ID: 1084331785

View in Genome Browser
Species Human (GRCh38)
Location 11:68434688-68434710
Sequence CCTTTTATGAAGGACCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 149}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084331779_1084331785 -3 Left 1084331779 11:68434668-68434690 CCGCGCCCGGCCTGAGTTTTCCT 0: 1
1: 0
2: 31
3: 376
4: 2356
Right 1084331785 11:68434688-68434710 CCTTTTATGAAGGACCTGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 149
1084331781_1084331785 -9 Left 1084331781 11:68434674-68434696 CCGGCCTGAGTTTTCCTTTTATG 0: 1
1: 1
2: 13
3: 68
4: 641
Right 1084331785 11:68434688-68434710 CCTTTTATGAAGGACCTGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 149
1084331775_1084331785 28 Left 1084331775 11:68434637-68434659 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1084331785 11:68434688-68434710 CCTTTTATGAAGGACCTGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 149
1084331778_1084331785 0 Left 1084331778 11:68434665-68434687 CCACCGCGCCCGGCCTGAGTTTT 0: 1
1: 80
2: 944
3: 5529
4: 19711
Right 1084331785 11:68434688-68434710 CCTTTTATGAAGGACCTGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 149
1084331780_1084331785 -8 Left 1084331780 11:68434673-68434695 CCCGGCCTGAGTTTTCCTTTTAT 0: 1
1: 0
2: 10
3: 166
4: 1523
Right 1084331785 11:68434688-68434710 CCTTTTATGAAGGACCTGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 149
1084331776_1084331785 27 Left 1084331776 11:68434638-68434660 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1084331785 11:68434688-68434710 CCTTTTATGAAGGACCTGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084331785 Original CRISPR CCTTTTATGAAGGACCTGCT TGG Intronic
901026367 1:6280666-6280688 CCTCTGCTGAAGGGCCTGCTGGG - Intronic
904040835 1:27584021-27584043 ACTAATATGAAGCACCTGCTGGG - Intronic
904081222 1:27873590-27873612 CCCTTCATGAGGGACCTCCTTGG - Intronic
907331936 1:53677278-53677300 CCTTCCATGAAGGACCAGCAGGG + Intronic
909817814 1:80018549-80018571 CATTTTATAAAGCAACTGCTCGG + Intergenic
911947126 1:104126058-104126080 TCTTTCATGAAGGACCTGGTAGG + Intergenic
912017521 1:105060472-105060494 CATTTAATGAATGCCCTGCTGGG - Intergenic
913528849 1:119718726-119718748 CCATTTATTGAGCACCTGCTGGG - Intronic
913690294 1:121273368-121273390 TCTATTCTGAAGGATCTGCTGGG + Intronic
914147248 1:145006591-145006613 TCTATTCTGAAGGATCTGCTGGG - Intronic
920477614 1:206291856-206291878 TCTATTCTGAAGGATCTGCTGGG + Intronic
921307598 1:213812752-213812774 GCTTCTATGAAAGACCTGGTAGG + Intergenic
922556858 1:226539164-226539186 CCTTATCTGCAGGACTTGCTTGG + Intergenic
923388863 1:233493526-233493548 CCTTTGATTAAGGAGTTGCTGGG - Intergenic
1064118296 10:12597490-12597512 CCTACCATGAGGGACCTGCTAGG - Intronic
1066225308 10:33377005-33377027 ACTTTTTTGAATGGCCTGCTAGG + Intergenic
1066809030 10:39300662-39300684 TCTTTTTTGATGGACCTGTTTGG - Intergenic
1067364968 10:45617863-45617885 CGTCTTATGATGAACCTGCTTGG - Intronic
1067758402 10:49024653-49024675 CCTTTTATGGGGCAGCTGCTGGG - Intronic
1069495867 10:68902712-68902734 CCTTTTTTAAAATACCTGCTTGG - Intronic
1070305821 10:75238621-75238643 CCCTTTATTGAGGACCTGCCGGG + Intergenic
1070346509 10:75547901-75547923 TGGTTTATGTAGGACCTGCTGGG + Intronic
1070351590 10:75597798-75597820 CTTTTTCTGAATTACCTGCTGGG + Intronic
1071229085 10:83564406-83564428 CCTTTGGTGAAGGAGCTCCTGGG + Intergenic
1072525772 10:96270218-96270240 CCTTTTACCAAGCACCTCCTAGG + Intronic
1074219174 10:111419642-111419664 CCTTTTATGAGGTACATCCTGGG - Intergenic
1075408952 10:122213195-122213217 GCTTTTTGGAAGGAGCTGCTGGG - Intronic
1079445694 11:20554516-20554538 CCTCTTATGGAGTCCCTGCTGGG - Intergenic
1079969123 11:27014959-27014981 CATTTTATCAAGGACATGCAAGG - Intergenic
1081885782 11:46494879-46494901 CCATTTATTAAGTATCTGCTAGG + Intronic
1084331785 11:68434688-68434710 CCTTTTATGAAGGACCTGCTTGG + Intronic
1084606588 11:70175831-70175853 TCTTTTATGAAAGCCCTGTTGGG - Intronic
1084812705 11:71624456-71624478 CATTGTATGAAGGAACTGCAGGG - Intergenic
1085230226 11:74961199-74961221 ATTTTTATGAAGTACTTGCTAGG + Intronic
1085644743 11:78215820-78215842 CATTTTATGAAGGCCCAGATGGG + Exonic
1085962060 11:81472588-81472610 ACTGTTATGAAGAACCTACTAGG - Intergenic
1086734753 11:90292333-90292355 ACTATTAAGAAGCACCTGCTAGG + Intergenic
1088770149 11:113026759-113026781 TCATTTATTAAGCACCTGCTAGG + Intronic
1091830069 12:3543208-3543230 CCTTTAATGCAGGAACAGCTAGG + Intronic
1092731275 12:11537371-11537393 CCTTTTATTTAGGACTTTCTTGG + Intergenic
1093853049 12:24064400-24064422 CCTTTTCTGATGGAACTGATCGG - Intergenic
1096793001 12:54056709-54056731 ACTTTTATTATGGACCTGCCAGG + Intergenic
1098574231 12:72022897-72022919 CCTTTTAGGAAGTAGATGCTGGG - Intronic
1101256126 12:102978456-102978478 CCTATGATTAATGACCTGCTAGG + Intergenic
1101729632 12:107416302-107416324 CCTTTTATTGAGCACCTGCCAGG + Intronic
1104081107 12:125431178-125431200 CCTTTTTTGAAAGATCTGCTTGG + Intronic
1107130579 13:36890503-36890525 TGTTTTCTGAAGGACATGCTGGG - Intronic
1108114577 13:47112801-47112823 CCTATTATGTAGGACCAGATAGG + Intergenic
1108609251 13:52068113-52068135 GCTTTTATGAGGAACCTGATAGG - Intronic
1113251602 13:108458755-108458777 GCTTTTATGAAGGAACATCTTGG - Intergenic
1118951033 14:70436935-70436957 AGTTTTATCAAGGCCCTGCTAGG + Intergenic
1122956814 14:105075045-105075067 TCTTCTGTGAAGTACCTGCTGGG + Intergenic
1202833296 14_GL000009v2_random:59105-59127 CCCTTTATGAATGACTTGCAAGG - Intergenic
1125313139 15:38402421-38402443 CCTTTTATTTAGCACCTCCTAGG - Intergenic
1127921698 15:63499663-63499685 CCTTTTATGAAGGAGATGAGGGG - Intergenic
1129229952 15:74191576-74191598 GTTTTTATGGAGCACCTGCTTGG - Intronic
1130994715 15:88897390-88897412 CCTTTTATTCAGACCCTGCTAGG + Intergenic
1133762974 16:8814402-8814424 GCATTTATGATGCACCTGCTAGG - Intronic
1134783925 16:16923677-16923699 CCCTTTATGAATGTGCTGCTTGG - Intergenic
1136621735 16:31433981-31434003 CCTGTTCTGTAGGCCCTGCTGGG + Intronic
1138161960 16:54762857-54762879 CGTTTTCTAAAGGACCTGCCAGG - Intergenic
1139216197 16:65125939-65125961 CCTTTGATGAAGGAACTGACAGG - Intronic
1139410722 16:66758222-66758244 ACATTTATTAAGCACCTGCTAGG - Intronic
1141111796 16:81276144-81276166 CCATTCATGGAGGACCCGCTAGG + Intronic
1143180174 17:4979840-4979862 CCTTGTTTGGAGGACCTGTTGGG - Exonic
1144528791 17:16015893-16015915 CAATTTATGAAGGACCTTCCTGG + Intronic
1145960930 17:28886180-28886202 CCTTTTAGTGAGGACCTGCTAGG + Intronic
1153085207 18:1278337-1278359 CTTTTTACCCAGGACCTGCTGGG - Intergenic
1159006644 18:63019374-63019396 TCTTTCAGGGAGGACCTGCTAGG - Intergenic
1159524555 18:69570629-69570651 TCTTTTATGAAAGACCTGGTAGG - Intronic
1161255464 19:3306646-3306668 ACATTTATGAAGCACCTACTGGG + Intergenic
926756855 2:16243472-16243494 CCTTGAATCAAGGAGCTGCTTGG + Intergenic
930250792 2:49031994-49032016 ACATTTATGGAGTACCTGCTGGG - Intronic
930956890 2:57213641-57213663 CCATTTATGAAGCACATGCTGGG - Intergenic
932557816 2:72841107-72841129 CCATTTATGAAGCACCTGCTGGG + Intergenic
934879868 2:97966899-97966921 TCTTATATGAGGGACCTGCCTGG - Intronic
938983974 2:136554928-136554950 ATATTCATGAAGGACCTGCTAGG + Intergenic
939247089 2:139639255-139639277 CCTTTTATGATGGCTCTGGTTGG - Intergenic
944969889 2:204980166-204980188 CATTTTATGAAGTGCCTGTTAGG - Intronic
945407407 2:209466515-209466537 ACATTTATCAAGGACCTACTAGG + Intronic
947816727 2:233042344-233042366 CCTTTTCTGTATCACCTGCTAGG + Intergenic
1170092487 20:12605602-12605624 CCTTATATGAAGGAGAGGCTGGG - Intergenic
1175113074 20:56662709-56662731 GCTGTTATAAAGGAGCTGCTGGG + Intergenic
1177541773 21:22502677-22502699 CCTGTTAACAAGAACCTGCTAGG + Intergenic
1180397578 22:12368085-12368107 CCCTTTTTGTAGGATCTGCTAGG - Intergenic
1180402143 22:12496050-12496072 CCCTTTTTGTAGGATCTGCTAGG + Intergenic
1184223926 22:43118341-43118363 GCTTTTATGGAGCCCCTGCTAGG + Intronic
949101182 3:147248-147270 TCTTTTATGATGGACTAGCTAGG + Intergenic
952116102 3:30183540-30183562 TCATTTATGAAGGATCTTCTAGG - Intergenic
953497539 3:43401208-43401230 GCATTTATGAAGGACGTGCTAGG + Intronic
953720716 3:45352496-45352518 CCATTTATTAAGCACCTGCCTGG + Intergenic
955121219 3:56060566-56060588 GCCTTTATGAAGCACCTGTTGGG - Intronic
955617783 3:60827088-60827110 CCTTTCAAGAATGACCTCCTTGG - Intronic
955730826 3:61984639-61984661 CCTTTTGACAAGGACCTACTAGG + Intronic
959605802 3:108240682-108240704 CCTTTTGTAAAGGATTTGCTAGG + Intergenic
962234816 3:133698932-133698954 CCTTTGATGCAGAGCCTGCTGGG - Intergenic
962373921 3:134844617-134844639 GCTGATATGAAGGTCCTGCTAGG - Intronic
967822512 3:193851328-193851350 CCTTTTATCCTGGAGCTGCTAGG + Intergenic
971567155 4:28159952-28159974 CCCTTAATGAAGGAACTGCAAGG - Intergenic
972209398 4:36818994-36819016 CATTTTATTAAGCACCTGCTGGG + Intergenic
973135637 4:46702964-46702986 TCTTTCATGAATTACCTGCTTGG - Intergenic
978054782 4:104249661-104249683 CCTCTTCTGCAGGAGCTGCTGGG + Intergenic
978321653 4:107503113-107503135 CGTTGTGTGAAGGACCTGGTAGG - Intergenic
978455305 4:108882978-108883000 TGTTTTATGAAGGTTCTGCTTGG - Intronic
978468331 4:109033021-109033043 TCCTTTATGGAGGACCTGGTGGG - Intronic
979146562 4:117253904-117253926 CTTTTTAAGAAGAAACTGCTGGG - Intergenic
979770331 4:124516421-124516443 ATTTTTATGAGGGACTTGCTAGG - Intergenic
979883943 4:126000134-126000156 CCTTTAATGAAGGATCTTCAAGG + Intergenic
982531122 4:156545328-156545350 TCTTATATGAATGACCTGGTTGG + Intergenic
986925860 5:12749659-12749681 TCTTTTATGAAGGACATGGCAGG + Intergenic
987555541 5:19442136-19442158 CCAATTATGAATGCCCTGCTTGG - Intergenic
989260725 5:39417039-39417061 GCTTTAATGACGGATCTGCTTGG + Intronic
989422560 5:41256794-41256816 CCTTTTATCAAGGAGCTGGCTGG - Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997283700 5:132663868-132663890 CCTTCTAAGAAGGTCCGGCTGGG + Intergenic
997389101 5:133498838-133498860 CTTTTTATTGAGCACCTGCTGGG + Intronic
1000180067 5:158800372-158800394 TCTTTTTATAAGGACCTGCTGGG - Intronic
1000292113 5:159880119-159880141 CCATTTATGAAGGCCCTTTTTGG + Intergenic
1001978476 5:176020813-176020835 CCTTTTATGAGCAACATGCTTGG - Intronic
1002238941 5:177822949-177822971 CCTTTTATGAGCAACATGCTTGG + Intergenic
1004554869 6:16686278-16686300 CCTTTTAGGAAAGACCTGGAAGG - Intronic
1011822804 6:91272684-91272706 CCTTTTATTAAGCACCTAATAGG + Intergenic
1012980038 6:105819516-105819538 ACGTTTATCAAGGACCTACTAGG + Intergenic
1015357976 6:132302669-132302691 ATTTTTAAAAAGGACCTGCTGGG - Intronic
1015674707 6:135732312-135732334 CATTTTTTGAATGACCTGTTTGG + Intergenic
1015954756 6:138588073-138588095 GGTTTTATGGAGTACCTGCTAGG - Intronic
1017124917 6:151056437-151056459 CTTTTTCTGAAAGGCCTGCTTGG + Intronic
1022563488 7:31373721-31373743 ACTTTCATGGAGGACCTACTAGG + Intergenic
1025523201 7:61768021-61768043 CGGTTTTTGAAGGACCTGCAAGG - Intergenic
1025546955 7:62187049-62187071 CGGTTTTTGAAGGACCTGCAAGG - Intergenic
1032452191 7:132042519-132042541 CTTTTTATGCATTACCTGCTAGG + Intergenic
1033211458 7:139463062-139463084 CCTTTTAAGAAGAAATTGCTGGG - Intronic
1034034063 7:147801816-147801838 CCTGTTCTCAATGACCTGCTGGG + Intronic
1035381417 7:158443706-158443728 ACTTTTAGGAAGGACCTCATGGG - Intronic
1035448818 7:158961405-158961427 CCTTTCCTGGAGGAGCTGCTTGG - Intergenic
1036507248 8:9366860-9366882 CCTTTTAACAGGGACCTCCTAGG - Intergenic
1036550692 8:9812898-9812920 CATTTTAGGAAGCACCTACTGGG - Intergenic
1037416442 8:18655755-18655777 CCTTTTATGAAGGAATTACTTGG - Intronic
1040104212 8:43531190-43531212 CATTTTATGACAGCCCTGCTAGG + Intergenic
1043215945 8:77588155-77588177 CCGTTTATGAAGCACATGATAGG - Intergenic
1044795036 8:95887911-95887933 CCTTTTATTGAGCACCTACTAGG - Intergenic
1050692751 9:8246732-8246754 CCTTTAATGAAGGACATGAAAGG - Intergenic
1051213044 9:14765630-14765652 GCTTTTATGAAACACCTGATAGG - Intronic
1056314446 9:85374453-85374475 CCTTGAATGAAGGAGCGGCTGGG - Intergenic
1056993228 9:91430298-91430320 CCATTTATGGAGCACCTGCTGGG + Intergenic
1061875436 9:133541196-133541218 CCCTTTGTTGAGGACCTGCTGGG + Intronic
1188323564 X:28771565-28771587 CCTTTAATGGAGAACCTGTTAGG + Intronic
1189444101 X:41065041-41065063 CCTTTTATGAAGGATAGTCTGGG + Intergenic
1191955976 X:66642665-66642687 CCTTTCATGAAGGAGCTTCATGG + Intergenic
1192305676 X:69957189-69957211 CCTTTTAAGAACTACCTTCTTGG + Intronic
1198304586 X:135368122-135368144 CATTTAATGACTGACCTGCTGGG - Intergenic
1198676617 X:139138087-139138109 CCATTTATGAAGCACTTACTGGG + Intronic
1198808641 X:140512331-140512353 CCTTTCATGAAAGTCCAGCTTGG - Intergenic
1200706879 Y:6450567-6450589 CATTATGTGAAGCACCTGCTGGG + Intergenic
1200917201 Y:8581793-8581815 CACCTTATGAAGCACCTGCTTGG - Intergenic
1201027233 Y:9714141-9714163 CATTATGTGAAGCACCTGCTGGG - Intergenic
1201240615 Y:11954127-11954149 CCTTTTATTCAGGCGCTGCTAGG - Intergenic
1202264180 Y:23000726-23000748 CCTTTTATGAAGGCCCAGGAAGG - Intronic
1202417172 Y:24634468-24634490 CCTTTTATGAAGGCCCAGGAAGG - Intronic
1202453615 Y:25035618-25035640 CCTTTTATGAAGGCCCAGGAAGG + Intronic