ID: 1084331512

View in Genome Browser
Species Human (GRCh38)
Location 11:68433162-68433184
Sequence GCGCCCTCCTCAGGACCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084331512_1084331522 25 Left 1084331512 11:68433162-68433184 CCCTCTGGTCCTGAGGAGGGCGC 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1084331522 11:68433210-68433232 AGATGTGTGTTGCCGGGAGGAGG 0: 1
1: 0
2: 1
3: 16
4: 258
1084331512_1084331518 -4 Left 1084331512 11:68433162-68433184 CCCTCTGGTCCTGAGGAGGGCGC 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1084331518 11:68433181-68433203 GCGCAGTGGGCACTCAGGCGTGG 0: 1
1: 0
2: 1
3: 8
4: 138
1084331512_1084331521 22 Left 1084331512 11:68433162-68433184 CCCTCTGGTCCTGAGGAGGGCGC 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1084331521 11:68433207-68433229 AGCAGATGTGTGTTGCCGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 133
1084331512_1084331519 18 Left 1084331512 11:68433162-68433184 CCCTCTGGTCCTGAGGAGGGCGC 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1084331519 11:68433203-68433225 GCTGAGCAGATGTGTGTTGCCGG 0: 1
1: 0
2: 1
3: 17
4: 242
1084331512_1084331520 19 Left 1084331512 11:68433162-68433184 CCCTCTGGTCCTGAGGAGGGCGC 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1084331520 11:68433204-68433226 CTGAGCAGATGTGTGTTGCCGGG 0: 1
1: 0
2: 2
3: 20
4: 202
1084331512_1084331523 29 Left 1084331512 11:68433162-68433184 CCCTCTGGTCCTGAGGAGGGCGC 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1084331523 11:68433214-68433236 GTGTGTTGCCGGGAGGAGGAAGG 0: 1
1: 1
2: 4
3: 45
4: 408
1084331512_1084331517 -9 Left 1084331512 11:68433162-68433184 CCCTCTGGTCCTGAGGAGGGCGC 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1084331517 11:68433176-68433198 GGAGGGCGCAGTGGGCACTCAGG 0: 1
1: 0
2: 1
3: 25
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084331512 Original CRISPR GCGCCCTCCTCAGGACCAGA GGG (reversed) Intronic
900294618 1:1942717-1942739 ACGGCCTCCTCAGGACCACCTGG + Intronic
900410997 1:2512666-2512688 GGGGCCTCCTCAGAACCTGAGGG + Intronic
901661064 1:10798148-10798170 CTGGCCTCCTCAGGGCCAGAGGG - Intergenic
903344764 1:22677151-22677173 GCCCGCTCCCCAGGAGCAGATGG - Intergenic
912924801 1:113904771-113904793 GCTCCCACATCAGGACGAGAAGG - Exonic
915206506 1:154273971-154273993 GCTCTCACTTCAGGACCAGATGG - Intronic
915313861 1:155017454-155017476 GCTCCCTCCCCGGGGCCAGAGGG + Exonic
915535590 1:156533620-156533642 GTGCCCATGTCAGGACCAGAGGG + Intronic
915564007 1:156703944-156703966 GTGCCCTCCTCAGGCCCTGCAGG - Intronic
1067342901 10:45419037-45419059 GCCCTCTCCCCAGGACCACAGGG + Intronic
1070669320 10:78367061-78367083 CCGGCCTCCTCAGGCCCAGTGGG + Intergenic
1070785381 10:79159413-79159435 CAGCCCTGCTCAGGGCCAGACGG - Intronic
1071525734 10:86357138-86357160 GCCCACACCTCAGGTCCAGAAGG + Intronic
1071526648 10:86363311-86363333 GCGCCCACCTCCGGCCCAGGCGG + Intronic
1076632263 10:131858183-131858205 GCCCCTGCCTGAGGACCAGATGG - Intergenic
1076773280 10:132678931-132678953 GCAGCCTCCTCAGGCCCAGATGG + Intronic
1076851233 10:133094338-133094360 CCTCCATCCTCAGGGCCAGAAGG - Intronic
1077246959 11:1544366-1544388 GGGCCATCCCCAGCACCAGAAGG + Intergenic
1077996103 11:7453915-7453937 TCGCCCTCCTCAGGAGCACCAGG + Intronic
1078823448 11:14905555-14905577 GCGCCCTCCAAAGGAGCACAGGG - Intronic
1083632988 11:64105260-64105282 GAGCCCTCCTAGGGACTAGAGGG - Intronic
1084154096 11:67304105-67304127 GCTCTCTCCGCAGGACCAGGCGG + Exonic
1084331512 11:68433162-68433184 GCGCCCTCCTCAGGACCAGAGGG - Intronic
1084678550 11:70651408-70651430 ACGACCTCCCCAGGCCCAGAAGG + Intronic
1085176604 11:74493567-74493589 GCGCCCGCCTCAGTCCCCGACGG + Exonic
1086210841 11:84316973-84316995 ATGCCCTCCTCAGGACCAGGGGG - Intronic
1087140731 11:94763238-94763260 GAGCCTTTGTCAGGACCAGATGG - Intronic
1089438085 11:118488673-118488695 GCGCCCTCTGGAGGACCAGCTGG + Exonic
1089490103 11:118877622-118877644 GCTCCCTCCACAAGACCACACGG - Intergenic
1090928529 11:131274415-131274437 GTGCCCTCCCCAAGGCCAGATGG - Intergenic
1091335412 11:134762486-134762508 CCGCCATCCTCAGCACCGGAAGG - Intergenic
1091335421 11:134762521-134762543 CCGCCATCCTCAGCACCGGAAGG - Intergenic
1091335430 11:134762556-134762578 CCGCCATCCTCAGCACCGGAAGG - Intergenic
1092813203 12:12290535-12290557 ACACCCTCCTCAGGGCTAGAAGG + Intergenic
1096437264 12:51604434-51604456 GCGCCTTCCTCAATACCACACGG + Intronic
1096474085 12:51897315-51897337 CTGCCCTTCTCAGGACCAGAAGG - Intergenic
1096751482 12:53761576-53761598 CCACCCTCCTCAGGCCCACAAGG - Intergenic
1100932027 12:99619912-99619934 GCTCCCTCCTCAGCTCTAGAGGG - Intronic
1102647988 12:114415989-114416011 GGGCCTTCCCCAGTACCAGAAGG + Intergenic
1105068071 12:133217223-133217245 GAGCCCTGCTGAGGACAAGAGGG + Intergenic
1105070481 12:133231563-133231585 CCAGCCTCCTCATGACCAGACGG + Exonic
1108498423 13:51046691-51046713 GCTCACTCCCCAGGCCCAGAGGG - Intergenic
1110432949 13:75446927-75446949 GCACCCTCAGCAGGACCTGAGGG + Intronic
1113429845 13:110240505-110240527 GCGCCCTGCTTAGGACAGGAAGG - Intronic
1113892990 13:113746205-113746227 GCTCCCTGCTCAGGAACACAAGG - Intergenic
1117353643 14:54903144-54903166 GCCCCCTCTTCAGGCCAAGAGGG + Intergenic
1117971922 14:61259949-61259971 GAGCCTTCATCTGGACCAGAGGG + Intronic
1119438486 14:74612681-74612703 GCGCCCTCCGCAGGGCCGGCCGG + Intergenic
1122221193 14:100239909-100239931 GCGCTCACCTGAGGACCACATGG - Exonic
1122558250 14:102592829-102592851 GCCCCCTCCTCAGGAGCCGCGGG + Exonic
1122855162 14:104556566-104556588 GGGCTCTCCTCTGGCCCAGAGGG + Intronic
1123162086 14:106288091-106288113 GCCCCCTCCTCAGGATTACAGGG - Intergenic
1123180127 14:106461495-106461517 GCCCCCTCCTCAGGATTACAGGG - Intergenic
1124190263 15:27568927-27568949 GCCCCATCCTCAGGACCCCAGGG - Intergenic
1125918566 15:43510761-43510783 ACGCCCTCCCCAGTACCAGCGGG - Intergenic
1132727161 16:1343875-1343897 GCACCCTCCACAGGCCCAGTCGG - Intronic
1136229547 16:28878453-28878475 GCTCCCTCATAAGGACCAGCTGG + Exonic
1141039737 16:80662851-80662873 GCTCCCTCCTCACCACCAGATGG + Intronic
1141908964 16:87045591-87045613 ACGACCTCCACAGGAACAGAAGG + Intergenic
1142425650 16:90000935-90000957 GTGCCTTCCTCAGCACCACAGGG - Intergenic
1143669114 17:8383986-8384008 GCGTCCAGTTCAGGACCAGACGG + Intergenic
1144355997 17:14446915-14446937 TCAGCCTCCTCAGGACCACATGG - Intergenic
1144447512 17:15344624-15344646 CTGCCCTCCTCAGCACCAGCAGG - Intergenic
1144710508 17:17398668-17398690 GCAGCCTCCCCAGGACCACATGG - Intergenic
1144824849 17:18100070-18100092 CCTGCCTCCTCGGGACCAGAAGG + Intronic
1151568761 17:74915637-74915659 GGGCCCTCCAGAGGCCCAGAGGG - Intergenic
1152146097 17:78569790-78569812 GCCCCGTCTGCAGGACCAGAAGG - Intronic
1152204739 17:78968477-78968499 GCGCCCTGCTCAGGGCCCCATGG - Intergenic
1152290830 17:79439095-79439117 GGGCCCTGCTCAGCGCCAGAGGG - Intronic
1152899623 17:82932962-82932984 GCCCCCGCCTCAGCCCCAGATGG - Intronic
1152932847 17:83119137-83119159 CCGCCCTCCTCACGGACAGATGG + Intergenic
1157616091 18:48988660-48988682 ATGCCCACCACAGGACCAGAGGG - Intergenic
1160455271 18:78994880-78994902 GCTCCCTGCTCAGGAACAGCAGG - Exonic
1160951344 19:1669034-1669056 CTGCCCTCCCCAGGACCAGTGGG - Intergenic
1161857515 19:6773977-6773999 GGGCCAGCCTGAGGACCAGATGG - Intronic
1162018865 19:7859763-7859785 GCCACCTCCTCAGGCCCAAAGGG + Intronic
1163513909 19:17751620-17751642 TGGCCCCCCTCAGGAACAGAGGG + Intronic
1166774145 19:45302452-45302474 GCGCCCTCCTGAGGCCCTGATGG + Exonic
1166843583 19:45713017-45713039 GGGCCCTCCTCAGCAGCAGGGGG + Exonic
1167207218 19:48110711-48110733 TGGCCCTGCTCAGGACCAGGAGG - Exonic
927510171 2:23639396-23639418 GCCCCCTCCTCAGGTTCAGGGGG + Intronic
933843307 2:86305168-86305190 GCGCCCTCATGAGGCCCAGATGG + Intronic
934079907 2:88458855-88458877 CCTCCCACCTCAGGGCCAGAAGG + Intergenic
937880219 2:126858981-126859003 GCCCCCTCCTCACCACCACATGG + Intergenic
938387108 2:130874386-130874408 AGGCCCTCCTCAGGCCCACAAGG + Intronic
943876621 2:193074239-193074261 GCTCTCTCCCCAGGACCAGAGGG - Intergenic
944581591 2:201137194-201137216 GCCCCCACCTCAGGGGCAGACGG - Intronic
948059180 2:235030996-235031018 GCTTCCTCCCCAGGGCCAGAGGG - Intronic
948809555 2:240467634-240467656 GCGGCCTCCTCAGGGTCAGTCGG - Exonic
1168801028 20:643195-643217 CCGCCCTACCCTGGACCAGAAGG - Intergenic
1168970631 20:1928464-1928486 CAGCCCTGCTCAGGACCAGCTGG + Intronic
1169198972 20:3698430-3698452 GCACCCTGCTCAGCAGCAGATGG - Intronic
1171420378 20:25013764-25013786 GGGCCCTCCTCAGGGGCAGAGGG - Intronic
1172626493 20:36350385-36350407 GGGGCCTCCTCAGGGCCAGGTGG - Intronic
1180142433 21:45900533-45900555 GCGCCGTCCTCAGAGCCAGAGGG + Intronic
1185238262 22:49727035-49727057 GCGGCCACCCCAGCACCAGAAGG + Intergenic
1185371181 22:50461624-50461646 GCGCCCTCCTCACGCCCATCCGG + Exonic
952816885 3:37453482-37453504 GCCACATCCTCTGGACCAGAGGG + Intronic
953574432 3:44101636-44101658 GGGACCTTCTCAGGATCAGAGGG + Intergenic
953897323 3:46812338-46812360 GCGCTCCCCTCAGGGCCAGGCGG - Exonic
959739056 3:109695177-109695199 GCTCCCTGCTCAGCTCCAGAGGG + Intergenic
962212441 3:133490663-133490685 GTGGGCTCCTCAGCACCAGAGGG - Intergenic
964778830 3:160312206-160312228 GCGGCCTGCTCAGTTCCAGAGGG - Intronic
965519474 3:169658694-169658716 GCCACTTCCTCAGCACCAGACGG + Intronic
968611473 4:1559074-1559096 CTGCCCTCCCCACGACCAGAAGG + Intergenic
969871026 4:10104948-10104970 GACCCCTCCTCAAGACCTGAGGG + Intronic
985074794 4:186203781-186203803 GCGCCGACCTCAGGACCTGTAGG + Intronic
985440552 4:189980427-189980449 ACGCCCTCCTCAGACCCAGGTGG + Intergenic
985782344 5:1877960-1877982 CCGCCCGCCTCAGGCGCAGAAGG + Exonic
985840279 5:2300639-2300661 CCACCCTGCTCAGGACCAGCGGG + Intergenic
986298343 5:6457755-6457777 GACACCTCCTCAGGACCAGGTGG - Intronic
994351287 5:98749189-98749211 GCTCTCTCCTCATGACCAGCAGG - Intergenic
999311243 5:150553571-150553593 GCGGCCTCCCCAGGAGCAGCTGG - Exonic
1001558171 5:172650368-172650390 GCTCTGTTCTCAGGACCAGAGGG + Intronic
1002536429 5:179878664-179878686 GCACCCTCCCCAGGAGCACAAGG - Intronic
1006093217 6:31640446-31640468 GAGCCCCCCTCAGGAGCAGGAGG + Exonic
1006397546 6:33796996-33797018 GCTCCCTCCTCAGGAGCCCAGGG + Intronic
1006694749 6:35921213-35921235 GCCCCCTCCTCGGGAGCAGGTGG - Exonic
1015184354 6:130396891-130396913 TCACCCTCCTCAGAACCAGTAGG + Intronic
1015281693 6:131441589-131441611 GAGACCTCCTCAGGACAGGATGG + Intergenic
1018722583 6:166584178-166584200 GGGCCCTCACCAGGACCAAATGG - Intronic
1018837947 6:167498980-167499002 GCGCCCTGCCCAGGACCTGCTGG - Intergenic
1023766984 7:43520973-43520995 GCACCTGCCTCAGGACCTGAAGG - Intronic
1025690505 7:63751384-63751406 GTGGCCTCCTCAGGCCCAGGGGG + Intergenic
1034164081 7:149012504-149012526 GCGCCCTCAACAGCACCTGAGGG - Intronic
1035258224 7:157645731-157645753 GCCCCCTCCCCAGGGCCAGCCGG - Intronic
1040689224 8:49913899-49913921 GTTCCCTCCTCAGGGGCAGAGGG + Intronic
1041445564 8:57948184-57948206 GCTCCCTGCTCAGCTCCAGAGGG + Intergenic
1041833227 8:62180532-62180554 GCGCCCTCCCCATGACCCAAAGG - Intergenic
1046695293 8:117333085-117333107 GCTCCCTCCTCAGTACCAGCTGG - Intergenic
1048881653 8:138877006-138877028 GCGCCCTCCCCAGGACAGGAAGG - Intronic
1058144704 9:101398830-101398852 CCGCCCGCCCCCGGACCAGAAGG - Intergenic
1060022166 9:120141064-120141086 ACTCCCTTCTCAGGTCCAGAAGG - Intergenic
1062287159 9:135778357-135778379 CTGCCCTCCTCAGGCCCAGTGGG - Intronic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1192563078 X:72140213-72140235 GCATACTCCTCAGGAACAGATGG - Exonic