ID: 1084332454

View in Genome Browser
Species Human (GRCh38)
Location 11:68438054-68438076
Sequence GTGGCTGGTGGGCGGCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 230}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084332441_1084332454 -6 Left 1084332441 11:68438037-68438059 CCGACCCTGCCCCTCCCGTGGCT 0: 1
1: 1
2: 4
3: 55
4: 591
Right 1084332454 11:68438054-68438076 GTGGCTGGTGGGCGGCACCAGGG 0: 1
1: 0
2: 0
3: 11
4: 230
1084332436_1084332454 3 Left 1084332436 11:68438028-68438050 CCCACCCAGCCGACCCTGCCCCT 0: 1
1: 0
2: 1
3: 53
4: 499
Right 1084332454 11:68438054-68438076 GTGGCTGGTGGGCGGCACCAGGG 0: 1
1: 0
2: 0
3: 11
4: 230
1084332443_1084332454 -10 Left 1084332443 11:68438041-68438063 CCCTGCCCCTCCCGTGGCTGGTG 0: 1
1: 0
2: 1
3: 32
4: 376
Right 1084332454 11:68438054-68438076 GTGGCTGGTGGGCGGCACCAGGG 0: 1
1: 0
2: 0
3: 11
4: 230
1084332437_1084332454 2 Left 1084332437 11:68438029-68438051 CCACCCAGCCGACCCTGCCCCTC 0: 1
1: 1
2: 9
3: 89
4: 671
Right 1084332454 11:68438054-68438076 GTGGCTGGTGGGCGGCACCAGGG 0: 1
1: 0
2: 0
3: 11
4: 230
1084332439_1084332454 -2 Left 1084332439 11:68438033-68438055 CCAGCCGACCCTGCCCCTCCCGT 0: 1
1: 0
2: 2
3: 34
4: 415
Right 1084332454 11:68438054-68438076 GTGGCTGGTGGGCGGCACCAGGG 0: 1
1: 0
2: 0
3: 11
4: 230
1084332438_1084332454 -1 Left 1084332438 11:68438032-68438054 CCCAGCCGACCCTGCCCCTCCCG 0: 1
1: 0
2: 3
3: 33
4: 410
Right 1084332454 11:68438054-68438076 GTGGCTGGTGGGCGGCACCAGGG 0: 1
1: 0
2: 0
3: 11
4: 230
1084332435_1084332454 11 Left 1084332435 11:68438020-68438042 CCAAGGAGCCCACCCAGCCGACC 0: 1
1: 0
2: 2
3: 17
4: 203
Right 1084332454 11:68438054-68438076 GTGGCTGGTGGGCGGCACCAGGG 0: 1
1: 0
2: 0
3: 11
4: 230
1084332432_1084332454 29 Left 1084332432 11:68438002-68438024 CCTTGATAGTGGAGTGGCCCAAG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1084332454 11:68438054-68438076 GTGGCTGGTGGGCGGCACCAGGG 0: 1
1: 0
2: 0
3: 11
4: 230
1084332434_1084332454 12 Left 1084332434 11:68438019-68438041 CCCAAGGAGCCCACCCAGCCGAC 0: 1
1: 0
2: 0
3: 18
4: 131
Right 1084332454 11:68438054-68438076 GTGGCTGGTGGGCGGCACCAGGG 0: 1
1: 0
2: 0
3: 11
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084332454 Original CRISPR GTGGCTGGTGGGCGGCACCA GGG Intronic
900339175 1:2179745-2179767 GCTGCTGGTGGGAGGCCCCAGGG + Intronic
900580430 1:3405918-3405940 GTGGGTGATGGGAGGGACCAGGG + Intronic
901020710 1:6253951-6253973 GCTGCTGGTGGGCGGCAGCGTGG - Exonic
901767936 1:11515651-11515673 GTGGGTGGTGGGCGGATCCTTGG + Intronic
901810937 1:11766485-11766507 GCAGCTGGTGGACGGCAGCACGG - Exonic
901875630 1:12165661-12165683 GGGGCTGGTGGCCGGGAGCAAGG + Intergenic
901884200 1:12211273-12211295 GTCACTGCTGGGCAGCACCAAGG - Intergenic
903349497 1:22709782-22709804 CTGGATGGTGGGCGGCTGCAGGG - Intergenic
904455138 1:30642962-30642984 GTTGCTGGGGGGCAGCCCCACGG - Intergenic
904494073 1:30876996-30877018 GGGGCTGGTGGCTGGCTCCAGGG + Exonic
904912273 1:33944309-33944331 GGGGCGAGTGGGCTGCACCAGGG + Intronic
905890810 1:41517195-41517217 CTGCCTGGTGGGCTGGACCAGGG - Intronic
907290725 1:53411010-53411032 GTGGCTGGTGGGGGAGAGCAGGG + Intergenic
907758318 1:57332863-57332885 GTGGCTGGTGGGAGGCAGACAGG - Intronic
910759955 1:90723984-90724006 CTGGTTGCTGAGCGGCACCAGGG - Intergenic
913202977 1:116511065-116511087 GTGGTTGTTGGGAGGCACCCTGG + Intergenic
915735665 1:158083343-158083365 GTGACTGGTGGGGGCCACCATGG + Intronic
919803919 1:201369556-201369578 TTGGGTGGTGGGAGGGACCAAGG - Intronic
922159974 1:223072406-223072428 GTGGGTAGAGGGAGGCACCAAGG + Intergenic
922478880 1:225924725-225924747 GTGGCGGCGAGGCGGCACCAGGG + Intergenic
922605171 1:226885686-226885708 GTGGCTGGAGGGCAGGGCCAGGG - Intronic
1063099138 10:2934610-2934632 GTTGCAGGTGGGTGGCCCCAGGG - Intergenic
1066653787 10:37681612-37681634 GGGTCTGGTGGGCAGCCCCACGG - Intergenic
1067217665 10:44316499-44316521 ATGGCTAGTGGGAGGGACCAAGG - Intergenic
1067764661 10:49075828-49075850 GCTTCTGGTGGGTGGCACCAAGG + Intronic
1067945534 10:50686065-50686087 GTGGGTGGTGGGAGGGATCAGGG - Intergenic
1068920038 10:62473871-62473893 GTGGCTGGTTGACAGCACCAAGG + Intronic
1069942824 10:71966573-71966595 AAGGCATGTGGGCGGCACCAAGG + Intronic
1070566310 10:77606104-77606126 GAGGCTGGAGGGCTGCACCAAGG - Intronic
1070747969 10:78946299-78946321 AAGGCTGGTGTGCTGCACCACGG + Intergenic
1071492112 10:86143275-86143297 GTGGCAGGAGGGCTGCAGCATGG - Intronic
1071633959 10:87235161-87235183 GTGGGTGGTGGGAGGGATCAGGG - Intronic
1071647407 10:87367378-87367400 GTGGGTGGTGGGAGGGATCAGGG - Intronic
1073116703 10:101095504-101095526 GAGGCTGTTGGGTGGCCCCAGGG + Intronic
1073178174 10:101569142-101569164 GAGGGGGGTGGGGGGCACCAGGG + Intergenic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1073458355 10:103651227-103651249 TTACCTGGTGGGCAGCACCAAGG - Intronic
1075405529 10:122193220-122193242 GTGGCTGGTTGGAGGAGCCAAGG + Intronic
1075782092 10:125023614-125023636 GGGGCTGGTGGGCCGCACTGGGG + Intronic
1076724861 10:132408565-132408587 GTGGCCGGTGGGCGGGAGCTGGG - Intronic
1076788166 10:132761558-132761580 ATGGCTGGTGGGGGACAGCACGG + Intronic
1076868569 10:133181550-133181572 GTGCCAGGTGGGCTGCCCCAGGG + Intronic
1079251895 11:18792726-18792748 GTGGATGGTGGCTGGAACCAGGG - Intergenic
1079342828 11:19627409-19627431 GTGCCTGTTGGGCTGGACCAAGG + Intronic
1081783198 11:45727763-45727785 GTGGGTGCTGGGCTGCCCCAAGG + Intergenic
1082101145 11:48174115-48174137 GTGGCTGAAAGGGGGCACCAAGG - Intergenic
1083854181 11:65384262-65384284 ATAGCAGGTGGGTGGCACCATGG - Intergenic
1084332454 11:68438054-68438076 GTGGCTGGTGGGCGGCACCAGGG + Intronic
1085184124 11:74560911-74560933 GTGGCTGGAAGGAGGCACAAAGG - Intronic
1087069320 11:94061308-94061330 GTGGCTGATGGGTGGCACTGTGG + Intronic
1090665752 11:128914044-128914066 GTGGCAGGTGGGCAGCCCCGGGG + Intronic
1092263301 12:6963553-6963575 GTGGCTGGTGGCGGGCAGCAGGG + Intergenic
1093649740 12:21629297-21629319 GTGGTTGGTGGGAGGAAGCATGG - Intergenic
1096587786 12:52634350-52634372 ATGGCTGGAGGCCGGGACCATGG - Intergenic
1099661452 12:85568449-85568471 GTGGCTGCTGGACCTCACCACGG + Intergenic
1100663112 12:96722122-96722144 GTGGTTGGTGGGTGGCACTGAGG - Intronic
1101656239 12:106722930-106722952 GTGGCTGGGGGAGGGGACCAAGG - Intronic
1102204594 12:111081927-111081949 GAGGCTGGAGGGCTGCACCTGGG - Intronic
1102640455 12:114362076-114362098 GTGGCTGGTTGGCGATAACAAGG - Intronic
1103320039 12:120087098-120087120 GTGGCTGTCGTGGGGCACCACGG + Intronic
1104635952 12:130437916-130437938 GTGCCTGGTGTGGGGAACCAAGG - Intronic
1104821274 12:131678961-131678983 GTGGCTGGCGGCCGGCACGTAGG + Intergenic
1104933947 12:132354705-132354727 GTGGCTGGTCGGCGGGGGCAGGG - Intergenic
1107992975 13:45834568-45834590 ATGGCTGGTGGGCAGCATCCCGG + Intronic
1108683998 13:52803270-52803292 GGTGCTGGTGGCTGGCACCAGGG + Intergenic
1110572917 13:77026477-77026499 GGGGCTGGTGACAGGCACCATGG - Intronic
1112091770 13:96090703-96090725 GTGGCTGGCTGGCGGCCCCGCGG - Intergenic
1112359961 13:98708532-98708554 GTGGGCAGTGGGAGGCACCATGG - Intronic
1113418165 13:110147432-110147454 GTTGCTGGTGGAAGGCAGCATGG + Intergenic
1113720586 13:112553088-112553110 GTGGCTGGTGGGGAGGAGCATGG - Intronic
1113720610 13:112553209-112553231 GTGGCTGGTGGGCAGGAACGTGG - Intronic
1113925028 13:113936769-113936791 GTCGCTTCTGGGTGGCACCAGGG + Intergenic
1114539956 14:23447743-23447765 GTGGCTGGGGGGCTCCACTAAGG + Intergenic
1118749565 14:68795943-68795965 GTGGCGGGAGGGCGGCCCTACGG + Intronic
1119055178 14:71412208-71412230 GTGGCTCGTGGGCTGCAGGATGG - Intronic
1119757412 14:77128818-77128840 GTGGCTGGTGAGCAGGCCCAAGG + Intronic
1120158512 14:81120232-81120254 TTGGCTGGTGGGCATTACCATGG - Intronic
1121097060 14:91224800-91224822 GAAGCTGGTGGACGTCACCACGG + Exonic
1122016574 14:98801953-98801975 ATCGCTGGTGGGAGGAACCATGG + Intergenic
1122447663 14:101781478-101781500 GAGGCTGGGGGGCGGCAGGAGGG - Intronic
1122594412 14:102879200-102879222 GTGACTGAAGGGAGGCACCAGGG + Intronic
1122904000 14:104793652-104793674 TTGGCTGGTGGGCCGCTGCAGGG - Exonic
1125313852 15:38409854-38409876 GTGGCTGGTGGTGGGAGCCATGG + Intergenic
1128941582 15:71791941-71791963 GTGGCTGGTGTGCAGTAGCAAGG - Intergenic
1129736953 15:77971976-77971998 CAGGCTGTTGGGCGGCACCCTGG - Intergenic
1130894196 15:88157868-88157890 GAGGCTGGTAGCTGGCACCAGGG + Intronic
1131109838 15:89758370-89758392 CTGGCTGGTGGGAGGCGGCAGGG - Intergenic
1131838087 15:96409880-96409902 GGGGCTGGTGGGCGGCGCGGCGG - Intergenic
1132101940 15:99029785-99029807 GGGGCTGGTGGGTCTCACCAAGG - Intergenic
1132598157 16:762514-762536 GTGGCTGGAGGGCAGGGCCAGGG + Intronic
1132975888 16:2711041-2711063 CTGCCAGGTGGGCGGCAGCAGGG - Intergenic
1135890354 16:26351597-26351619 GTGGCTGGTGGGTTGTTCCAGGG - Intergenic
1136019740 16:27432473-27432495 GTGGCAGGGAGGTGGCACCAGGG - Intronic
1136366035 16:29809706-29809728 GTGGCTGGGGGGCGTCTCCCGGG - Exonic
1136705885 16:32187942-32187964 GGGGTTGGCGGGCGGCACAAGGG - Intergenic
1139581847 16:67878464-67878486 GTGGGTGGTGGGCTGGACCATGG + Intronic
1141436447 16:84002362-84002384 GGGGCTGGTGGGCTCCTCCACGG - Exonic
1141928841 16:87186881-87186903 GTGGCTGGTGTAGGGCAACAGGG - Intronic
1142195654 16:88738169-88738191 GAGCCAGGTGGGCGGGACCAGGG + Intronic
1142291091 16:89193864-89193886 GGGGCTGGTGGGCAGCACTCGGG - Exonic
1203064186 16_KI270728v1_random:1001779-1001801 GGGGTTGGCGGGCGGCACAAGGG + Intergenic
1142757589 17:2025071-2025093 GGGGCTGCCGGGCAGCACCACGG - Exonic
1143027850 17:3951565-3951587 GTGGCAGGTGGGAGGCACTGGGG - Exonic
1143565434 17:7717684-7717706 GTGGCCGGTGTGCGGCCCCTCGG - Exonic
1143631718 17:8143717-8143739 GTGGCTGGTGGGGTGGGCCAGGG + Exonic
1144211674 17:13021120-13021142 GTGGCTGCTGGGTGGCTCAATGG + Intergenic
1145778592 17:27546643-27546665 GTGCCTGGTGGGCAGGGCCAGGG + Intronic
1145786484 17:27597203-27597225 GTGGCTGGTGGGAGGCAGGTGGG + Intronic
1147995672 17:44359106-44359128 GTGGCTGGTGCTGGGAACCACGG - Intronic
1148446735 17:47742642-47742664 GTGGCTGGTGGGCTCCAGCCCGG - Exonic
1148778746 17:50110153-50110175 GAGGATGGTGAGGGGCACCACGG - Exonic
1149186301 17:54001710-54001732 GTGGCTGGAGGGAGGCTACATGG - Intergenic
1149478875 17:56985786-56985808 GTGGCTGGAGGGTGCAACCATGG - Intronic
1151341197 17:73472045-73472067 GTGGCTGGTGGGTGCCACTCTGG + Intronic
1151491699 17:74435507-74435529 CTGGCTGCTGGGCAGCAGCATGG + Intronic
1151836624 17:76586278-76586300 GTGGCGGGTGGGCGGCGGCCGGG + Intronic
1152013270 17:77734098-77734120 GTGGCTGGTGGTTGCCACCCTGG - Intergenic
1152828253 17:82480964-82480986 GTGTCTGGAGGGCAGCAGCAGGG + Intronic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1159798231 18:72868215-72868237 GGGGCTGGTGCGCGGCAGAATGG + Intergenic
1160047513 18:75400591-75400613 GTGGCAGGTGGAGGGCACCCTGG - Intergenic
1160233553 18:77067647-77067669 GCTGCTGGTGGGTAGCACCAGGG - Intronic
1160507260 18:79434156-79434178 TTGGGTGCTGGGGGGCACCAGGG + Intronic
1160862890 19:1245156-1245178 GAGGCTGGTGGGCAGGGCCAAGG - Intergenic
1160971422 19:1769420-1769442 GAGGCTGGTGGTTGGTACCAGGG + Intronic
1161067028 19:2243674-2243696 GTGGCTGCTCGGGGGCAACAGGG - Intronic
1162013132 19:7830140-7830162 CTGGCTGGTGGGCGGGGCCAGGG + Intergenic
1162803117 19:13121945-13121967 GTGGCTGGAAGGCGGCACAGGGG - Intronic
1162926550 19:13933137-13933159 GTGGTTGTGGGGCAGCACCAGGG + Exonic
1162927711 19:13938422-13938444 GTGGTTGTTGGGGGGGACCAAGG - Exonic
1163925224 19:20334920-20334942 TTGGCTGGTGGGAGTCACCTGGG + Intergenic
1164120788 19:22262891-22262913 GTGGGTGGTATGCGGCACCCTGG + Intergenic
1164179234 19:22805675-22805697 GTGGGTGGTATGCGGCACCCTGG - Intergenic
1164233637 19:23313314-23313336 GTGCCCTGTGGGCAGCACCAAGG - Intronic
1165472008 19:36009352-36009374 CTGCCTGGTGCGCGGCACCCGGG - Exonic
1165711967 19:38018001-38018023 GTGGCTGGATGGCTGCAGCAAGG - Intronic
1165797026 19:38525533-38525555 GTGGGTGCTGGGCGGCATCCTGG - Intronic
1166003457 19:39891928-39891950 ATGGCAGGTGGGCGGCGCCCAGG - Exonic
1166179355 19:41095961-41095983 AGGGCTGGTGGGCGGGGCCAGGG + Exonic
1166566691 19:43769879-43769901 GTGGCTGTTGGGCGGGTTCAAGG - Intronic
1166966744 19:46533650-46533672 GTGCCCAGTGGGCGGCACCATGG + Intronic
1168344811 19:55644986-55645008 GCGGGTGGTGGGCGGCCCCACGG + Exonic
927086228 2:19676251-19676273 CTGGCTGGTGCTGGGCACCAGGG - Intergenic
937289502 2:120773715-120773737 GTGGCAGGTGGCAGGCAGCACGG + Intronic
939879504 2:147613860-147613882 GTGGCAGGTGTCCAGCACCAAGG - Intergenic
942834614 2:180278437-180278459 GAGGTTGGTGGGCTGAACCAGGG - Intergenic
946191327 2:218009610-218009632 GTGGCTGGGGGACGGCAGGAGGG - Intergenic
948742604 2:240057435-240057457 CTGGTTTGTAGGCGGCACCAGGG + Intergenic
1169131431 20:3168084-3168106 GTCGCGGGTGGGCGCCGCCAAGG + Intronic
1173293167 20:41732308-41732330 GTGACTGGTGGGCTGCACTTTGG - Intergenic
1173555323 20:43961613-43961635 GTGGCGGGTGGGTGGGAGCAGGG + Intronic
1173725406 20:45293723-45293745 CGGGCTGGGGCGCGGCACCACGG - Exonic
1174056067 20:47799392-47799414 GTGGCAGGTGGGAGGTGCCAGGG - Intergenic
1174137084 20:48387117-48387139 GTGGCTGGTGGGTGGCACTTGGG - Intergenic
1174200903 20:48805694-48805716 GTGGCTGTTGGGGGGCACAGAGG - Intronic
1175967671 20:62667680-62667702 GTGCCTGCTGGGCGCCAGCATGG + Intronic
1176143885 20:63557006-63557028 GGGGATGGTGGGAGGCATCACGG - Intergenic
1179108466 21:38424610-38424632 GATGCTGTGGGGCGGCACCAGGG + Intronic
1179820637 21:43935016-43935038 GTGGGTGGTGGACGGCACATGGG - Intronic
1180970444 22:19812167-19812189 CCGGCAGGTGGGCGGCTCCATGG + Intronic
1181672080 22:24430379-24430401 GAGGCTGGTGGGCAGCAGGAAGG + Intronic
1182277731 22:29201083-29201105 AGGGCTGGTGGGCTGCTCCAGGG + Intergenic
1183429120 22:37755211-37755233 GGGGCTGGTGGTGGGCAGCATGG + Intronic
1184807764 22:46806797-46806819 GTGGCTGGTGGGTCCCACCCAGG + Intronic
1185139226 22:49090990-49091012 CTGTCTGCTGGGCAGCACCAGGG - Intergenic
1185392497 22:50570254-50570276 GGGGTGGGTGGGCAGCACCAGGG - Intronic
950759261 3:15206228-15206250 GCGGCTGGTGGGCGGGGCGAGGG + Exonic
953553254 3:43921498-43921520 GTGGATGGTGGGTGGGACCTAGG + Intergenic
955195728 3:56803141-56803163 GTGGCTGAAGGGAGGCACCTGGG + Intronic
961379142 3:126486087-126486109 GGAGCTGGTGGTCAGCACCAAGG + Intronic
961456690 3:127028116-127028138 CTGGGGGGTGGGGGGCACCAGGG - Intronic
962314802 3:134352643-134352665 TTGGCTGGTGGGCGAGAGCAGGG + Intergenic
963734154 3:149001206-149001228 GTGGCTGGGGGAAGTCACCATGG - Intronic
964209521 3:154211517-154211539 GTGGGTGGGGGGTGGCATCAGGG + Intronic
968569014 4:1329664-1329686 GTGCCTTGTGGGTGGCTCCAGGG - Intronic
968634206 4:1669502-1669524 GAGGCTGCGGGGCGGCCCCAGGG + Intronic
971972085 4:33633885-33633907 GGGCCTGGTGGGAGGCCCCATGG + Intergenic
972698257 4:41468804-41468826 GTAGCTGGTGGGTGGCAGCTCGG + Intronic
973696839 4:53498609-53498631 GTGGCTGTGGGGCTGCAGCAAGG - Intronic
981624368 4:146738878-146738900 GTTCCTGGTGGGTGGCACCCAGG + Intronic
981782254 4:148442978-148443000 GACGCTGTTGGGCGGCGCCAGGG - Intronic
984944693 4:184961838-184961860 GTGGCTGATGGGAGGTAGCAGGG + Intergenic
986592568 5:9386604-9386626 GTGGCTGGTGTCAGCCACCATGG - Intronic
987249997 5:16090126-16090148 GTGGCTGTGGGGAGGTACCACGG - Intronic
989009701 5:36856223-36856245 GTGGCTCCCCGGCGGCACCAGGG - Intergenic
994092021 5:95818083-95818105 GAGGCTGGGGGGCAGCTCCAGGG - Intronic
997197253 5:131988392-131988414 GTGGGTCCTGGGCGGAACCAAGG + Intronic
997836267 5:137195777-137195799 ATGACTGGTTGGCAGCACCAGGG + Intronic
998158627 5:139800347-139800369 GTGCCTGGTGGACTGCACTAAGG - Intronic
999254745 5:150204060-150204082 ATGGCAGGTGGGCGGGACAAGGG + Intronic
1001310255 5:170605163-170605185 GTGGCTGGTGGGCAGGGGCATGG - Intronic
1001563181 5:172683476-172683498 GTGGCTGCTGGGCGGCAGGCAGG - Exonic
1001589067 5:172853219-172853241 GTGACTGGTGAGCGGCTCCTAGG + Intronic
1002512695 5:179733111-179733133 GGGGCAGGTGGGCAGCACCATGG - Exonic
1002805860 6:573387-573409 GAGGCAGGTGGGAGGCAGCAGGG - Intronic
1003402740 6:5804267-5804289 GTGCCTGGTGGGCACCAGCAAGG + Intergenic
1003512977 6:6796971-6796993 GTGGCTCGTGGGAGGCTGCAAGG - Intergenic
1004044660 6:12012335-12012357 GCGGCTGCTGGGCGGCGGCAGGG + Exonic
1005421393 6:25655025-25655047 AAGGCTGGTGGGCTTCACCATGG - Intronic
1016631341 6:146236479-146236501 GTGACTGGTGGTAGGCACTAGGG + Intronic
1017822875 6:158061537-158061559 GAGGCTGGTGCGCGGCAGGATGG + Intronic
1019414348 7:920477-920499 GTGGGTGGAGGGCGGCGCCGCGG - Intronic
1022500062 7:30877141-30877163 GTGGCTGGTGAGAAGCACCAGGG + Intronic
1023650215 7:42361659-42361681 GTGGCTGATGGCAGGCAGCAGGG + Intergenic
1023991795 7:45133014-45133036 GTGGCTGGTGGGGGGCAGTGGGG + Intergenic
1024223084 7:47303356-47303378 CTGGCTGCTGGGAGGCGCCAGGG + Exonic
1025236928 7:57240762-57240784 GCGGCAGGTGGGCGGTGCCAGGG + Intergenic
1027348636 7:77288027-77288049 GTGCCTGGTGGGCACCTCCATGG - Intronic
1029651894 7:101899055-101899077 GTGGCTGGAGAGCATCACCAAGG + Intronic
1030983212 7:116210582-116210604 GTGGCTGTTGAGCGGCGCCGCGG + Exonic
1031523300 7:122793151-122793173 GGGGCTGGAGGGATGCACCAAGG - Intronic
1032781437 7:135168014-135168036 GTGGAGGGTGGGAGGCACCCCGG - Intronic
1033521886 7:142168927-142168949 GTGGCTTGTGGACAGCACCTTGG + Intronic
1034436011 7:151063059-151063081 GTGGGTGGGGGGCTGGACCAAGG + Intronic
1035134857 7:156692737-156692759 GTGGCCAGTGGGCTGCACAAAGG + Intronic
1039910899 8:41826153-41826175 CTGGCAGGTTGGGGGCACCAAGG - Intronic
1040951279 8:52940719-52940741 GTCGGTGGTGAGCGCCACCACGG - Exonic
1041738188 8:61133125-61133147 CTGCCTGGTGGGGGACACCAGGG + Intronic
1045213155 8:100120054-100120076 CTGTCTGGTGGGTGGCACTAGGG - Intronic
1048319773 8:133389325-133389347 CTGGCTTGTGGGAGGCAGCAGGG - Intergenic
1048856813 8:138693490-138693512 GTGGTTGGTGGGAGTCAGCACGG - Intronic
1057353393 9:94317990-94318012 GTGGATGGTGGGAGGGATCAGGG + Intergenic
1057411239 9:94818035-94818057 GTGGCAGGTCTGAGGCACCATGG - Intronic
1057654358 9:96939602-96939624 GTGGATGGTGGGAGGGATCAGGG - Intronic
1058906143 9:109484153-109484175 GTGGTTGGTGTGCGCCACCCAGG - Intronic
1059216333 9:112567346-112567368 GTGGCTCAAGGGCGTCACCAGGG + Intronic
1059312965 9:113401159-113401181 GGGCCTGGAGGGCGGCTCCAGGG - Intronic
1060794028 9:126502851-126502873 CTGGCAGATGGGCGGCACCGTGG + Intronic
1061926651 9:133809170-133809192 GTGGCAGGTGGCCGGGCCCATGG - Intronic
1061980309 9:134099236-134099258 GTGCCTGGTGGGCGTGACCCCGG - Intergenic
1061997207 9:134192602-134192624 GTGGCTGGTGGGGGACACACTGG + Intergenic
1062261306 9:135664557-135664579 GTGTCCGGTGGGCTGCAGCAGGG + Intronic
1062316125 9:135967696-135967718 GTGGCTGGCTTGAGGCACCACGG - Intergenic
1062316226 9:135968376-135968398 GAGGTTGGAGGGCGGCACCGAGG + Intergenic
1062388597 9:136325084-136325106 GTGGATGGTGGGAGGCTCGAGGG + Intergenic
1062392393 9:136339045-136339067 GTGGGTGGTGGCCGGAACAAGGG + Intronic
1062724142 9:138061810-138061832 GTGGCTGGTTGACAGCCCCAAGG + Intronic
1203760501 EBV:10775-10797 GTGACTGGTGGGGGGCATCTGGG - Intergenic
1185611255 X:1394848-1394870 GTGGCTGCTGGGCGGCGGGACGG + Intergenic
1190461091 X:50676211-50676233 GTGGCTGATGGGAGGCCCTAGGG + Intronic
1192455165 X:71270052-71270074 GTGGCAGCTGGGCGGCAGCTGGG + Intergenic
1198214578 X:134545016-134545038 CGGGCTGGTGGGCGGCGCCCCGG + Intergenic