ID: 1084333010

View in Genome Browser
Species Human (GRCh38)
Location 11:68440654-68440676
Sequence CAGAGGAAGCAGAAGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1405
Summary {0: 1, 1: 0, 2: 9, 3: 116, 4: 1279}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084333010_1084333023 9 Left 1084333010 11:68440654-68440676 CCAGCCCCCTTCTGCTTCCTCTG 0: 1
1: 0
2: 9
3: 116
4: 1279
Right 1084333023 11:68440686-68440708 CAGTGAGCCCCACCTTGCTGGGG 0: 1
1: 0
2: 1
3: 22
4: 216
1084333010_1084333024 13 Left 1084333010 11:68440654-68440676 CCAGCCCCCTTCTGCTTCCTCTG 0: 1
1: 0
2: 9
3: 116
4: 1279
Right 1084333024 11:68440690-68440712 GAGCCCCACCTTGCTGGGGCTGG 0: 1
1: 0
2: 1
3: 33
4: 306
1084333010_1084333020 7 Left 1084333010 11:68440654-68440676 CCAGCCCCCTTCTGCTTCCTCTG 0: 1
1: 0
2: 9
3: 116
4: 1279
Right 1084333020 11:68440684-68440706 GCCAGTGAGCCCCACCTTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 184
1084333010_1084333022 8 Left 1084333010 11:68440654-68440676 CCAGCCCCCTTCTGCTTCCTCTG 0: 1
1: 0
2: 9
3: 116
4: 1279
Right 1084333022 11:68440685-68440707 CCAGTGAGCCCCACCTTGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084333010 Original CRISPR CAGAGGAAGCAGAAGGGGGC TGG (reversed) Intronic
900149080 1:1170494-1170516 GAGAGGAAGGAGGAGGGGGAGGG - Intergenic
900279845 1:1859674-1859696 GAGAGGAAGGAGAAGTGGGGTGG + Intronic
900383039 1:2394782-2394804 CCGAGGGAGCAGATGGGGGGTGG + Intronic
900538099 1:3188825-3188847 GAGAGGAGGAAGCAGGGGGCGGG + Intronic
900540817 1:3201819-3201841 CAGTGGACACAGAAGTGGGCGGG - Intronic
900661566 1:3787048-3787070 GAGAGGAAGCAGAGGCGGGAAGG - Exonic
900667969 1:3828356-3828378 CACAGGAGGCGGAAGGAGGCAGG - Intronic
900700309 1:4044209-4044231 AAGAGGAAGAAGAAAGAGGCTGG - Intergenic
900806573 1:4771524-4771546 CACAGGAAGGACAAGGGGGCTGG - Intronic
900848770 1:5125453-5125475 CAGAGTAAGCAGAAAGGAACAGG + Intergenic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
900894743 1:5475240-5475262 CAGTGGGAGCAGAAGGGCACAGG - Intergenic
900992771 1:6105615-6105637 CCCAGGAAGCAGCAGTGGGCAGG + Intronic
901058847 1:6462356-6462378 AAGAGGAAGGAGGCGGGGGCAGG - Intronic
901735669 1:11310597-11310619 CAAAGAAAGCAGCAAGGGGCAGG - Intergenic
902199507 1:14823091-14823113 CAGAGGGAGGAGAACGGGGCTGG - Intronic
902655776 1:17867039-17867061 CACAGGAGGCAGAAGAAGGCTGG - Intergenic
902659785 1:17893040-17893062 CAGAGGCTGCAGAAGGGGAACGG - Intergenic
902965225 1:19996107-19996129 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
903134872 1:21302847-21302869 CAGATGAATCACCAGGGGGCAGG + Intronic
903515621 1:23909008-23909030 CAGTGGAAGCAGGTGGGGGAGGG + Intronic
903828961 1:26163638-26163660 CCGAGAAGGAAGAAGGGGGCCGG - Intergenic
903840297 1:26234137-26234159 CAGAGGCGGCAGAACGGGGTGGG + Intronic
903917482 1:26774880-26774902 CAGAGGGACCATATGGGGGCTGG - Exonic
904274193 1:29369653-29369675 CACAGGAAGGAGAGAGGGGCAGG - Intergenic
904306565 1:29593921-29593943 AAGAGGGAGGAGAAGGGGGCAGG + Intergenic
904423773 1:30410440-30410462 CACAGGAAGGAGAGAGGGGCAGG + Intergenic
904455320 1:30644281-30644303 CAGAGGAGGCTCAAGGGAGCAGG - Intergenic
904587108 1:31586675-31586697 CAGAGGAGGGGGAAGGGAGCTGG - Intronic
904610121 1:31721196-31721218 CTGAGGAAGGAGGAGGGAGCTGG + Intergenic
905702052 1:40024454-40024476 CAAAGAAAGCAGAAGTGGCCAGG - Intergenic
905811633 1:40917382-40917404 CACAGGACGTACAAGGGGGCAGG - Intergenic
906518249 1:46452244-46452266 AAGAGGAAGCAGAGTGGGGCTGG + Intergenic
906532943 1:46533758-46533780 CAGAGGCAGAGGCAGGGGGCTGG - Intergenic
906570168 1:46831111-46831133 CCCAGGAAGCAGAAGGGGTCGGG - Intergenic
906660187 1:47576400-47576422 CTGTGGAAGCAGCATGGGGCTGG + Intergenic
906877130 1:49551822-49551844 GAGAGGAAACAGCAGTGGGCAGG + Intronic
907223960 1:52927640-52927662 AGGAGGAAGCAGAAGGCCGCAGG - Intronic
907478492 1:54725072-54725094 CAGAGGAGGCAGAACAGGGTTGG + Intronic
907491301 1:54810570-54810592 CTGGGGAAGCAGGATGGGGCGGG - Intronic
907600049 1:55760269-55760291 CCCAGGAAGAAGAAGGGGTCAGG + Intergenic
907837599 1:58125950-58125972 AGGAGGAAGGAGAAGGGGACAGG + Intronic
907902128 1:58750637-58750659 CTGAGAAAGCAGAAGGGGAGGGG - Intergenic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
907991462 1:59587001-59587023 CTCAGGAAGCACAAGGGGTCAGG + Intronic
908876893 1:68687415-68687437 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
909403224 1:75257930-75257952 CCCAGGAAGCATAAGGGGTCAGG + Intronic
909417524 1:75424241-75424263 GAGAGGAAGCTCAAGGGGGTGGG - Intronic
910047065 1:82930860-82930882 GAGAGGAACCAGAAGTAGGCGGG - Intergenic
910110967 1:83683072-83683094 CAGAGAAAGCATAAAGGAGCTGG + Intergenic
910859514 1:91730234-91730256 CAGAGGAAACAGACGAGGACAGG - Intronic
910922173 1:92359889-92359911 CAGAGAAAGCAGAAAAGGGGAGG + Intronic
911008756 1:93255780-93255802 AAGAGGAAGAAGAAGGAGGGGGG + Intronic
911100624 1:94093133-94093155 GGGAGGATGCTGAAGGGGGCAGG + Intronic
911676946 1:100668907-100668929 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
912844203 1:113064400-113064422 CAGAGGCAGAAGCAGGAGGCAGG + Intergenic
912954589 1:114145880-114145902 GAGAGGTAGGAGAAGGGGGTGGG + Intronic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
913473618 1:119215349-119215371 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
913507125 1:119527123-119527145 CCCAGGAAGCACAAGGGGTCTGG - Intergenic
913942722 1:125123145-125123167 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
914403182 1:147343185-147343207 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
914801835 1:150967882-150967904 CAGAGGAAGCAGAAATGGCTAGG + Intronic
914826913 1:151143562-151143584 CAGAGGCAGCAGATGAGGGAAGG - Intronic
915022994 1:152798495-152798517 CAGAGGATGGGGAAGGGGTCAGG + Intronic
915088821 1:153407180-153407202 CCCAGGAAGCACAAGGGGCCAGG + Intergenic
915090483 1:153420807-153420829 TAGAGAAGGCAGCAGGGGGCTGG - Exonic
915101816 1:153506523-153506545 CAGAGGAAGCAGATGAGAGGTGG - Intergenic
915225144 1:154406132-154406154 CAGAGGGAGAAGAGGGGCGCTGG - Intronic
915289342 1:154872510-154872532 CAGAGGATGCTGAAGGGGTTGGG - Intergenic
915301286 1:154953048-154953070 CTGAGGAGGGAGAAGGGGGTTGG - Intronic
915367283 1:155323402-155323424 CCGAGGGAGCAGGAGGGGACCGG - Intronic
915602906 1:156933447-156933469 ACGGGGAAGCAGAAGGGAGCGGG - Intergenic
915644793 1:157262036-157262058 CTGAGGGAGCAGAATGGAGCTGG - Intergenic
915872401 1:159574890-159574912 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
916211777 1:162365582-162365604 CAGAGGAAGCAGGGCTGGGCAGG - Intronic
916379628 1:164195482-164195504 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
916501599 1:165392372-165392394 CAGTGGAAGGAGCAGGGGACAGG - Intergenic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
916797512 1:168180328-168180350 GAGGAGAAGCAGATGGGGGCAGG + Intronic
916915350 1:169400860-169400882 CCCAGGAAGCACAAGGGGTCGGG + Intronic
916973368 1:170048683-170048705 GAGAGCAAGCAGAAGCGGGGTGG + Intronic
917010340 1:170464075-170464097 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
917304086 1:173608955-173608977 GAGAGGAAGGAGAAGGGGAAGGG + Intergenic
917308825 1:173656041-173656063 CATGGGAAGCACAAGGGGTCAGG - Intronic
917743650 1:177986206-177986228 CCCAGGAAGCACAAGGGGTCGGG + Intergenic
917904029 1:179572004-179572026 CCCAGGAAGCACAAGGGGTCGGG - Intronic
917963576 1:180164912-180164934 GAGAGGAAGCAGGAGGGGGTTGG + Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918002679 1:180512476-180512498 AAGGGCAAGAAGAAGGGGGCAGG + Intergenic
918456741 1:184727864-184727886 TACAGGCAGCATAAGGGGGCAGG - Intronic
918632144 1:186730771-186730793 CCCAGGAAGCACAAGGGGTCGGG - Intergenic
919275452 1:195409314-195409336 CAGAGGAGGCAGAAAGGGAAGGG + Intergenic
919728579 1:200899158-200899180 AAGAGGAAGAAGAAGGGAGGAGG + Intronic
919920150 1:202162527-202162549 CAGGGGAAGAAGGAGTGGGCAGG - Intergenic
920203543 1:204275504-204275526 GCCAGGAAGCAGAAGGGAGCAGG + Intronic
920448597 1:206039477-206039499 AAGAGGATGGAGAAGGGGGATGG + Intronic
920709265 1:208279515-208279537 CAGAGGAAACACATGGGGTCAGG - Intergenic
920949444 1:210558521-210558543 TAGAGGGAGCATAAGGGGGAAGG + Intronic
920995664 1:210988212-210988234 CCCAGGAAGCACAAGGGGTCAGG - Intronic
921360841 1:214329840-214329862 CAGAGGCAGCTGAGGGAGGCAGG + Intronic
922186353 1:223278276-223278298 CCCAGGAAGCACAAGGGGTCAGG + Intronic
922393113 1:225168362-225168384 CCCAGGAAGCACAAGGGGTCAGG + Intronic
922406289 1:225316612-225316634 CCCAGGAAGCACAAGGGGTCAGG - Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922596307 1:226816113-226816135 CAGAGGAAGGAAGATGGGGCAGG - Intergenic
922681705 1:227603631-227603653 ATGAAGCAGCAGAAGGGGGCTGG - Intronic
922800776 1:228363886-228363908 CAGAGGACGCTGGACGGGGCAGG - Intronic
923194492 1:231652026-231652048 CCCAGGAAGCACAAGGGGTCAGG - Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923947093 1:238900327-238900349 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
924067159 1:240235823-240235845 CAGAGGAAGAAGAGGGGAGATGG - Intronic
924657644 1:245988048-245988070 CAGAGGAATCACTAGGAGGCAGG + Intronic
924872826 1:248067702-248067724 CTCAGGAAGCACAAGGGGTCAGG + Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063057224 10:2518964-2518986 AAGAAGAAGAAGAAGGGGGGGGG + Intergenic
1063247020 10:4231690-4231712 CAGGGGTGGCAGAAGGGTGCTGG + Intergenic
1063348057 10:5329623-5329645 TAGAGGAAGGGGAAGGGGGTTGG - Intergenic
1063382260 10:5592844-5592866 GAGAGGGAGGAGAAGGGAGCTGG + Intergenic
1063790978 10:9447521-9447543 GAGAGGAAGGGGAAGGGGGAAGG - Intergenic
1064452225 10:15452964-15452986 TGGAGGAAGAAGAATGGGGCTGG + Intergenic
1065081225 10:22131252-22131274 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1065167089 10:22990989-22991011 CAGAGGAAGCAGAGAGGAGGAGG - Intronic
1065649776 10:27875757-27875779 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1065862971 10:29886846-29886868 GAGAGGAAGGAGATGGGGGTAGG + Intergenic
1065901123 10:30209077-30209099 CAGAGGAAGCATGGAGGGGCCGG - Intergenic
1065967178 10:30779802-30779824 GAGAGGAAGCACAAGGAGGCAGG - Intergenic
1066060516 10:31719606-31719628 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1066746459 10:38606486-38606508 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1066785189 10:38995542-38995564 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1066953709 10:42145925-42145947 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1067047044 10:42990718-42990740 CAGAGGAAGGAGACAGGGGTGGG + Intergenic
1067193318 10:44091097-44091119 CCCAGGAAGCACAAGGGGTCCGG + Intergenic
1067370609 10:45678608-45678630 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067389172 10:45847548-45847570 CAGGGGAGGCAGCAGGGTGCGGG - Intronic
1067416898 10:46109410-46109432 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067432835 10:46255171-46255193 CAAGGAAAGCAGATGGGGGCAGG + Intergenic
1067445085 10:46337001-46337023 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067491782 10:46714852-46714874 AAGACGAAGCAGAGGGGGCCGGG + Intergenic
1067502300 10:46816293-46816315 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067592287 10:47523727-47523749 CAGGGGAGGCAGCAGGGTGCGGG - Intronic
1067602877 10:47625524-47625546 AAGACGAAGCAGAGGGGGCCGGG - Intergenic
1067639403 10:48031800-48031822 CAGGGGAGGCAGCAGGGTGCGGG - Intergenic
1067874091 10:49988505-49988527 CAGGGGAGGCAGCAGGGTGCGGG + Intronic
1068654899 10:59564436-59564458 CCAAGGAAGGAGAAGAGGGCAGG + Intergenic
1069227219 10:65959322-65959344 CCCAGGAAGCACAAGGGGTCGGG - Intronic
1069734587 10:70645420-70645442 CCGGGGAAGCACAAGGGGTCAGG - Intergenic
1069823255 10:71240263-71240285 CAGAGGATGCAGATTTGGGCCGG - Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070466783 10:76732028-76732050 GAGAGGAAAAAGAAGGGGGCTGG - Intergenic
1070474217 10:76815931-76815953 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1070799557 10:79237191-79237213 CAGAGTAAGCCGAGGGGGACTGG + Intronic
1070827977 10:79402127-79402149 CAGAGGAGGCAGAAGGTCCCTGG + Intronic
1071060411 10:81564125-81564147 GAGAGGAGGCAGTTGGGGGCTGG + Intergenic
1071491463 10:86139387-86139409 CAGAGGGAGGTGAAGGGGACTGG - Intronic
1071572675 10:86706597-86706619 GAGAGGCAGCAGCAGGTGGCTGG - Intronic
1071602356 10:86964557-86964579 CTGAGGAGGCAGAACGGAGCAGG + Intronic
1071698520 10:87903784-87903806 CCCAGGAAGCACAAGGGGTCGGG - Intronic
1071999235 10:91177835-91177857 CCCAGGAAGCACAAGGGGTCAGG - Intronic
1072148766 10:92667802-92667824 AAGAGGAAGAAGAGGGGGGGAGG + Intergenic
1072526902 10:96279953-96279975 CATGGGAGGCAGAAGGGAGCTGG + Intergenic
1072679739 10:97498467-97498489 CCGGGGAAGCGCAAGGGGGCGGG + Exonic
1073434284 10:103506855-103506877 AAAAGAAAGCAGAAGTGGGCCGG - Intronic
1073998158 10:109339569-109339591 CCCAGGAAGCACAAGGGGCCGGG - Intergenic
1074017106 10:109545518-109545540 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1074240824 10:111637306-111637328 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1074386262 10:113018984-113019006 CAGAGGGAGCACAAGAGGGAGGG + Intronic
1074507558 10:114085011-114085033 TAGAGCAAGCAGACAGGGGCAGG + Intergenic
1074853345 10:117456006-117456028 AAGAGCAAGCAGGAGGGGGTGGG + Intergenic
1074898435 10:117796433-117796455 GAGAGAAAGCAGAAGGGGCAGGG - Intergenic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075222974 10:120600648-120600670 CAGAGGAAGCAGAAGCAAGCCGG - Intergenic
1075334832 10:121601069-121601091 AAGAGAAAGGAGAAGGGGGTGGG + Intergenic
1075579681 10:123607651-123607673 CAGCCGGAGCAGAAGGGGCCAGG - Intergenic
1075645222 10:124092476-124092498 AGGAGGAAGGAGGAGGGGGCGGG + Intronic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1075858020 10:125647715-125647737 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1075911213 10:126127175-126127197 GGGAGGAAGCAGAAGGGAGAAGG + Intronic
1076365298 10:129917947-129917969 CAGAGGACCCAGAATGGGGCAGG + Intronic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1076821424 10:132941891-132941913 CAGCGGATGCAGAGTGGGGCTGG - Intronic
1076838411 10:133032723-133032745 ATGAGGAGGGAGAAGGGGGCAGG - Intergenic
1077186610 11:1238330-1238352 CAGAGGAGGCAGAAAGGCGGTGG + Intronic
1077545634 11:3168429-3168451 CAGATGTAGCAGAAGGGGCAGGG - Intergenic
1077902749 11:6502941-6502963 CAGGGGGAGGAGAAGGGGCCTGG - Intronic
1077920691 11:6639930-6639952 CAGAGGAGGCTAGAGGGGGCAGG + Exonic
1078321588 11:10339802-10339824 CCCAGGAAGCACAAGGGGTCGGG + Intronic
1078340473 11:10495111-10495133 CAGAGGGAGGGGAAGGGGCCAGG - Intronic
1078431172 11:11289937-11289959 CAGAGGAGTCTGAAGAGGGCTGG + Intronic
1078822515 11:14895962-14895984 AAGAGGATGCAGAAGGGGAAAGG + Intergenic
1079138945 11:17794965-17794987 CAGCAGATGCAGAAGGGGGCAGG - Intronic
1079333417 11:19551691-19551713 GAGAGGAAGCAGGACGTGGCTGG - Intronic
1079475048 11:20821254-20821276 TAGAGGAAGGAGAAGGGTGGAGG - Intronic
1079682912 11:23321164-23321186 CCCAGGAAGCACAAGGGGTCGGG + Intergenic
1079832108 11:25281253-25281275 CTGGGGAAGCATAAGGGGTCAGG - Intergenic
1079848710 11:25501921-25501943 CTCAGGAAGCACAAGGGGCCAGG - Intergenic
1080209724 11:29771601-29771623 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1080662887 11:34311842-34311864 CAGAGAAAGCCAATGGGGGCCGG + Intronic
1080665047 11:34328438-34328460 CAGAGGAAGCAGCAGAGGCTTGG - Intronic
1081231585 11:40591287-40591309 CTAAGGAAGCACAAGGGGTCAGG - Intronic
1081269284 11:41064767-41064789 CAGAGGGAGCAGAAGCAGGGTGG + Intronic
1081365690 11:42232296-42232318 CATAGAAAGCAGAAGGGATCTGG - Intergenic
1081389674 11:42514844-42514866 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1081558716 11:44192214-44192236 AAGAAGAAGCAGGAGAGGGCTGG - Intronic
1081587443 11:44397095-44397117 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1081673592 11:44955451-44955473 CACAGGAAGCAGGAAAGGGCTGG - Intergenic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1081958962 11:47119392-47119414 CCCAGGAAGCACAAGGGGTCGGG - Intronic
1082147036 11:48683219-48683241 CCTCGGAAGCACAAGGGGGCAGG + Intergenic
1082313948 11:50694635-50694657 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1082596126 11:55084566-55084588 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1082629209 11:55521011-55521033 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1082634234 11:55577354-55577376 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1082794618 11:57370207-57370229 CCTAGGAAGCAGATGGGGCCAGG - Exonic
1082968187 11:58989876-58989898 CCCAGGAAGCAGAAGGGGTTGGG - Intronic
1083043904 11:59714837-59714859 CAGAGGGAGGAGAAGGGAGATGG - Intronic
1083613601 11:64015809-64015831 GAGGGGGCGCAGAAGGGGGCAGG + Intronic
1083712785 11:64559342-64559364 CAGAGGAGGCAGGAGGGAGACGG - Intronic
1083920199 11:65778309-65778331 CAGAGGCAGGAGCAGAGGGCGGG + Exonic
1084010077 11:66342943-66342965 AAGAGGAAGCAGAAGGAGATGGG - Intronic
1084219883 11:67671333-67671355 ATGAGGAAACAGATGGGGGCTGG + Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084357319 11:68648573-68648595 CAGAGGAAGCCCTTGGGGGCAGG - Intergenic
1084639283 11:70414823-70414845 GAGAGGAAGCAGGATGCGGCGGG + Intronic
1084721286 11:70907120-70907142 CAGAGGAAGCAGCTGGGGACTGG + Intronic
1085200075 11:74696640-74696662 CAGAGGCAGCAGCTGGGGGTTGG + Intronic
1085247946 11:75119489-75119511 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1085384935 11:76152175-76152197 CAGAGGAAGCAGTTGGGACCCGG + Intergenic
1085409538 11:76283033-76283055 CAGAGTCAGCAGCAGGGGCCAGG - Intergenic
1085567147 11:77524550-77524572 CAGAGAACACAGAAGAGGGCAGG - Intronic
1086086107 11:82956646-82956668 CCCAGGAAGCAAAAGGGGTCAGG - Intronic
1086409098 11:86526080-86526102 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1086524065 11:87703998-87704020 CCAAGGAAGCATAAGGGGTCAGG - Intergenic
1086587003 11:88463773-88463795 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1086732971 11:90271491-90271513 CACAGGAAGCACAAGGGGTCAGG - Intergenic
1086907394 11:92433493-92433515 CCCAGGAAGTAGAAGGGGTCAGG - Intronic
1087484824 11:98748063-98748085 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1087503930 11:98996640-98996662 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1088388020 11:109281454-109281476 GAGAGGAACCAGCAGTGGGCAGG + Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1088852254 11:113714602-113714624 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1089057622 11:115599380-115599402 AAGAGGAAGTAGAAGGGGAAGGG - Intergenic
1089151987 11:116371491-116371513 CAGAGGCAGGGGATGGGGGCAGG + Intergenic
1089615821 11:119694212-119694234 CAGGGGAAGCAGGAGCTGGCAGG + Intronic
1089640216 11:119843070-119843092 GAGAGGAAGCAGCTGGGAGCAGG + Intergenic
1089666263 11:120021938-120021960 CAGAGCCAGCGGAAGAGGGCAGG - Intergenic
1089742105 11:120591566-120591588 CAGAGGAGGCAGAAGGCAGCTGG - Intronic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1090229072 11:125088830-125088852 CAGTGGAAGGTGATGGGGGCCGG + Exonic
1090387003 11:126363185-126363207 GACAGGAAGGAGATGGGGGCAGG - Intronic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090667866 11:128926874-128926896 CAGAGGACACAGAAGCGGGATGG - Intergenic
1090745139 11:129699323-129699345 CACAGGAAGCAAAATGGGGAGGG + Intergenic
1090854609 11:130600691-130600713 CAGAGCAGGAGGAAGGGGGCAGG + Intergenic
1091310764 11:134573706-134573728 CAGAGGAGGCAGGAAGGGGATGG + Intergenic
1091391518 12:129039-129061 CAGATGCAGCAGATGGGGTCGGG - Intronic
1091398920 12:171198-171220 GAGAAGAAGAACAAGGGGGCAGG - Intronic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1091796273 12:3299076-3299098 GAGAGGAAGAAGAAGGTGGCGGG - Intergenic
1092000418 12:5027149-5027171 CAGAGACAGAAGTAGGGGGCAGG + Intergenic
1092308865 12:7330997-7331019 CCCAGGAAGCAAAAGGGGTCAGG + Intergenic
1092706454 12:11290428-11290450 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1092981393 12:13798158-13798180 CTGAGGAAGGAGAATGGGTCAGG - Intronic
1093017637 12:14170943-14170965 GAGAGGAAGGAGAAGGGTGAGGG + Intergenic
1093137960 12:15474412-15474434 CCGAGGCAGCAAAAGGGGTCTGG - Intronic
1093138463 12:15479201-15479223 CTAAGGAAGCAAAAAGGGGCTGG - Intronic
1093179312 12:15949628-15949650 CCCAGGAAGCACAAGGGGTCAGG - Intronic
1093597718 12:20981667-20981689 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1093672911 12:21899522-21899544 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1093728794 12:22544584-22544606 CCGAGGAAAGATAAGGGGGCGGG + Intergenic
1093781821 12:23146034-23146056 CCGGGGAAGCACAAGGGGTCAGG + Intergenic
1093992919 12:25610275-25610297 CCCAGGAAGCACAAGGGGCCTGG - Intronic
1093994984 12:25631258-25631280 CAGAAGAACCAGCAGTGGGCAGG - Intronic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094166167 12:27446261-27446283 CAGAGGGAGCAGGAGGGGAAGGG + Intergenic
1094447325 12:30546052-30546074 GAGAGGAACCAGCAGTGGGCAGG + Intergenic
1094803414 12:34065172-34065194 CCCAGGAAGCACAAGGGGGCAGG + Intergenic
1094805168 12:34083438-34083460 CCTGGGAAGCACAAGGGGGCAGG + Intergenic
1095044283 12:37483105-37483127 CAGAGGAAGCAGAAGGCAATGGG + Intergenic
1095214987 12:39537920-39537942 CAGATGAATCAGAATGAGGCAGG + Intergenic
1095385326 12:41643225-41643247 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1095408010 12:41889666-41889688 TAGAGGAAGCAGGAGAGGGGAGG - Intergenic
1095548976 12:43410265-43410287 CAGAGGAGGCAGACTGGGGTTGG + Intronic
1095706479 12:45242510-45242532 CCCAGGAAGCACAAGGGGTCGGG - Intronic
1095720178 12:45392057-45392079 CCCAGGAAGCACAAGGGGTCGGG + Intronic
1095793831 12:46195889-46195911 CCCAGGAAGCACAAGGGGTCAGG - Exonic
1095816364 12:46426865-46426887 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1095932104 12:47637304-47637326 GAGAGGAACCAGCAGTGGGCGGG - Intergenic
1096193947 12:49636917-49636939 CAGCGTATCCAGAAGGGGGCAGG - Exonic
1096580696 12:52582933-52582955 TACAGGAAGGAGGAGGGGGCAGG - Intergenic
1096891584 12:54776957-54776979 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1096895744 12:54819352-54819374 CACAGGAAGCATAAGGGGTTGGG - Intergenic
1097050427 12:56219907-56219929 CTGAGGAGGCTGAAGGGGGAAGG + Intronic
1097409120 12:59228258-59228280 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1097718948 12:62999656-62999678 CAGTGGAACCTGATGGGGGCAGG + Intergenic
1097740786 12:63240584-63240606 CCCAGGAAGCACAAGGGGTCGGG + Intergenic
1097912197 12:64982298-64982320 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1097948875 12:65403865-65403887 CCCAGGAAGCAGAAGGGGTCAGG - Intronic
1097983158 12:65754956-65754978 CTCAGGAGGGAGAAGGGGGCGGG + Intergenic
1098015575 12:66100659-66100681 CCCAGGAAGCATAAGGGGTCAGG - Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098523531 12:71460743-71460765 GAGAGGAGGAAGAATGGGGCTGG - Intronic
1098696993 12:73572289-73572311 CCGAGGAAGCACAAGGGGTTGGG + Intergenic
1099235741 12:80080610-80080632 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1099240171 12:80128969-80128991 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1099561023 12:84174079-84174101 GGGTGGAGGCAGAAGGGGGCTGG + Intergenic
1099897483 12:88667335-88667357 CCCAGGAAGCACAAGGGGTCGGG + Intergenic
1100652923 12:96610599-96610621 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1101069940 12:101063145-101063167 CCCAGGAAGCACAAGGGGTCGGG - Intronic
1101488075 12:105185507-105185529 CCCAGGAAGCACAAGGGGTCGGG - Intronic
1101524906 12:105519793-105519815 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1101542421 12:105676991-105677013 CAGGGGAGGCAGGAGGGGCCAGG + Intergenic
1101622019 12:106398044-106398066 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1101986502 12:109451495-109451517 CAAGGGAAGCAGAAGGGGCCCGG + Exonic
1102045245 12:109825774-109825796 CAGAGGAGGGGGAAGAGGGCAGG + Intronic
1102166411 12:110810253-110810275 GAGAGGAAGCAGGAGTGGGTAGG - Intergenic
1102309618 12:111835096-111835118 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1102645826 12:114403265-114403287 CGGAGGAGGCAGGAGGAGGCAGG + Intronic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102799154 12:115716469-115716491 TAAAGGAAGCAGGAGGAGGCTGG + Intergenic
1102879328 12:116472231-116472253 CAGAGCAAGCTGGAAGGGGCTGG - Intergenic
1103261612 12:119593704-119593726 CAGAGGACGCAGAAGGGGTGAGG + Exonic
1103311275 12:120010846-120010868 CACAGGAAGCAGCAGAGGACTGG - Intronic
1104085423 12:125470413-125470435 GAGAGGTAGCAGGAGAGGGCAGG - Intronic
1104333076 12:127866052-127866074 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1104718665 12:131032600-131032622 GAGAGGAAGCAGAGGGGCCCTGG - Intronic
1104777701 12:131400971-131400993 CAGAAGAGGATGAAGGGGGCGGG - Intergenic
1105419975 13:20243469-20243491 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1105575809 13:21650568-21650590 AAGAGGAAGAAGGAGGGGGCTGG - Intergenic
1105789045 13:23779669-23779691 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1105992580 13:25637320-25637342 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1106003475 13:25747001-25747023 CAGAGGAAGCAGAGGCTCGCAGG - Intronic
1106356398 13:28987454-28987476 GAGAGGAAGGAGATGGGGGTTGG + Intronic
1106969997 13:35128071-35128093 CAAAGAAAGCAGAAAGGGGTGGG + Intronic
1107095077 13:36527287-36527309 CAGAGGAGGGAGAAGGGAGGTGG + Intergenic
1107264290 13:38533872-38533894 CAGAAGAAGAAGAAAGGGGGAGG + Intergenic
1107276935 13:38688529-38688551 CAGAGTCTTCAGAAGGGGGCTGG - Exonic
1107364464 13:39655692-39655714 CTGAGGTGGCAGCAGGGGGCGGG + Exonic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1108264862 13:48696700-48696722 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1108304529 13:49118235-49118257 CCCAGGAAGCAAAAGGGGTCGGG + Intronic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108541436 13:51451459-51451481 TAGTGGAAGCAGATGGGAGCCGG + Intronic
1108553201 13:51567223-51567245 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1108715402 13:53073363-53073385 CTGGGGAAACAGAAGAGGGCTGG + Intergenic
1108850187 13:54718671-54718693 CCCAGGAAGCATAAGGGGTCGGG - Intergenic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1109358550 13:61266846-61266868 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1109457561 13:62611982-62612004 CCTAGGAAGCACAAGGGGTCAGG - Intergenic
1109816194 13:67588523-67588545 CCCAGGAAGCAGAAGGGGTTGGG + Intergenic
1110380167 13:74841262-74841284 CAGAGGAATCAGAATGGAGGGGG - Intergenic
1110457969 13:75711547-75711569 CCCAGGAAGCACAAGGGGTCCGG - Intronic
1110712536 13:78665425-78665447 CAAAGGAAACAGAAAGGGACGGG - Intergenic
1110924799 13:81137991-81138013 CAGAGGAAGTGGGAGGGGGAAGG - Intergenic
1111004336 13:82229207-82229229 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1111322760 13:86651420-86651442 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1111760442 13:92457405-92457427 CTGGGGAAGGAGAAGGGTGCTGG - Intronic
1112374531 13:98826366-98826388 CAGAGGAAGGAGAGGGGGCGAGG - Intronic
1113282122 13:108799863-108799885 AAGAGGAAGAAGAAGGGAGGAGG + Intronic
1113331846 13:109334905-109334927 CATAGGAGACAGAACGGGGCGGG + Intergenic
1113499649 13:110763347-110763369 GAGAGGAAGTAGAATGGCGCTGG - Intergenic
1113582741 13:111440448-111440470 CAGGGGAAGCTGCAGGGGGCAGG - Intergenic
1113591129 13:111502053-111502075 CCGGGGAAGCACAAGGGGTCAGG - Intergenic
1113633683 13:111905418-111905440 GCGGGGACGCAGAAGGGGGCGGG - Intergenic
1113633714 13:111905490-111905512 GCGGGGACGCAGAAGGGGGCGGG - Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114222003 14:20705010-20705032 GAGAGGTAGCAGAAGGGGGCAGG - Intergenic
1114317237 14:21520554-21520576 CAGAGGAAGCACATAGGGGTGGG - Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115421474 14:33199706-33199728 GAGGGGAAGAAGAAGGGGGAGGG - Intronic
1115792780 14:36898463-36898485 CCCAGGAAGCACAAGGGGTCAGG - Intronic
1116474698 14:45326166-45326188 CCGGGGAAGCACAAGGGGTCAGG - Intergenic
1116489214 14:45486535-45486557 CCCAGGAAGCAGAAGGGGTCGGG - Intergenic
1116618663 14:47171853-47171875 CTCAGGAAGCACAAGGGGTCAGG + Intronic
1117172751 14:53117350-53117372 CCCAGGAAGCAGAAAGGGTCAGG + Intronic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117528896 14:56639695-56639717 CCCAGGAAGCGCAAGGGGGCAGG + Intronic
1117624143 14:57618417-57618439 CCCAAGAAGCAGAAGGGGTCGGG + Intronic
1117981587 14:61347402-61347424 CAGAGAAAGCAGATGAAGGCAGG - Intronic
1118005099 14:61558431-61558453 CAGTGAAAGCAGCAGGGGCCTGG - Intronic
1118516334 14:66532407-66532429 CAGAGGAAGCAGAAGATGCCAGG + Intronic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1118789170 14:69073489-69073511 TAAAGAAAGCAGCAGGGGGCTGG + Intronic
1119319992 14:73724925-73724947 CAGAGGAAGATGCAGGGGGAGGG - Intronic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119699593 14:76744476-76744498 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119732855 14:76962038-76962060 CTGAGGAAGCCGACGGGTGCCGG - Intergenic
1119749448 14:77067083-77067105 CATGGGAAGCAGAAGAGGGCTGG - Intergenic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1119800544 14:77441096-77441118 GGGAAGAAGCAGAAGGGAGCAGG + Intronic
1119805957 14:77482546-77482568 CAGAGGAAGGACCAGAGGGCGGG + Exonic
1120585927 14:86312422-86312444 CTGGGGAAGCACAAGGGGTCAGG + Intergenic
1120881744 14:89419020-89419042 CTGAGAAAGCAGGAGGGGACTGG - Intronic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121111222 14:91314447-91314469 CAGAGGCTGCAGAGGTGGGCAGG - Intronic
1121128127 14:91421197-91421219 CAAGGGTAGCAGAATGGGGCAGG - Intergenic
1121182799 14:91942247-91942269 CAGAGGAGTAAGAAGGGGGTGGG - Intronic
1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG + Intergenic
1121688490 14:95857349-95857371 TGGAGGCAGCAGAAGGGGCCTGG - Intergenic
1121781352 14:96624389-96624411 GAGAGGAAGGAGACGGGGTCAGG - Intergenic
1122113093 14:99515138-99515160 CAGAGGAAGAAGACAGGGGCTGG + Exonic
1122147051 14:99697710-99697732 CAGAGGAAGCAGCAAGGCACTGG + Intronic
1122178202 14:99936614-99936636 CGGATGTGGCAGAAGGGGGCGGG + Intronic
1122309615 14:100786213-100786235 GAGAGGAAACAGGAAGGGGCAGG + Intergenic
1122652398 14:103232709-103232731 CAGTGGGAGCAGCAGGGGGATGG + Intergenic
1122663876 14:103315830-103315852 CAGATGAAGGAGAGGGGGCCCGG - Intergenic
1122663890 14:103315892-103315914 CAGATGAAGGAGAGGGGGCCGGG - Intergenic
1122666530 14:103334078-103334100 CTCAGGAAGCAGAAGGGGCGCGG + Exonic
1122695251 14:103549273-103549295 CAGAGACAGCAGAAGGGAGAGGG + Intergenic
1122742396 14:103879909-103879931 CAGAGGAAGACGGTGGGGGCAGG + Intergenic
1122987316 14:105218457-105218479 CAGACGAAGCTGGAGGTGGCTGG - Intronic
1123049272 14:105532776-105532798 CAAAGGGAGCAGAAAGGGCCCGG + Intergenic
1123108839 14:105855855-105855877 GAGAGGGAGCCGAAGGGGGCGGG - Intergenic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124885677 15:33683690-33683712 CCCAGGAAGCACAAGGGGTCGGG + Intronic
1124948441 15:34292951-34292973 CCCAGGAAGCACAAGGGGTCGGG - Intronic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1125434369 15:39629370-39629392 CAAAGTAACCAGAAAGGGGCTGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125883139 15:43210300-43210322 CTGGGGAACCAGAATGGGGCAGG - Intronic
1125916790 15:43494818-43494840 GGGAGGAAGCAGAAGCAGGCTGG - Intronic
1126336146 15:47588231-47588253 CAGAGGAAGGATAGTGGGGCAGG - Intronic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1126500631 15:49340366-49340388 CCCAGGAAGCACAAGGGGCCGGG - Intronic
1126720053 15:51568988-51569010 CATGGGAAGCACAAGGGGTCAGG + Intronic
1126818589 15:52478341-52478363 CCCAGGAAGCACAAGGGGTCGGG - Intronic
1127016882 15:54699014-54699036 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1127318029 15:57815925-57815947 CAGAGGAAGCTGCAGAGGGCAGG + Intergenic
1127339514 15:58026574-58026596 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1127530506 15:59839049-59839071 CAGAGGCTGCAGATGGGAGCTGG + Intergenic
1127598275 15:60509382-60509404 TAGAGCAAGCATGAGGGGGCAGG + Intronic
1127719159 15:61682968-61682990 AAGAGGAAGGAGGAGTGGGCAGG + Intergenic
1127798175 15:62455776-62455798 GAGAGATAGCAGAAGGGGACTGG - Intronic
1128083466 15:64870467-64870489 CAGAGGAGGAGGAAGGGAGCTGG - Intronic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128151563 15:65366529-65366551 CAGAGGGGGCAGCAGGGGGTGGG + Intronic
1128732482 15:70030656-70030678 CAGAGGGAGAAGGAGGTGGCTGG - Intergenic
1129148824 15:73673829-73673851 CTAAGGAAGCAGAAAGGGGCAGG - Intergenic
1129265653 15:74391906-74391928 CAGAGGCAGCAGTAGGCGGTGGG - Intergenic
1129564670 15:76608953-76608975 CCCAGGAAGCACAAGGGGTCAGG - Intronic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1129727925 15:77911043-77911065 CAGAGGAAGGAGGAGGGGATGGG - Intergenic
1129839954 15:78737817-78737839 CAGAGGAAGGAGGAGGGGATGGG + Intergenic
1130042537 15:80417506-80417528 GAGAAGAAGCAGAGGGGGGATGG - Intronic
1130106507 15:80932497-80932519 CAGAGAAGGCAGAAGAGGGGCGG + Intronic
1130145156 15:81268492-81268514 CAGAGGAAGCAGCAGGGCATGGG - Intronic
1130192421 15:81749804-81749826 CAGAGGAAGCAGGAGAGGAAAGG + Intergenic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130284139 15:82541301-82541323 CAGAGTTGGAAGAAGGGGGCAGG - Intronic
1130333015 15:82935780-82935802 CAGAGGAGACAGAAGTGGGTGGG - Intronic
1130430479 15:83842219-83842241 ATGAGGAGGCAGAAGGGGGATGG + Intronic
1130528667 15:84728628-84728650 TAGAAAAAGCAGAAGAGGGCCGG - Intergenic
1130962791 15:88674681-88674703 CAGAGCCTGCAGAGGGGGGCTGG - Intergenic
1131145043 15:90005358-90005380 CAGGTGAGGCAGGAGGGGGCTGG + Intronic
1131174373 15:90201073-90201095 CAGAGGAGCCGGAAGGGGCCAGG + Intronic
1131213324 15:90516606-90516628 GATAGAAAGCAGAAAGGGGCTGG + Intergenic
1131569683 15:93522121-93522143 CAGAGTAGACAGAAAGGGGCTGG - Intergenic
1132519077 16:379131-379153 CAGTGGACACAGCAGGGGGCGGG + Intronic
1132648595 16:1010343-1010365 GTAAGGAAGCAGAAGCGGGCTGG - Intergenic
1132674693 16:1116892-1116914 CCGGGGGAGCAGAGGGGGGCGGG - Intergenic
1133015647 16:2938255-2938277 TACAGGAAGGAGAAGGCGGCTGG + Exonic
1133314018 16:4870903-4870925 AAGATGAAGAAAAAGGGGGCAGG + Exonic
1133388894 16:5393153-5393175 CAGAGAAAGGATGAGGGGGCAGG - Intergenic
1133414681 16:5597235-5597257 CAGAGAAAGCGGGAGGGGGGTGG - Intergenic
1133801544 16:9090071-9090093 CAGAGATAGCAGACTGGGGCAGG + Intergenic
1133837663 16:9381084-9381106 CAGAGGAAGCAAGAGAGGGAGGG + Intergenic
1134045524 16:11098333-11098355 CCGAGGATGCAGAAAGGGACAGG + Intronic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134410514 16:14000034-14000056 CAGAGGAAGCAGAGGAGGAGAGG + Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1135066565 16:19314982-19315004 GAGAGGAAGGAGGAGGGGGTGGG + Intronic
1135943554 16:26843665-26843687 CAAAAGAAGCTGAAGGGGGCTGG - Intergenic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136399736 16:30010885-30010907 CAGAGGCAGGTGCAGGGGGCTGG - Exonic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1136736602 16:32473156-32473178 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
1136907822 16:34118665-34118687 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1137007097 16:35287381-35287403 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1137083779 16:36097839-36097861 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1137374560 16:47941604-47941626 AAGAGGAAGGAGTAGGGGGAGGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1138202131 16:55097142-55097164 AAGAGGAAGAAGAAGGAGTCTGG + Intergenic
1138370862 16:56525257-56525279 CAGAGCAGGCGGAACGGGGCTGG + Intergenic
1138413916 16:56860351-56860373 CAGAGGAAGGAGAGGGGAGAGGG - Intergenic
1138734010 16:59229848-59229870 CCAAGGAAGCACAAGGGGTCGGG + Intergenic
1138785116 16:59836630-59836652 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1138856214 16:60696708-60696730 CAGAGGAAGAAGAAGATGACTGG - Intergenic
1139231089 16:65283257-65283279 CAGAGGATGCAGCTGGGGCCAGG + Intergenic
1139356682 16:66371064-66371086 AGGAGGAAGCAGAAGGGGCCAGG + Intronic
1139530764 16:67541671-67541693 CAGAAGAAGCAGCTGAGGGCTGG - Exonic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1140112546 16:72016312-72016334 AAGAGGAAGAGGAAGGGGACTGG + Intronic
1140134670 16:72195371-72195393 GAGAGGGAGCAGAAGCGGGCAGG - Intergenic
1140534923 16:75700960-75700982 AAGAGGAAGCAGTAGGGAGGAGG + Intronic
1140539278 16:75740731-75740753 CCCAGGAAGCACAAGGGGTCGGG - Intronic
1140715279 16:77720888-77720910 CAAAGACAGCAGAAAGGGGCTGG - Intergenic
1141163987 16:81648037-81648059 CGGTGGAAGCAGCAGGGGGAGGG - Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141403820 16:83774046-83774068 CAGAGATAACAGCAGGGGGCTGG - Intronic
1141417337 16:83886148-83886170 AGGAGGAAGCAGAAGGAGGCTGG + Intergenic
1141675630 16:85515835-85515857 CAGAAGAGGCAGGAGGGGACCGG - Intergenic
1141692967 16:85606897-85606919 CCGAGGCAGGGGAAGGGGGCTGG - Intergenic
1141911712 16:87064671-87064693 GAAAGTAAGCAGAAGCGGGCTGG - Intergenic
1142106242 16:88304414-88304436 CAGAGGAATCTGCAGGGGCCAGG + Intergenic
1142181404 16:88672638-88672660 CAGGGGAAGCAAAAAGGAGCTGG + Intergenic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1142252650 16:88999715-88999737 CAGAGGGAGGAGGGGGGGGCGGG + Intergenic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1203016466 16_KI270728v1_random:356421-356443 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1203034801 16_KI270728v1_random:629579-629601 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142644784 17:1304711-1304733 TGGAGGAAGCAGGAGGGGGCAGG + Intergenic
1142674274 17:1503926-1503948 GAGAGGAACCTGGAGGGGGCCGG - Intronic
1142685844 17:1576540-1576562 CGCAGTTAGCAGAAGGGGGCAGG + Intronic
1143097637 17:4486875-4486897 GAAAGGAAGGAGAAAGGGGCCGG + Intronic
1143785305 17:9251253-9251275 CAGAGGAGGCAGGGCGGGGCTGG - Intronic
1143864851 17:9916475-9916497 CCGAGGAAGCAGCTGGGGGAAGG + Exonic
1144209726 17:13003901-13003923 GAGAGGGAGCAGGAGGAGGCAGG - Intronic
1144346555 17:14354785-14354807 GAGAGGAAGCAGAAGTGGGCAGG - Intergenic
1144453742 17:15402510-15402532 CAGAGGAGGCAGCAAGAGGCCGG + Intergenic
1144653286 17:17020111-17020133 TTGAGGAAGCAGAAGAGGGTGGG - Intergenic
1144748777 17:17633904-17633926 AAGAGGGAGCAGGAGCGGGCAGG - Intergenic
1144765134 17:17728469-17728491 CAGAGGATGCAAAATGGGGTAGG + Intronic
1145690649 17:26735913-26735935 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1146058930 17:29594370-29594392 CAGAGGAAGCTGAGGGGCCCTGG + Intronic
1146259171 17:31410608-31410630 CCGAGGGGGCTGAAGGGGGCGGG + Intronic
1146497977 17:33339901-33339923 CAGAGGCAGCAGTTGGGGTCGGG - Intronic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1147326370 17:39671653-39671675 CAGAGGAAGGAAAATGGGGATGG - Exonic
1147475133 17:40703588-40703610 CAGTGGAAGCAGATGTGGTCTGG - Exonic
1147581948 17:41631984-41632006 CCGAGCAAGGAGATGGGGGCTGG - Intergenic
1147738724 17:42657941-42657963 CAGAGGAATCAGGAGAGGGAAGG - Intergenic
1147775511 17:42898097-42898119 TGGAGGAAGCAGAAAGGGGCTGG + Intergenic
1147913892 17:43875443-43875465 CAGAGGAAGCGCACTGGGGCTGG + Intronic
1147914566 17:43878776-43878798 CATAGGAAGGAGGATGGGGCTGG + Intronic
1148086145 17:44994993-44995015 CAGAGGAAGGAGGAGAGGGGAGG + Intergenic
1148132440 17:45270339-45270361 CAGAGGAGGCAGGTGGGCGCAGG - Intronic
1148171833 17:45527378-45527400 CAGAGGGAGCAGAATGGAGCTGG + Intergenic
1148223028 17:45877999-45878021 CTAAGGAAGCAGAAGGGCTCAGG + Intergenic
1148277541 17:46319011-46319033 CAGAGGGAGCAGAATGGAGCTGG - Intronic
1148299748 17:46536876-46536898 CAGAGGGAGCAGAATGGAGCTGG - Intronic
1148364188 17:47041186-47041208 CAGAGGGAGCAGAATGGAGCTGG - Intronic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148841052 17:50497491-50497513 AAAAAGAAGCAGAAGGGGCCAGG + Intergenic
1148842152 17:50505986-50506008 GAGAGGAAGCAGGAAAGGGCTGG - Intergenic
1148907648 17:50921361-50921383 CAGAGAAAGCAGAAGTGTGGAGG - Intergenic
1149303983 17:55331143-55331165 AACAGGAAGCAGAAGTGGGCAGG - Intergenic
1149660696 17:58332667-58332689 GACAGGAAACAGAAGGGGGTGGG + Intergenic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1150402758 17:64872411-64872433 CAGAGGGAGCAGAATGGAGATGG + Intronic
1150545699 17:66155271-66155293 CACAGGAAGTACAAGGGGTCAGG + Intronic
1150702273 17:67458183-67458205 AGGAGGAAGCAGGAGGAGGCAGG - Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1151467481 17:74296758-74296780 AAGAGGGAGCAGAATGAGGCTGG - Intronic
1151560330 17:74866392-74866414 CAGGGGCTGCAGAAGGAGGCCGG - Intronic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1151752259 17:76046278-76046300 CAGAGGAAGCAGGGGGCGGGTGG + Intronic
1151803640 17:76391992-76392014 GAGAGGTAGCAGAAGTGGGGGGG + Exonic
1151911257 17:77084855-77084877 GAGAGGAAGCAGGTGGGGGCAGG - Intergenic
1152117614 17:78398368-78398390 CACAGGAAGCAGGAGGGGCCAGG - Intronic
1152177478 17:78797411-78797433 CTGAGGAAGCAGGGGAGGGCGGG + Exonic
1152218698 17:79049143-79049165 CAGTGGGGGCAGAAGGGGTCTGG - Exonic
1152268359 17:79309396-79309418 GAGAAGCAGCAGGAGGGGGCGGG - Intronic
1152336731 17:79703140-79703162 TAGAGGGAGGAGAAGGGGGAGGG - Intergenic
1152401533 17:80069448-80069470 CTGAGGAAGCTGAAGGGGTCAGG + Intronic
1152415976 17:80162206-80162228 CAGCGGAAGCAGGAGTGGGGCGG + Intergenic
1152494611 17:80662217-80662239 GATAGGAGGCAGAAGGCGGCTGG - Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152526967 17:80893875-80893897 CCTCGGAAGCAGAAAGGGGCAGG - Intronic
1153090310 18:1335387-1335409 CTCAGGAAGCACAAGGGGTCGGG + Intergenic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1153268449 18:3295368-3295390 CCCAGGAAGGAGCAGGGGGCTGG + Intergenic
1153671806 18:7418985-7419007 TAAAGAAAGCAGTAGGGGGCTGG - Intergenic
1155086887 18:22467603-22467625 CAGGAGCAGCAGGAGGGGGCTGG + Intergenic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1155988604 18:32256445-32256467 GAGAGGCAGGAGAAGGTGGCTGG - Intronic
1156433396 18:37100232-37100254 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1156844770 18:41652657-41652679 CAGTGAAAGAAGAATGGGGCAGG + Intergenic
1157025283 18:43835675-43835697 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1157161083 18:45315143-45315165 CAGAGGAAGCTTCAGGAGGCAGG + Intronic
1157379642 18:47201982-47202004 AAGAGGGATGAGAAGGGGGCTGG - Intergenic
1157394909 18:47333479-47333501 GAGAGGATGCAGAAGTGGGCAGG - Intergenic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157708826 18:49833912-49833934 CACAGGCCGCAGAATGGGGCAGG - Intronic
1157995910 18:52555636-52555658 CACAGGAAGCAGAAGGACTCAGG + Intronic
1158127739 18:54120716-54120738 CAAAGGAAACAGAAGAAGGCTGG + Intergenic
1158429239 18:57369353-57369375 CAGAGGAAGGAGAACTGGACAGG - Intronic
1158472688 18:57751728-57751750 GTGAGGGAGCAGAAGGTGGCTGG - Intronic
1158675066 18:59510985-59511007 CAGAGCCAGCTGAATGGGGCTGG - Intronic
1158938208 18:62384392-62384414 GAGAGGAACAAGAAGGGGGGAGG - Intronic
1159399434 18:67911552-67911574 GAGAGGAAGCAAGAGAGGGCAGG - Intergenic
1160150066 18:76391885-76391907 CAGAGCCAGCAGGAGGAGGCCGG + Intronic
1160281673 18:77496607-77496629 CAGAGGAAGTAGGAAGGAGCTGG - Intergenic
1160510101 18:79448651-79448673 CAGAGAAATAAAAAGGGGGCAGG + Intronic
1160749388 19:726908-726930 CAGAGGAAGCAGGATCGGGCTGG + Intronic
1160797859 19:954079-954101 CGGAGGGAGCAGGAGAGGGCAGG + Intronic
1160901851 19:1432746-1432768 GGGAGGAAGCAGAAGAAGGCAGG - Intronic
1161328144 19:3673127-3673149 CAGAGGGAGGAGCAGAGGGCAGG - Intronic
1161422014 19:4181148-4181170 GAGAGGGAGGAGAAGAGGGCAGG - Intronic
1161610548 19:5240059-5240081 CAGGAGAAGCAGAAGGGGTGAGG + Intronic
1161704896 19:5815047-5815069 GAGGGGAAGCAGATGGGGCCGGG - Intergenic
1162022467 19:7874106-7874128 CAGGGGAGGCCGATGGGGGCTGG - Intronic
1162178481 19:8849115-8849137 CAGAGGAAGCATAAGGCCTCTGG - Intronic
1162345088 19:10114124-10114146 AAGAGGCCGCAGCAGGGGGCGGG + Exonic
1162352406 19:10158589-10158611 GAGAGGGAGCAAAATGGGGCTGG + Intronic
1162647796 19:12062851-12062873 CAGAACCAGCAGAAGGGAGCCGG - Intergenic
1162794552 19:13079697-13079719 CACAGGCAGCAGGAGGGCGCAGG + Intronic
1162868410 19:13566749-13566771 GAGAGGAAGCAAGAGAGGGCAGG - Intronic
1162920041 19:13895559-13895581 CAGAGGAAGATGAAGGGGTGGGG + Intronic
1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG + Intronic
1163518976 19:17780795-17780817 CTGAGGAAGCAGGAGAGGGAGGG + Intronic
1163538703 19:17893794-17893816 CAGAAGGAGCTGGAGGGGGCTGG + Exonic
1163673340 19:18642222-18642244 AAGAGGAAGGAGACGTGGGCAGG - Intronic
1164152420 19:22566413-22566435 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1164246668 19:23436068-23436090 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1164259069 19:23553493-23553515 GAGAGGTAGTGGAAGGGGGCAGG - Intronic
1164321649 19:24153485-24153507 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1164563968 19:29312670-29312692 CAGAGAATGCACAAAGGGGCAGG + Intergenic
1164578459 19:29419558-29419580 GAGTGGAAGCAGAAGGGTGGGGG - Intergenic
1164650765 19:29889934-29889956 CAGAGGAAGCTGAAGGGCCCAGG + Intergenic
1164735214 19:30536179-30536201 CCAAGGATGAAGAAGGGGGCAGG - Intronic
1165490905 19:36122074-36122096 CAGAGGAAGCACCTGGAGGCTGG + Intronic
1165639173 19:37369873-37369895 CAGTGGGAACAGAAGGGGACTGG - Intergenic
1165775705 19:38403306-38403328 CCGAGGCAGCGGGAGGGGGCGGG - Intronic
1165980672 19:39719873-39719895 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166382758 19:42363207-42363229 CTAAGGGAGCAGATGGGGGCTGG + Exonic
1166489661 19:43247887-43247909 CTCAGGAAGCACAAGGGGTCAGG - Intronic
1167000321 19:46741906-46741928 CCCAGGAAGCTGAAGTGGGCAGG + Intronic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167419663 19:49395480-49395502 ATGAGGAAGCAGAGGGGGTCTGG + Intronic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167671719 19:50857348-50857370 AGGAGGAAGGAGAAGGGGGAAGG + Intronic
1167794055 19:51697657-51697679 CAGAGGGAGCAGCAGGGAGATGG + Intergenic
1167913964 19:52725372-52725394 CAGGGGAGGCCGACGGGGGCTGG + Intronic
1168100348 19:54138118-54138140 CAGAGGCGGCGGCAGGGGGCAGG - Intronic
1168323091 19:55521845-55521867 CAGAGCTGGCAGAAGGTGGCAGG - Intergenic
1202670302 1_KI270709v1_random:44020-44042 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
925059960 2:883452-883474 CAGGGGGAGCAGCAGAGGGCTGG + Intergenic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925172024 2:1755750-1755772 AAAAGGAAGGAGAAAGGGGCTGG - Intergenic
925217410 2:2109328-2109350 CACAGGAATCTGGAGGGGGCTGG - Intronic
925279231 2:2671105-2671127 AAGAGGAAGCAGAGGGGTCCAGG + Intergenic
925326927 2:3030084-3030106 CAGAGGGAGAAGAAAGAGGCAGG + Intergenic
925729239 2:6905416-6905438 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
926509895 2:13761786-13761808 CAAAGGAGGCAGAAGTGGGAAGG + Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926944053 2:18168466-18168488 CCCAGGAAGCACAAGGGGTCGGG - Intronic
927256340 2:21043815-21043837 CAGAGGGAGCGGGAGGGAGCCGG - Intronic
927302101 2:21526896-21526918 CATAGGAAGCACAAGGGGTCAGG - Intergenic
927328317 2:21832362-21832384 AAGAGGAACCAGCAGTGGGCGGG + Intergenic
927338293 2:21950993-21951015 CAGAGGAAGGGGAGGGGGGGTGG - Intergenic
927937372 2:27083379-27083401 CCGAGGAGGCAACAGGGGGCAGG - Exonic
928021363 2:27707666-27707688 CAGAGGAGGCAGAATGGTCCAGG + Exonic
928458740 2:31449911-31449933 CAGAGGAGGTAGCATGGGGCAGG + Intergenic
928487621 2:31748722-31748744 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
928518203 2:32063656-32063678 CCGAGGAAGGAGAAAGGGGCGGG + Exonic
928592896 2:32835344-32835366 GAGAGGAAGCAGAAGAGAGAGGG - Intergenic
928900815 2:36315811-36315833 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
929256212 2:39813938-39813960 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
929474081 2:42227685-42227707 CAGAGGAGGAGGAAGGGGGCGGG - Intronic
929576964 2:43058006-43058028 CTCAGGAAGCAGGAGGGGGCTGG - Intergenic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
930010891 2:46937766-46937788 CATAGGAAGCTGAAGGGGTTTGG + Intronic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930597951 2:53411097-53411119 CCTAGGAAGCACAAGGGGTCAGG + Intergenic
930837892 2:55814216-55814238 CCAAGGAAGCACAAGGGGTCAGG + Intergenic
931306524 2:61034513-61034535 CCCAGGAAGCACAAGGGGTCAGG + Intronic
931538588 2:63304463-63304485 CATGGGAAGCACAAGGGGTCGGG + Intronic
931885786 2:66615563-66615585 CCCAGGAAGCACAAGGGGTCGGG - Intergenic
931950465 2:67356263-67356285 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
932435387 2:71700168-71700190 CAGAGGGAGTAGCATGGGGCGGG - Intergenic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932649158 2:73536977-73536999 CAGAGGATGCAAAATGGAGCTGG + Intronic
932910875 2:75805037-75805059 AAGAGGAAGCAGAAGGTTGGTGG + Intergenic
933224454 2:79729447-79729469 GAGAGGAAGCAGCACGGGTCAGG - Intronic
933260297 2:80124757-80124779 CAGAGGAAGAGGAAGGGGAGGGG - Intronic
933661725 2:84933056-84933078 AAGAAGAAGAAGTAGGGGGCAGG + Intergenic
934187756 2:89762273-89762295 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
934308861 2:91845675-91845697 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
934731777 2:96663385-96663407 CAGTGGAGGGAGGAGGGGGCAGG + Intergenic
935099107 2:99975592-99975614 AGGAGGAAGCAGTAGGAGGCAGG + Intronic
935133904 2:100281805-100281827 GAAAAGAGGCAGAAGGGGGCAGG + Exonic
935220458 2:101008001-101008023 CAGAGGCGGCAGAAAGGGACTGG - Exonic
936060616 2:109293470-109293492 CAGTGGAGAGAGAAGGGGGCAGG - Intronic
936621475 2:114102236-114102258 CTCAGGAAGCATAAGGGGTCAGG - Intergenic
936640349 2:114304564-114304586 CCCAGGAAGCACAAGGGGTCGGG - Intergenic
936674528 2:114699787-114699809 CAGAGGAACCAGAAGGGGCAAGG + Intronic
936684776 2:114815041-114815063 GAGAGGGAGCAGAAGGGTGGAGG - Intronic
936723174 2:115278636-115278658 GAGAGGAAACACATGGGGGCAGG + Intronic
936907717 2:117556363-117556385 GAGGGGATGCAGATGGGGGCAGG - Intergenic
936918099 2:117660774-117660796 CTGAGGAACAAGAAGGAGGCTGG - Intergenic
936945140 2:117923327-117923349 CCCAGGAAGCACAAGGGGTCAGG + Intronic
937061072 2:118980861-118980883 CAGAGGACTCAGAAGGGGACAGG + Intronic
937219979 2:120337174-120337196 CAGAGGAAGCAGCTCAGGGCTGG + Intergenic
937807214 2:126160662-126160684 CACAGGAAGCACAAGGGGTTGGG + Intergenic
937984576 2:127632798-127632820 CAGAGGAGGCAGGAGGGGTGGGG - Intronic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
938567127 2:132529068-132529090 CCCAGGAAGCACAAGGGGTCAGG + Intronic
938720161 2:134060465-134060487 CCCAGGAAGCATAAGGGGTCAGG + Intergenic
938925607 2:136038803-136038825 CAGAGAAAGCAGAAAGGGAAGGG - Intergenic
939373847 2:141338305-141338327 AAGAGGAAGCAGAAGAAAGCAGG + Intronic
939730805 2:145782575-145782597 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
939766624 2:146258079-146258101 CAGAGAAAGAAGAAGGGGTTTGG - Intergenic
939807193 2:146788598-146788620 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
940135014 2:150425797-150425819 CAGAGGAAGGAAACTGGGGCAGG - Intergenic
940437283 2:153669726-153669748 CCCAGGAAGCACAAGGGGACAGG + Intergenic
940528276 2:154844883-154844905 CCCAGGAAGCACAAGGGGTCTGG - Intronic
940594079 2:155767318-155767340 CCGGGGAAGCACAAGGGGTCAGG - Intergenic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
941054009 2:160766697-160766719 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
941593463 2:167447791-167447813 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
941626397 2:167835239-167835261 CACAGGAAGCGCAAGGGGTCAGG + Intergenic
941751461 2:169139265-169139287 CAGAGCAGGCAAAAGGGAGCCGG + Exonic
941776502 2:169399378-169399400 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
942010940 2:171761795-171761817 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
942080051 2:172391744-172391766 CAGAGGAAAAACAAGGGGGTGGG + Intergenic
942208596 2:173648226-173648248 CAGAGAAAGCAGGACGGGGAGGG + Intergenic
942308788 2:174634819-174634841 CAAAGGAACCTGAAGGGGGAAGG + Intronic
942495320 2:176534044-176534066 CAGAGGAAGCAGAAGGGATCAGG + Intergenic
942596251 2:177594138-177594160 GATAGAAAGCAAAAGGGGGCAGG + Intergenic
942602681 2:177657672-177657694 GAGAGAAAGCAGAAAGAGGCGGG + Intronic
942753540 2:179314687-179314709 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
942802646 2:179893172-179893194 CAGAAGAAGCAGAAGCTGCCAGG + Intergenic
943303378 2:186230520-186230542 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
943503415 2:188721596-188721618 TAGAGGAAGCAGGATTGGGCAGG - Intergenic
943621711 2:190155522-190155544 TAGAGGAAGCTGAATGGGGTGGG + Intronic
943652377 2:190471302-190471324 CCCAGGAAGCACAAGGGGTCAGG + Intronic
944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG + Intergenic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
945111242 2:206361862-206361884 CAGAGGATGCAGAAGGTAGTGGG - Intergenic
945155166 2:206830432-206830454 AAGAAGAAGAAGAAGGGGGGAGG + Intergenic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
945481491 2:210350820-210350842 CATGGGAAGCACAAGGGGTCAGG + Intergenic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946056091 2:216903187-216903209 CAGAGGACTCAGAAGAAGGCAGG - Intergenic
946083065 2:217142831-217142853 CAGAGGGCGCAGAAGAGGGTTGG - Intergenic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946143902 2:217714290-217714312 GAGAGGATGGAGAAGGGGGAAGG - Intronic
946280901 2:218664791-218664813 CAGAGGCAGCAGGAGCGGGGGGG - Exonic
946313889 2:218897288-218897310 CCGAGGCAGCAGAAAGGGGAGGG + Intronic
946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG + Intronic
946739477 2:222787817-222787839 AAGAGGACTCAGAAGTGGGCAGG + Intergenic
946762362 2:223007219-223007241 AAAAGGAGGCAGAAGGGTGCTGG - Intergenic
946974960 2:225138541-225138563 AAGAGGAAGCAGAATTGGGTAGG + Intergenic
947142145 2:227029288-227029310 AAGAGGAAGGAGGAAGGGGCTGG - Intronic
947445095 2:230157167-230157189 AAGAGAAAGCAGCAGGGGGAAGG - Intergenic
947574058 2:231258475-231258497 AAGAGTAAGCAGTCGGGGGCCGG - Intronic
947734293 2:232446734-232446756 CAGGGGACACAGAAGAGGGCAGG - Intergenic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
948295475 2:236857221-236857243 GAGAGGAAAGAGGAGGGGGCGGG - Intergenic
948523402 2:238556446-238556468 GAGAGAGAGTAGAAGGGGGCAGG + Intergenic
948588740 2:239036568-239036590 GGCAGGAAGCAGGAGGGGGCGGG - Intergenic
948595496 2:239076885-239076907 TAGAGGAGGCTGAAGGGTGCTGG - Intronic
948601612 2:239110902-239110924 CTGAGGAGGCAGGAGGGGCCGGG - Intronic
948757945 2:240170026-240170048 CAGAGGTGGGAGAAGGGAGCGGG - Intergenic
949032247 2:241802637-241802659 CAGAGGGAGGAGGAGGGGCCGGG + Intronic
1168750247 20:276971-276993 CAGAGGATGGGGAAGAGGGCGGG + Intronic
1168837345 20:886023-886045 GAGAGGAGGAAGATGGGGGCAGG + Intronic
1169211672 20:3769155-3769177 CGGAGGAGGCAGGAGGGGGAAGG - Intergenic
1169795798 20:9461463-9461485 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1170064780 20:12299327-12299349 CAGTGGCAGCAGCTGGGGGCTGG + Intergenic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1170720511 20:18873659-18873681 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1170747711 20:19115512-19115534 CAGAGGTCCCAGAAGGGGGGAGG + Intergenic
1170823238 20:19771865-19771887 AAGAGGAGGCAGGAGGAGGCAGG - Intergenic
1171000776 20:21413707-21413729 CCTAGGAAGCACAAGGGGTCAGG + Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1171457095 20:25278286-25278308 CAGAGCAAGCTGGAGGGTGCAGG - Intronic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1171763396 20:29233675-29233697 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1171819068 20:29816927-29816949 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1172174933 20:32966528-32966550 CAGAGGAAGGACACGGGGGAAGG + Intergenic
1172292131 20:33784114-33784136 AAGAGGAGGGAGAAGGGTGCTGG - Intronic
1172623937 20:36336847-36336869 CCCAGGAAGGAGAAGGGGGCTGG - Intronic
1172888583 20:38247763-38247785 AAGAGGATGCAGAAGAGGGAAGG + Intronic
1173262196 20:41446560-41446582 CAGAGGCAGCTGGAGGGGGAGGG - Intronic
1173492314 20:43493019-43493041 CAGAGGCAGCAGAAGAGGGCAGG + Intergenic
1173534045 20:43795244-43795266 TAAAGGAAACAAAAGGGGGCTGG + Intergenic
1173617809 20:44414273-44414295 CAGAGGAGGGGGCAGGGGGCAGG + Intronic
1173797816 20:45874843-45874865 TAGAGGAATATGAAGGGGGCTGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173875502 20:46368087-46368109 CAGAGGAAGCAGGAAGAGTCAGG - Intronic
1174075997 20:47937439-47937461 TAGAGGAAGAATAAGGGGCCGGG - Intergenic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1174301557 20:49585913-49585935 CAGAGAAAGAGGAAGGGGACAGG + Intergenic
1174406883 20:50308700-50308722 GAGAGGAGGAAGTAGGGGGCTGG + Intergenic
1174454893 20:50642004-50642026 CTGCGGAAGCAGAAGGGGGTGGG - Intronic
1174471909 20:50767726-50767748 CTGCGGAAGCAGAAGGGGGTGGG + Intergenic
1174670989 20:52307543-52307565 CAGAAAAAGCAGAAGGGTGGGGG - Intergenic
1174762246 20:53217301-53217323 CTCAGGGAGCAGAAGGGGCCTGG + Intronic
1175750097 20:61490321-61490343 CACACGAAGCGGAAGGGGCCTGG + Intronic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176050314 20:63115856-63115878 CAGAGGCAGCAGCCAGGGGCTGG + Intergenic
1176214416 20:63941502-63941524 AAGAGGAAGCAGAAGTGGGCCGG + Intronic
1176379195 21:6103349-6103371 CAGAGGCAGCAGCAGGGGCAGGG + Intergenic
1176385508 21:6137080-6137102 AGGAGGAGGCAGAAGTGGGCAGG - Intergenic
1176893551 21:14348341-14348363 GAGAGGGAGCAGAAGAAGGCTGG + Intergenic
1177112181 21:17041962-17041984 CAGAGGACGTAGAAGGAGACAGG + Intergenic
1177299256 21:19219568-19219590 AAGAGAAAGCAGAAGGGGAAGGG + Intergenic
1178943309 21:36925566-36925588 CAGAGGAAGCAGAAGAAGGTGGG - Intronic
1179421472 21:41240111-41240133 CATAGGAAGCAGAATGTGGCTGG + Intronic
1179737965 21:43401172-43401194 AGGAGGAGGCAGAAGTGGGCAGG + Intergenic
1179744278 21:43434888-43434910 CAGAGGCAGCAGCAGGGGCAGGG - Intergenic
1179929397 21:44557510-44557532 CAGAGGAAGGAGAGAGGGGGAGG + Intronic
1180049228 21:45323835-45323857 GGGAGGAAGCAGAGGGGAGCTGG - Intergenic
1180068833 21:45426016-45426038 GTGGGGAAGCAGGAGGGGGCGGG - Intronic
1180323047 22:11341624-11341646 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180535944 22:16392763-16392785 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1181034808 22:20164789-20164811 CAGAGGAAGCAGGCAGGGGTGGG + Intergenic
1181115890 22:20632341-20632363 CAGAGGCTGCAGAGGAGGGCTGG + Intergenic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1181960164 22:26617045-26617067 CAGAGGAAGCAGACGGGGAAAGG - Intronic
1182180266 22:28339820-28339842 CGCAGGAAGCACAAGGGGTCAGG - Intronic
1182358398 22:29733165-29733187 CAGAGGGAGCTGAAGTGGGAAGG - Intronic
1182566643 22:31205096-31205118 CAGAGGAAGAAGAGGGGGAGTGG - Exonic
1182950912 22:34374976-34374998 CAGAGGCTGCCTAAGGGGGCTGG - Intergenic
1183039463 22:35165868-35165890 CCCAGGAAGCAAAAGGGGTCAGG + Intergenic
1183302034 22:37063218-37063240 GAGAGGCAGCAGAAGGGGCTGGG + Exonic
1183313591 22:37124925-37124947 AAGAGGAAGCAGCTGGCGGCAGG - Intergenic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1183392274 22:37552388-37552410 GAGGGGCAGCAGAAGGGGTCAGG - Intergenic
1183513058 22:38247071-38247093 CAGAGGAGGCTGATGTGGGCTGG - Intronic
1183985136 22:41565633-41565655 AAAAGGATGCAGAATGGGGCAGG - Intronic
1184369971 22:44076031-44076053 GAGAGGATGCTGAAGGGGGCAGG + Intronic
1184704624 22:46202145-46202167 CAGAGGAGGCAGGAGGGGGCTGG - Intronic
1184737793 22:46409442-46409464 GACAGGAGGCAGACGGGGGCGGG + Intronic
1184895285 22:47403075-47403097 CAGAGGAGGCAGGAGGGGTGCGG + Intergenic
1184950670 22:47840529-47840551 CTGGGGAGGCAGAAAGGGGCAGG - Intergenic
1185150481 22:49161161-49161183 CAGAGGGAGCCGGAGGGGCCGGG - Intergenic
1185183972 22:49381607-49381629 CAGAGGAAGCAGAGCCAGGCAGG - Intergenic
1185399060 22:50606687-50606709 CACAGGAGGCAGGAGGGCGCAGG - Exonic
1203235986 22_KI270732v1_random:1931-1953 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1203324546 22_KI270738v1_random:1256-1278 CTCAGGAAGCACAAGGGGTCTGG - Intergenic
949209172 3:1477679-1477701 CACAGGAAGCACAAGGGGTCAGG + Intergenic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949450001 3:4174741-4174763 CCCAGGAAGCACAAGGGGTCAGG + Intronic
949641108 3:6036646-6036668 CCCAGGAAGCACAAGGGGGCAGG - Intergenic
949846048 3:8371993-8372015 CCGAGGAAGCACAAGGGGTTGGG + Intergenic
949912287 3:8922149-8922171 CCGGGGAAGCACAAGGGGTCAGG + Intronic
949980265 3:9498421-9498443 CAGCAGCAGCAGAAGGGGTCAGG + Exonic
950218794 3:11178749-11178771 CGGAGAAAGCAGAAAGGGTCTGG - Intronic
950473318 3:13199722-13199744 CGGAGGACTCAGATGGGGGCAGG - Intergenic
950479935 3:13237931-13237953 CAGAGGAAGCATTTGGGGACTGG - Intergenic
950554011 3:13684404-13684426 CAGAGGGGGCAGGAGAGGGCGGG + Intergenic
950597252 3:13995642-13995664 CCCAGGAAGCACAAGGGGTCAGG - Intronic
950604934 3:14070295-14070317 CCCAGGAAGCACAAGGGGTCAGG + Intronic
950781611 3:15397414-15397436 CCGGGGAAGCACAAGGGGTCAGG - Intronic
951098378 3:18658014-18658036 ATCAGGAAGCAGAAGAGGGCAGG - Intergenic
951474765 3:23093241-23093263 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
951534678 3:23729874-23729896 AAAAGGAAGCAGGAGTGGGCAGG - Intergenic
951653749 3:24981722-24981744 CCCAGGAAGCATAAGGGGTCAGG - Intergenic
952256005 3:31696247-31696269 GAGAGGAAGCAGATGAGTGCAGG - Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952700336 3:36321161-36321183 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
953339754 3:42123450-42123472 CACAGGAAGCAGGAAGGGCCAGG - Intronic
953515931 3:43591809-43591831 CCCAGGAAGCACAAGGGGTCGGG + Intronic
953885558 3:46712727-46712749 GGGAGGAAACAGATGGGGGCTGG - Intronic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
954526341 3:51275082-51275104 CACAGGAAGCAGGATGCGGCGGG - Exonic
954548112 3:51456118-51456140 CCCAGGAAGCATAAGGGGTCAGG + Intronic
954683570 3:52358771-52358793 GAGAGGGAGCAGAGGGGTGCAGG - Intronic
954805397 3:53216960-53216982 CAGAGGAAGCACCAGGTGGGAGG - Intergenic
954924498 3:54220609-54220631 CAGAGGAAGCAGCAGGTGTGGGG - Intronic
955029594 3:55203514-55203536 CTGAGGAAGCAGATGGGGTGTGG - Intergenic
955478182 3:59360729-59360751 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
957130164 3:76214374-76214396 CCCAGGAAGCACAAGGGGTCAGG + Intronic
957207489 3:77216505-77216527 CCCAGGAAGCACAAGGGGTCAGG - Intronic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
957811628 3:85229392-85229414 CCCAGGAAGCACAAGGGGTCGGG - Intronic
958822576 3:98992464-98992486 CAGAGGAAACTGAAGGGAGAGGG - Intergenic
958828893 3:99064602-99064624 CTGGGGAAGCACAAGGGGTCAGG - Intergenic
958830721 3:99085491-99085513 TAGAGGAAGCAGAAGTTTGCTGG - Intergenic
959093148 3:101925299-101925321 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
959617965 3:108369524-108369546 CCCAGGAAGCACAAGGGGTCAGG + Intronic
959695184 3:109241534-109241556 CAGGGGAAGAAGAAGGGTGGGGG + Intergenic
960247156 3:115412476-115412498 CAAAGGAAGGACAATGGGGCTGG - Intergenic
960568743 3:119164646-119164668 CACAGGAAGCGCAAGGGGTCTGG + Intronic
960763136 3:121096029-121096051 CCCAGGAAGCACAAGGGGTCAGG - Intronic
960822901 3:121753026-121753048 CAGGGGAAGAAGAAGAGGGAAGG + Intergenic
961499283 3:127319972-127319994 GAGAGACAGCAGAATGGGGCAGG + Intergenic
961616937 3:128189845-128189867 AAAAGGAAGTAGAAGGAGGCTGG - Intronic
961714199 3:128847575-128847597 GGGAGGAAGGGGAAGGGGGCAGG + Intergenic
962512268 3:136114146-136114168 CCCAGGAAGCAGAAGGGATCAGG + Intronic
962524432 3:136224492-136224514 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
962836791 3:139196547-139196569 CCCAGGAAGCACAAGGGGTCAGG - Intronic
963121167 3:141778240-141778262 CAGGGAAAGCACAAGAGGGCTGG - Exonic
963175176 3:142290400-142290422 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
963199128 3:142568849-142568871 GAGATGAGGCAGCAGGGGGCTGG - Intronic
963491340 3:146005078-146005100 CAGAGGAGGCAGAATGGGATTGG + Intergenic
963678703 3:148347466-148347488 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
963758313 3:149259120-149259142 GAGTGGAAGCAGCAGTGGGCAGG - Intergenic
963880522 3:150523511-150523533 GCGAGGAAGGATAAGGGGGCAGG + Intergenic
963984467 3:151575661-151575683 CCCAGGAAGCACAAGGGGTCTGG - Intergenic
964374432 3:156035591-156035613 AGGAGGAAGCAGGAGGGGGGAGG - Intergenic
964492208 3:157249037-157249059 GAGAGGAATCAGTAAGGGGCAGG + Intergenic
964694381 3:159491316-159491338 CCCAGGAAGCACAAGGGGTCAGG + Intronic
965052686 3:163671202-163671224 GAGAGGAACCAGTAGTGGGCAGG + Intergenic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965389561 3:168088707-168088729 GAGAGAAACCAGAAGAGGGCAGG - Intronic
965410606 3:168326059-168326081 CAGAGGAAGCAGAGTGGAGTTGG + Intergenic
966496528 3:180587563-180587585 CAGAGGAAGAAGATGGGTACAGG + Intergenic
966516636 3:180828248-180828270 TACAGGAAGGAGAAGGCGGCCGG - Intronic
966816926 3:183896990-183897012 CAGACCAAGCAGATGGGAGCAGG + Intergenic
966956497 3:184885822-184885844 CAGAGGGAGCAGAAGAAGGAGGG - Intronic
967181578 3:186909800-186909822 CACAGGAAGCACAAGCGGTCGGG - Intergenic
967238446 3:187412319-187412341 CACGGGAAGCACAAGGGGTCAGG + Intergenic
967246985 3:187497833-187497855 CAGAGGGAACAGAAAGGGGTAGG - Intergenic
967468635 3:189837177-189837199 CAGAGGAAGTAGCAGGAGACAGG - Intronic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
967797222 3:193610965-193610987 CCCAGGAAGCACAAGGGGTCAGG - Intronic
967836290 3:193966135-193966157 CAGAGGCAGAAGGAGGGAGCTGG - Intergenic
968271993 3:197410111-197410133 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968810700 4:2798536-2798558 GAGAGGAAGCAGCTGGGGTCAGG - Intronic
969275237 4:6130198-6130220 CAGGGGAAGAAGGAGGGAGCGGG + Intronic
969537786 4:7767270-7767292 AAGAGGGAGCAAAAGGGAGCGGG + Intronic
969590761 4:8120636-8120658 CAGAGCACACAGATGGGGGCTGG - Intronic
969660036 4:8521991-8522013 CTGAGGATGCAGAAGTGTGCAGG - Intergenic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
970005878 4:11410306-11410328 CAGAGGAAAGAGATGGGAGCTGG + Intronic
970784536 4:19780332-19780354 CTCAGGAAGCACAAGGGGTCGGG - Intergenic
971116122 4:23647554-23647576 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
972199483 4:36696851-36696873 CAAAGGAAGCAGAATGGGCAAGG - Intergenic
972351998 4:38244559-38244581 CAAGGGAAGGAGGAGGGGGCCGG - Intergenic
972374808 4:38460299-38460321 CAGAGGAAGAAGTAGGTGGCTGG - Intergenic
972965358 4:44502352-44502374 CCCAGGAAGCACAAGGGGTCGGG - Intergenic
973732218 4:53833529-53833551 CTCAGGAAGCACAAGGGGTCAGG + Intronic
973809642 4:54557505-54557527 GACAGGACGCAGAATGGGGCTGG - Intergenic
974142031 4:57899803-57899825 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974547652 4:63333799-63333821 CCCAGGAAGCAAAAGGGGTCAGG + Intergenic
974841168 4:67300903-67300925 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
974871722 4:67652731-67652753 CCCAGGAAGCACAAGGGGTCAGG + Intronic
975066887 4:70077223-70077245 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
975092858 4:70423838-70423860 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
975250237 4:72169707-72169729 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
975292153 4:72689406-72689428 CAGTGGGAAAAGAAGGGGGCAGG + Intergenic
976267185 4:83195446-83195468 AAGAGCAAGGAGAAGAGGGCGGG - Intergenic
976446050 4:85130377-85130399 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
976490774 4:85667432-85667454 CTCAGGAAGCACAAGGGGTCAGG - Intronic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
976899798 4:90158811-90158833 CTCAGGAAGCACAAGGGGTCAGG - Intronic
977014461 4:91675833-91675855 CAGAGGAAGCAGGAAGGAACAGG + Intergenic
977333210 4:95663898-95663920 CTCAGGAAGCACAAGGGGACAGG + Intergenic
977492854 4:97736416-97736438 CTCAGGAAGCACAAGGGGTCAGG + Intronic
977731855 4:100363263-100363285 CAGAGGAAGCTGGAAGAGGCAGG - Intergenic
977994381 4:103484615-103484637 GCCAGGAAGCAGAAGGGGTCAGG + Intergenic
978108197 4:104930440-104930462 CACAGGAAGCACAAGGGGTCAGG + Intergenic
978331545 4:107618571-107618593 AAGAGGAAACAGAAGGTGGTGGG + Intronic
978402884 4:108349682-108349704 CAGAGGGAGTAGATTGGGGCTGG - Intergenic
979315419 4:119255686-119255708 CCCAGGAAGCACAAGGGGTCAGG - Intronic
979558515 4:122077302-122077324 CAGAGGAAGAAGAGGGGGAGTGG + Intergenic
980413695 4:132457995-132458017 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
980714725 4:136614714-136614736 GAGAGGTAGTGGAAGGGGGCAGG - Intergenic
980848724 4:138354951-138354973 CCTAGGAAGCACAAGGGGTCGGG + Intergenic
981188457 4:141833819-141833841 CCCAGGAAGCAAAAGGGGTCAGG + Intergenic
981869377 4:149468187-149468209 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983140312 4:164142004-164142026 CTCAGGAAGCACAAGGGGTCAGG + Intronic
983195406 4:164800703-164800725 CAGAGAAAGCTGTAGAGGGCTGG - Intergenic
983299100 4:165902541-165902563 CCCAGGAAGCAGAAGGAGTCAGG - Intronic
983388122 4:167092173-167092195 CCCAGGAAGCACAAGGGGTCGGG + Intronic
984220401 4:176967568-176967590 CAGGGGAAGCATGAGGGGGTGGG + Intergenic
984844435 4:184097880-184097902 CAGAGGAACCAGACCGGGGGAGG + Intronic
985770969 5:1810455-1810477 CAGGGGCAGCTGAAAGGGGCTGG + Intronic
985861624 5:2476030-2476052 CAGCAGAAGCAGAGGGGGTCTGG + Intergenic
985916726 5:2925797-2925819 CAGAGGAAGAAGAAGAGGAAAGG - Intergenic
986023669 5:3829008-3829030 GAGAGAAAACAGCAGGGGGCAGG + Intergenic
986361668 5:6984268-6984290 CAGAGGAAGCAGGAGGCATCTGG + Intergenic
986379608 5:7170745-7170767 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
986385623 5:7230789-7230811 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
986655017 5:10002598-10002620 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
986806680 5:11314094-11314116 CAGAGGTCCCAGAAAGGGGCTGG - Intronic
987975748 5:25012817-25012839 CAGAGGAAGCAAAAGAGAGATGG + Intergenic
988394261 5:30677614-30677636 CTGAGGAGGCTGAAGGGGGGAGG - Intergenic
988862896 5:35303326-35303348 CAGAAGAAGCAGGAGGGGTGGGG + Intergenic
988871547 5:35396283-35396305 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
988991099 5:36671909-36671931 GAGAGGAAGCAGGAAGGTGCTGG - Intronic
989180911 5:38575992-38576014 CAGAGGAAGGTGATGGGGGAAGG + Intronic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989451887 5:41596501-41596523 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
989453089 5:41609734-41609756 CCCAGGAAGCACAAGGGGTCGGG - Intergenic
989675325 5:43966192-43966214 CCCAGGAAGCACAAGGGGCCAGG - Intergenic
990154236 5:52856606-52856628 CAGAGGAGGTAGAAGGGTGGTGG - Intronic
990276814 5:54205956-54205978 CAGAAGAAGAATAAGGGGGAAGG - Intronic
990340019 5:54813154-54813176 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
990341020 5:54823246-54823268 CAGAGTATGCAGAATGGGGGAGG + Intergenic
990537991 5:56742728-56742750 GAGAAGAAGAAGAAGGGGGGAGG - Intergenic
990652936 5:57923052-57923074 CACGGGAAGCACAAGGGGTCAGG + Intergenic
990801358 5:59607644-59607666 TAGAGGAGGCAGCAGGGGGTAGG + Intronic
990860419 5:60320411-60320433 CCCAGGAAGCATAAGGGGTCAGG - Intronic
990897671 5:60716193-60716215 CACAGGAAGCACAAGGGGTTAGG - Intergenic
991117408 5:62970174-62970196 GAGAGGAAGCAGTGGTGGGCAGG - Intergenic
991397839 5:66223140-66223162 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
992149011 5:73882700-73882722 CAGGGGAAGAAGAAGGGAGGTGG + Intronic
992197125 5:74351016-74351038 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
992288078 5:75255921-75255943 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
992640944 5:78767938-78767960 TAGAGGGAGCAGAAGAGGGTGGG - Intronic
993052703 5:82944241-82944263 CTGGGGAAGCACAAGGGGTCAGG + Intergenic
993090512 5:83420644-83420666 CAGAGGAAGCAGAGGGCTGTGGG + Intergenic
993244244 5:85431666-85431688 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
993741406 5:91545226-91545248 GAGAGGAAGCAGGAGAGAGCTGG + Intergenic
994082023 5:95717602-95717624 CAGAGGCAGCAGAATGAGACAGG - Intronic
994438140 5:99764033-99764055 CCGGGGAAGCACAAGGGGTCAGG - Intergenic
994565580 5:101442251-101442273 CCTAGGAAGCACAAGGGGTCAGG + Intergenic
995309264 5:110692512-110692534 CACAGGAAGCGCAAGGAGGCAGG + Intronic
995316675 5:110782441-110782463 GAGAGGAAGCAAGAGGGGGTGGG + Intergenic
995352339 5:111193845-111193867 CAGAGTATGTAGAAGAGGGCAGG + Intergenic
995495556 5:112738130-112738152 CAGAAGAGGAAGAAGGGGGAGGG + Intronic
995620542 5:114021129-114021151 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
995692623 5:114844610-114844632 CCCAGGAAGCAGAAGGGGTCAGG + Intergenic
996129864 5:119769408-119769430 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
996337033 5:122395663-122395685 CACACAAAACAGAAGGGGGCAGG - Intronic
996650898 5:125874693-125874715 GTGAGGAAGCAGAATAGGGCTGG + Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
996706073 5:126499962-126499984 CAGAGGAGGCATAATGAGGCTGG + Intergenic
996987581 5:129585192-129585214 GAGGGCAAGCAGAAGCGGGCAGG - Intronic
997191832 5:131945185-131945207 CAGAGAAAGCAGAGCGGAGCAGG - Intronic
997339343 5:133130608-133130630 GAGAGGAAGTGGAAGGGGGGAGG - Intergenic
997365057 5:133320319-133320341 CAGTGAAACCAGCAGGGGGCAGG - Intronic
997518531 5:134507230-134507252 GGGAGGAAGCTGAAGGGGGCAGG + Intergenic
997606576 5:135179313-135179335 CAGAGGAGCCAGGAGGGGGCTGG + Intronic
997771750 5:136561486-136561508 CTGAGGAAGAAGACAGGGGCAGG - Intergenic
997823192 5:137084275-137084297 CTTAGCAAGCAGAAGGAGGCAGG - Intronic
998205499 5:140154335-140154357 CAGAGCAAGCAGGAGTGGGGAGG - Intergenic
998823847 5:146081521-146081543 CAGAAGAAGCAAAAGGGGAAAGG + Exonic
999033024 5:148315417-148315439 CAGAGGAGGCAGCAGAGGGGTGG + Intronic
999319338 5:150603724-150603746 CAGAGGAAGGAGCACAGGGCTGG + Intronic
999376614 5:151091170-151091192 AAGAAGAAGCAGAAAGGAGCTGG - Intronic
999530826 5:152461918-152461940 GAGAGGGAGCCGGAGGGGGCTGG + Intergenic
999558207 5:152768480-152768502 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
999814627 5:155163530-155163552 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
999907296 5:156155913-156155935 AAGAGGAAACAGAAGGTTGCAGG + Intronic
1000068938 5:157721122-157721144 CATGGGAAGCAGAAGGGGTCAGG + Intergenic
1000589973 5:163146603-163146625 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1000996177 5:167960959-167960981 CCCAGGAAGCACAAGGGGTCAGG - Intronic
1001424509 5:171614672-171614694 CAGAGGCAGCAGTGGGAGGCTGG + Intergenic
1001532988 5:172477800-172477822 GAGAGGGAGCAGAAGGCAGCAGG - Intergenic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1001803079 5:174560107-174560129 CAGTGGAAGCAGGATAGGGCAGG - Intergenic
1002092173 5:176812028-176812050 CTGAGGAGGCAGGATGGGGCGGG - Intronic
1002097999 5:176843424-176843446 GACAGAAAGCAGAAGGGGGTTGG + Intronic
1002253630 5:177944023-177944045 CAGAGGTAGGAGCAGGGCGCAGG - Intergenic
1002290020 5:178194159-178194181 CAGAGGAGGCAGCAGCGGGTGGG - Intergenic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1003400580 6:5787213-5787235 CAGAGGAGGCTGAAGAGGGGAGG - Intergenic
1003505030 6:6733823-6733845 GAGAGGGAGCTGAATGGGGCTGG - Intergenic
1004056027 6:12139542-12139564 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1004098769 6:12586696-12586718 CAGAGGAAAAACAAAGGGGCAGG - Intergenic
1004177731 6:13354734-13354756 CAAGGGAAGGAGAAGGGAGCAGG - Intergenic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004629499 6:17407845-17407867 ATGAAGAAGCAAAAGGGGGCTGG + Intronic
1004883030 6:20027400-20027422 CAGAGGGAGCAAGAAGGGGCTGG + Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005471179 6:26164166-26164188 CAGTGGTAGCAGGAGGTGGCAGG + Intronic
1005558103 6:27008577-27008599 CCCAGGAAGCACAAGGGGTCGGG + Intergenic
1005867752 6:29948953-29948975 CAGAGGAAGCAGTAGCTGGGTGG - Intergenic
1005884513 6:30086414-30086436 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1005997580 6:30940756-30940778 CAGAGGAACCAGAAAGGAGCAGG - Intergenic
1006191662 6:32213195-32213217 CAGAGGCAGGAGAAGGTGCCAGG + Exonic
1006391985 6:33763947-33763969 CTGAGGACGCCTAAGGGGGCAGG - Intergenic
1006398492 6:33802198-33802220 CAGAGGAAGGCACAGGGGGCAGG + Intronic
1006406034 6:33845573-33845595 CAGAGGAAGCAGATGTGAGAAGG - Intergenic
1006505235 6:34485035-34485057 AAGAGGAAGCACAGGGGGTCTGG + Intronic
1006616583 6:35332133-35332155 CACAGGAAGCAGAAGGGGTTGGG + Intergenic
1006859660 6:37162456-37162478 CAGAGGAGGCTGAAGAGGTCCGG - Intergenic
1007258534 6:40545590-40545612 CAGAGGAAGAGGAAGAGGGGAGG + Intronic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007372429 6:41434952-41434974 CACAGGAAGCGGAGGGGGGAGGG - Intergenic
1007408133 6:41646428-41646450 CACAGGCAGCAGAAAGGGGAAGG + Intronic
1007690106 6:43695366-43695388 CAGAGGCAACGGAAAGGGGCGGG + Intergenic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1007966537 6:46008549-46008571 CTGTGAAAGCTGAAGGGGGCTGG - Intronic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010361782 6:75003892-75003914 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1010461454 6:76118695-76118717 CCCAGGAAGCAGAAGGGGTCAGG - Intergenic
1010511850 6:76729817-76729839 CCGGGGAAGCACAAGGGGTCAGG - Intergenic
1010652075 6:78467402-78467424 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1011221430 6:85058315-85058337 CAGAAGAAGCAGAAGGGCTTGGG + Intergenic
1011379874 6:86731585-86731607 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012561508 6:100586517-100586539 CTCAGGAAGCACAAGGGGTCAGG - Intronic
1012608573 6:101188333-101188355 CCCAGGAAGCACAAGGGGCCAGG + Intergenic
1012879306 6:104766262-104766284 TATATGCAGCAGAAGGGGGCTGG + Intronic
1012976981 6:105791419-105791441 CACAGGCAGCAGAGGGAGGCTGG + Intergenic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1013261393 6:108446805-108446827 CAGAGGCAGCATAAGAGAGCTGG - Intronic
1013964129 6:115935227-115935249 CCCAGGAAGCACAAGGGGTCAGG + Exonic
1014063633 6:117101200-117101222 CCCAGGAAGCAAAAGGGGTCAGG - Intergenic
1014489491 6:122044679-122044701 CAGAGGAAAAAAAAGGGGGAGGG - Intergenic
1014979191 6:127926400-127926422 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1015186373 6:130421041-130421063 CAGATGAAACAGAAGGGGAGGGG - Intronic
1015233078 6:130938901-130938923 CAGAGGAAGAAAAAGTAGGCAGG + Intronic
1015337633 6:132058847-132058869 CACAGAAAGCAGAATGGGTCTGG + Intergenic
1015411062 6:132894425-132894447 TAGAGGAAGGAGGAGGGGGTTGG + Intergenic
1015889513 6:137955486-137955508 CAGGGCAAGAAGAAGAGGGCGGG + Intergenic
1015937883 6:138420769-138420791 AAGAGGAAGCAGGACGAGGCAGG - Exonic
1016523909 6:144977669-144977691 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017541713 6:155409338-155409360 CAGAGGAAACCGATGGGGGTGGG + Intronic
1018219726 6:161565987-161566009 CTGATGATGCAGAAGGGGGAAGG - Intronic
1018728862 6:166634178-166634200 CAGAGGAAGCAGATTCGGGGAGG + Intronic
1018791430 6:167151229-167151251 AAGAGAAAGCACAAGGGGCCAGG + Intronic
1019186362 6:170222954-170222976 CAGAGGACGCAGACCTGGGCAGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019415094 7:923394-923416 CACAGGAAGCAGGGAGGGGCCGG + Intronic
1019631641 7:2052811-2052833 CAGAGGAACCGGGAGGGAGCTGG + Intronic
1019654152 7:2179572-2179594 CAGAGGGAACAGAATGGGGCTGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019969144 7:4526137-4526159 AAGAGGAAGAAGAAAGGGGAAGG + Intergenic
1020017780 7:4841542-4841564 CAGAGGAAGCCGGCGGGCGCGGG + Intronic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1020340174 7:7101519-7101541 CAGAGGGAGCAGGAGGGAGTAGG - Intergenic
1020487740 7:8739407-8739429 CCCAGGAAGCACAAGGGGTCAGG - Intronic
1020639828 7:10741792-10741814 CACAGGAAGCACAAGGGGTCGGG + Intergenic
1020845345 7:13274617-13274639 CTCAGGAAGCACAAGGGGCCAGG - Intergenic
1021143187 7:17053140-17053162 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1021224637 7:18013096-18013118 CCCAGGAAGCACAAGGGGTCGGG - Intergenic
1021261786 7:18467389-18467411 CAGAGAAAGCAGCAGAGGCCTGG - Intronic
1021566948 7:22025614-22025636 AAGAGGAAGCAGCTGGGGGTGGG - Intergenic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1022230799 7:28410260-28410282 CAGCGGAGGCAGGAGGCGGCCGG - Intronic
1022417677 7:30191948-30191970 TAGAGGAAAGACAAGGGGGCGGG + Intergenic
1022800969 7:33776941-33776963 CAGATGAAGCAGATGGTGCCAGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023710977 7:42992279-42992301 CAGGAGTAGCAGAAGGGGACAGG - Intergenic
1023723080 7:43114552-43114574 CAGAGGAAGCAGCAAGCGGAGGG - Intronic
1023854534 7:44174265-44174287 GAGAGGAAGCACGAGGGGGCAGG - Intronic
1024185485 7:46944335-46944357 CAGTGGAAACAGAAGTGAGCAGG - Intergenic
1024346199 7:48316775-48316797 GAGAGGAAGCAAGAGGGGGGAGG + Intronic
1024565042 7:50673804-50673826 GAGATGATGCAGATGGGGGCCGG - Intronic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1025184182 7:56844314-56844336 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1025211298 7:57020692-57020714 TAGAGGGAGCGGAAGGGGGCGGG - Intergenic
1025320824 7:58091653-58091675 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1025479127 7:60960676-60960698 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1025552923 7:62272138-62272160 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1025595185 7:62914768-62914790 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1025660655 7:63556155-63556177 TAGAGGGAGCGGAAGGGGGCGGG + Intergenic
1025737116 7:64160721-64160743 CCCAGGAAGCACAAGGGGACGGG + Intronic
1025876049 7:65480475-65480497 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1026530910 7:71196433-71196455 CAGAAGCAGAAGAAGGGGCCAGG - Intronic
1026828139 7:73596566-73596588 AGGAGGAAGAAGAAGGGGACTGG - Intronic
1026913967 7:74108765-74108787 CAGAGGCAGGAGAGGGGAGCTGG + Intronic
1026959480 7:74399239-74399261 CAGTGTAAGAAGAAGGGTGCTGG + Intronic
1027129865 7:75583139-75583161 GAGAGGGAGCAGGAGGGGACTGG - Intronic
1027335731 7:77148339-77148361 CCCAGGAAGCACAAGGGGTCAGG - Intronic
1027584909 7:80045559-80045581 CAGAGGGTTCAGAAGGGGACAGG - Intergenic
1027637009 7:80688922-80688944 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1028144224 7:87304236-87304258 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1028503881 7:91550181-91550203 GAGAGGAAGCAGCAGGGGCTAGG - Intergenic
1028523566 7:91758921-91758943 CACAGGAAGCACAAGGGGTCAGG + Intronic
1028877292 7:95837777-95837799 CTGGGGAAGCACAAGGGGTCAGG - Intronic
1029064872 7:97839315-97839337 CAGGGGGAGCAGAGGAGGGCCGG + Intergenic
1029306653 7:99624684-99624706 CAGAGGAAGCAGAGCTGCGCTGG + Intronic
1029703414 7:102262543-102262565 CAGTGGAAGCAGCAGAGGACTGG + Intronic
1029780062 7:102722753-102722775 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1029801652 7:102954136-102954158 CCCAGGAAGCACAAGGGGTCGGG + Intronic
1030181037 7:106709585-106709607 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1030597400 7:111556514-111556536 GAGATGAGGCTGAAGGGGGCTGG - Intronic
1030850569 7:114480256-114480278 CAGAGGAGGAAGAGGGGGACAGG - Intronic
1030893719 7:115030896-115030918 CTGGGGAAGCACAAGGGGTCAGG - Intergenic
1031000416 7:116409055-116409077 CTCAGGAAGCACAAGGGGTCAGG + Intronic
1031385806 7:121149518-121149540 CAGAGGAAGCAGATGTGAGTTGG - Intronic
1031483618 7:122304950-122304972 CAGAGGAAGCAAAAGGGGGGTGG - Intronic
1032738494 7:134714366-134714388 CAGAGGAAGGACAAGTCGGCTGG - Intergenic
1032870172 7:135976952-135976974 CTGAGGAAGCTGATGGGAGCTGG - Intronic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033401766 7:141032800-141032822 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1033437609 7:141347713-141347735 CAGAGAAGGCAGACGGGGGGTGG - Intronic
1033449148 7:141447537-141447559 CAGAGCAAGCAGAATGCGGATGG - Intronic
1033525541 7:142210090-142210112 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1035259206 7:157650769-157650791 CAGCTGCAGCAGAAAGGGGCTGG - Intronic
1035533313 8:372501-372523 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1035593476 8:836216-836238 CACTGGAAGCAGGAGGCGGCCGG - Intergenic
1036295957 8:7537433-7537455 CAGAGGAAGGAGTATGTGGCCGG + Intergenic
1036326609 8:7783586-7783608 CAGAGGAAGGAGTATGTGGCCGG - Intergenic
1036589706 8:10157770-10157792 GAGAGAAAGAAGAAGAGGGCGGG - Intronic
1037583611 8:20261546-20261568 GGGAGAATGCAGAAGGGGGCTGG - Intronic
1037670800 8:21013601-21013623 CAGAGGAAGGAGGGGGGTGCAGG - Intergenic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1037880264 8:22570210-22570232 CAGAGGGGGAAGAAGGTGGCTGG + Intronic
1037992597 8:23331322-23331344 CAGAGGAGGGAGAAGGGCTCTGG - Intronic
1038053687 8:23837677-23837699 GAGGGGAAGCAGAGGGGAGCAGG + Intergenic
1038226246 8:25660733-25660755 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1039127024 8:34215130-34215152 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1039888395 8:41668573-41668595 CAGAAGAAGCAGCAGATGGCCGG + Intronic
1040008701 8:42642900-42642922 CTGGGGCAGCAGCAGGGGGCAGG - Intergenic
1040366920 8:46727169-46727191 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1040410854 8:47152950-47152972 CCCAGGAAGCACAAGGGGTCTGG + Intergenic
1040627864 8:49172579-49172601 AAAAGGAAGCAGAAGGAAGCTGG - Intergenic
1040702660 8:50086311-50086333 CAGAGGAAGAAGTTGGAGGCAGG + Intronic
1040989628 8:53335917-53335939 CAGAGTAGGCAGATGGGGGGTGG - Intergenic
1041011445 8:53547598-53547620 GAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1041190546 8:55349473-55349495 CAGAGGATGCAGAAGCTGGAGGG - Intronic
1041302651 8:56429296-56429318 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1041581335 8:59462759-59462781 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1041817765 8:61994498-61994520 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1042541054 8:69907435-69907457 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1042630278 8:70808508-70808530 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1042645314 8:70980198-70980220 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1042963990 8:74331224-74331246 CACAGGAAGCAGGAGTAGGCGGG - Intronic
1043747758 8:83897958-83897980 CCTAGGAAGCACAAGGGGCCGGG + Intergenic
1044007869 8:86960195-86960217 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1044030484 8:87229058-87229080 CTGAGGAAGCACAAGGGGTCAGG - Intronic
1044278797 8:90333438-90333460 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1044440995 8:92223295-92223317 CCCAGGAAGCACAAGGGGGTGGG - Intergenic
1044761063 8:95518159-95518181 CACAGCAAGCAGCATGGGGCTGG - Intergenic
1045071193 8:98506336-98506358 CCCAGGAAGCACAAGGGGTCAGG - Intronic
1045241055 8:100402008-100402030 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1045433141 8:102132947-102132969 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1045585445 8:103529556-103529578 CCCGGGAAGCAGAAGGGGTCAGG - Intronic
1046007737 8:108506226-108506248 CCGGGGAAGCGCAAGGGGGCAGG - Intergenic
1046329326 8:112695005-112695027 CTCAGGAAGCACAAGGGGTCAGG + Intronic
1046520672 8:115321053-115321075 TAGAGCAGGAAGAAGGGGGCTGG - Intergenic
1046607879 8:116390908-116390930 CATGGGAAGCACAAGGGGTCGGG + Intergenic
1046624576 8:116563001-116563023 CAGAGGAGGCAGATGTGAGCAGG - Intergenic
1046894875 8:119462141-119462163 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1046947547 8:119988271-119988293 CCCAGGAAGCACAAGGGGTCAGG - Intronic
1047167917 8:122461311-122461333 CTGAGTAAGAAGGAGGGGGCTGG + Intergenic
1047432552 8:124805412-124805434 CAGAGGAAGCAGGAGAGGGAAGG + Intergenic
1047614606 8:126553933-126553955 CAGAGGAAGAAGACGGGTGGGGG + Exonic
1047673565 8:127174786-127174808 GAGAGGAAGCAAAAGGGAGGGGG + Intergenic
1047767772 8:128003306-128003328 CAGAGGAGACAGAAGGGGAGGGG - Intergenic
1048231286 8:132644544-132644566 CTCAGGAAGCACAAGGGGTCAGG + Intronic
1048298952 8:133237602-133237624 AAGAGGAAGCAGGAGAGGGAAGG + Exonic
1048972124 8:139651034-139651056 GGGAAGAAGCAGAAGGGGGTGGG - Intronic
1049106428 8:140616661-140616683 CAGGGGCAGCAGCAGTGGGCAGG + Intronic
1049203690 8:141353659-141353681 CAGAGGAGGCTGAAGTGGGAAGG + Intergenic
1049235649 8:141510936-141510958 CCCAGGCAGGAGAAGGGGGCTGG + Intergenic
1049239242 8:141528586-141528608 CAGAGGAGGGAGGAGGGAGCAGG + Intergenic
1049241422 8:141539267-141539289 CAGCGGGAGCTGAAGGTGGCGGG + Intergenic
1049271941 8:141700717-141700739 CAGAGGACCCAGTAGGGGGCTGG - Intergenic
1049346332 8:142141076-142141098 AAGAGGAAGCAGGAGGGAGAAGG - Intergenic
1049358109 8:142198673-142198695 CACAGGCAGCAGAAGTGGGCTGG + Intergenic
1049431398 8:142566981-142567003 AAGAGGCAGATGAAGGGGGCGGG - Intergenic
1049494716 8:142924312-142924334 CAGAGGCAGCTGAGAGGGGCAGG + Intergenic
1049603485 8:143518751-143518773 CAGAGGGAGCACAAGCGGTCGGG - Intronic
1050374199 9:4953636-4953658 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1050386967 9:5101087-5101109 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1050508946 9:6374396-6374418 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1050678716 9:8085417-8085439 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1050700230 9:8330136-8330158 CCCAGGAAGCACAAGGGGTCAGG - Intronic
1050750688 9:8933128-8933150 CCCAGGAAGCACAAGGGGTCGGG - Intronic
1050874474 9:10617022-10617044 GAGAGGCACCAGAAAGGGGCAGG + Intergenic
1051112154 9:13651376-13651398 CCAGGGAAGCAGAAGGGGTCGGG - Intergenic
1051778550 9:20662553-20662575 GAGAGGAAGCAGAATTGAGCAGG - Intronic
1052145737 9:25045884-25045906 CCCAGGAAGCACAAGGGGTCGGG - Intergenic
1052813980 9:33085625-33085647 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1052887703 9:33666207-33666229 CCCAGGAAGCACAAGGGGTCGGG + Intergenic
1052986583 9:34492311-34492333 CAGAGGAAGCAGCAAGGATCTGG - Intronic
1053174810 9:35915046-35915068 CAGAGGAAGCACAATGTGCCTGG - Intergenic
1053371805 9:37567850-37567872 CTGAGGACGCAGAAGAGGGAAGG - Intronic
1053440212 9:38109800-38109822 CAGAAGAAGCGCAAGGGGCCAGG + Intergenic
1053453739 9:38214713-38214735 TAGAGGAAGGAGAAGGGGAAAGG + Intergenic
1053471142 9:38346854-38346876 AAGAGGCAGCAGCAGGGGGTGGG - Intergenic
1053485724 9:38454622-38454644 AAGTGGAAGCAGAATGGGGCTGG - Intergenic
1054581827 9:66922280-66922302 CCCGGGAAGCAGAAGGGGCCAGG - Intronic
1055239154 9:74163356-74163378 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1055494503 9:76841196-76841218 CCCAGGAAGCACAAGGGGTCGGG + Intronic
1056282511 9:85055689-85055711 CAGAGGCATCAGAAGGGTTCAGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056417395 9:86390145-86390167 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1056554526 9:87677622-87677644 CAGATGAAGCAGACTCGGGCCGG + Intronic
1057129611 9:92644408-92644430 CAGAGGACGCAGATGAGGGCAGG + Intronic
1057342671 9:94216934-94216956 CCAAGGAAGCACAAGGGGTCAGG + Intergenic
1057457213 9:95225453-95225475 AAGAGGCATCAGAAGGGGCCTGG + Intronic
1057516607 9:95727274-95727296 AAGAGGAAAGAGAAGGGGGGTGG - Intergenic
1057555069 9:96081575-96081597 GAGAGGAAGGATAAGGGGGCAGG - Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1058243886 9:102600781-102600803 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1058564018 9:106261288-106261310 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1059202388 9:112430280-112430302 CAGAGGAAGCAGCAGTGGATAGG + Intronic
1059811301 9:117858449-117858471 TAGAGGAGACAGGAGGGGGCAGG - Intergenic
1060247275 9:121957381-121957403 CAGAGGAGGAAAGAGGGGGCGGG - Intronic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061188775 9:129070102-129070124 CAGAGGAAGCAGTGGGAGGGAGG + Intronic
1061203085 9:129148362-129148384 CAAAGGTAGCAGAAGTGGCCGGG - Exonic
1061619663 9:131803647-131803669 CAGAGGTAGGAGGAGGGAGCAGG + Intergenic
1061727513 9:132589715-132589737 GAGAGGACGCCGAGGGGGGCTGG - Exonic
1061874904 9:133538857-133538879 CCAAGGAAGCTGATGGGGGCTGG - Intronic
1061940872 9:133883096-133883118 CAGAGAGAGCAGCAGGGGGTGGG - Intronic
1062044765 9:134419898-134419920 CACAGGGAGCAGAATGTGGCAGG - Intronic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1062591057 9:137274873-137274895 CTGAGGAAGCAGGAGAGGCCTGG + Intergenic
1185512001 X:670725-670747 CAGAGGAAGAAAGACGGGGCTGG + Intergenic
1185526557 X:784874-784896 CAGAGGAAGCTGAATGGGTCAGG - Intergenic
1185843320 X:3413756-3413778 CAGAGGAACCAAACAGGGGCTGG + Intergenic
1186045571 X:5532888-5532910 CAGAGGAAGAAGGAGGGAGGGGG + Intergenic
1186653892 X:11592150-11592172 CAGAGGAGGAAGATGGGGGAAGG + Intronic
1187248397 X:17574636-17574658 CCTAGGAAGCACAAGGGGTCGGG - Intronic
1187377096 X:18764689-18764711 GTGAGGAAGGAGGAGGGGGCAGG + Intronic
1188036110 X:25318859-25318881 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1188201613 X:27299400-27299422 CCCAGGAAGCACAAGGGGTCGGG + Intergenic
1188219830 X:27527453-27527475 CTCAGGAAGCAAAAGGGGTCAGG - Intergenic
1188397987 X:29708386-29708408 CAGAGGCTGCAGAGGGGGGCAGG - Intronic
1189038553 X:37517928-37517950 GAGAGGAAGCAAAACTGGGCAGG - Intronic
1189062418 X:37768808-37768830 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1189110593 X:38286077-38286099 AAGAGGAAGGAGAAGGGGAAGGG - Exonic
1189110638 X:38286203-38286225 GAGAGGAAGGAGAAGGGGAGGGG - Exonic
1189256345 X:39642600-39642622 CAGAGGAGAAAGATGGGGGCAGG + Intergenic
1189269365 X:39740137-39740159 CAGAGGAAGAGGCAGGGGCCCGG - Intergenic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1189857548 X:45238455-45238477 GAGAGGAAACAGAACGGGGCAGG + Intergenic
1189939213 X:46104058-46104080 CACAGGAAGTAAAAGGGGTCAGG + Intergenic
1189970739 X:46415820-46415842 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1190062835 X:47222032-47222054 AAGAGGAAGCAGAAGACGGCTGG + Intronic
1190341536 X:49300271-49300293 CCGGGGAAGCAGTAGGGGTCGGG - Intronic
1190548640 X:51556295-51556317 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1190598070 X:52066215-52066237 GAGAGGAAGGAGATGGGGGAGGG + Intronic
1190610754 X:52187858-52187880 GAGAGGAAGGAGATGGGGGAGGG - Intronic
1190622220 X:52298905-52298927 CCCAGGAAGCACAAGGGGTCGGG + Intergenic
1191016134 X:55811977-55811999 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1191125897 X:56953604-56953626 CACGGGAAGCACAAGGGGTCAGG - Intergenic
1191133351 X:57038268-57038290 CACAGGAAGTACAAGGGGTCGGG - Intergenic
1191171469 X:57451818-57451840 CAAAGAAAGCAGGATGGGGCAGG - Intronic
1191192752 X:57684458-57684480 CACGGGAAGCACAAGGGGTCAGG + Intergenic
1191635094 X:63367630-63367652 CCGAGGAAGCACAAGGAGTCAGG + Intergenic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1191800817 X:65077359-65077381 CAGTGGAAGCAGAGAAGGGCTGG - Intergenic
1191865244 X:65698568-65698590 CAGCAGAAGCAGTGGGGGGCAGG - Intronic
1192129053 X:68530726-68530748 CCTAGGAAGCACAAGGGGTCGGG - Intronic
1192371884 X:70521073-70521095 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1192629064 X:72760937-72760959 CCCAGGAAGCACAAGGGGTCGGG - Intergenic
1192637230 X:72831211-72831233 CCCAGGAAGCACAAGGGGTCAGG - Intronic
1192644484 X:72889603-72889625 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1192652646 X:72959877-72959899 CCCAGGAAGCACAAGGGGTCGGG + Intergenic
1192900243 X:75488807-75488829 CCTAGGAAGCACAAGGGGTCAGG + Intronic
1192902447 X:75514598-75514620 CCCAGGAAGCACAAGGGGTCTGG + Intronic
1192919063 X:75686319-75686341 CACAGGAAGCACAAGAGGTCAGG - Intergenic
1192977731 X:76303680-76303702 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1193051396 X:77103331-77103353 CCCAGGAAGCATAAGGGGTCAGG - Intergenic
1193391681 X:80936767-80936789 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1193718844 X:84964772-84964794 CAGAGGAGGCAGAACAGGGTTGG - Intergenic
1193787134 X:85772815-85772837 CATGGGAAGCACAAGGGGTCAGG - Intergenic
1194098517 X:89673997-89674019 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1194417070 X:93627522-93627544 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1194813459 X:98415194-98415216 CCCGGGAAGCAGAAGGGGTCAGG + Intergenic
1195126310 X:101812831-101812853 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1195456863 X:105078961-105078983 CCCAGGAAGCACAAGGGGTCAGG - Intronic
1195696878 X:107674007-107674029 CAGAGGAAGGGGAAGGGGCGGGG + Intergenic
1195774865 X:108391770-108391792 CACAGGAAGCACAAGGGGTCGGG - Intronic
1195813395 X:108858805-108858827 CCCAGGAAGCACAAGGGGTCTGG + Intergenic
1196638458 X:118031924-118031946 CTCAGGAAGCACAAGGGGTCAGG + Intronic
1197051106 X:122060914-122060936 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1197384151 X:125782764-125782786 CAGAGGAAACAGAAAGGGATGGG - Intergenic
1197574808 X:128199134-128199156 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1197761099 X:130028910-130028932 CAGAGGAGGCAGGAGGGGGGTGG + Intronic
1197880823 X:131164685-131164707 CTCAGGAAGCACAAGGGGTCGGG - Intergenic
1198036084 X:132802844-132802866 GAGATCAAGCAGAAGGGGGAAGG + Intronic
1198293728 X:135263753-135263775 CCCAGGAAGCACAAGGGGTCAGG - Intronic
1198615642 X:138456042-138456064 CCCAGGAAGCAGAAGGGGTCAGG + Intergenic
1198645928 X:138806512-138806534 CAGAAGAATCTGAAGGGGACAGG + Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200297688 X:154939227-154939249 CCCAGGAAGCACAAGGGGTCAGG + Intronic
1200333149 X:155319438-155319460 CTCAGGAAGCACAAGGGGTCGGG + Intronic
1200451539 Y:3335372-3335394 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1200574028 Y:4866555-4866577 CTCAGGAAGCAGAAGGGGTCAGG + Intergenic
1200752010 Y:6954603-6954625 CCCAGGAAGCACAAGGGGTCAGG - Intronic
1200820302 Y:7575855-7575877 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1200874641 Y:8140129-8140151 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1201230642 Y:11860876-11860898 CTCAGGAAGCACAAGGGGTCAGG - Intergenic
1201231876 Y:11872823-11872845 CAGAGGAACCAAACAGGGGCTGG - Intergenic
1201249246 Y:12039578-12039600 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1201450086 Y:14102390-14102412 CTCAGGAAGCACAAGGGGTCAGG + Intergenic
1201546993 Y:15176264-15176286 GAGAGGAAGCAGTAGGTGGCTGG - Intergenic
1201595196 Y:15660488-15660510 CAAAGCAAGAAGAAGGGGGAAGG - Intergenic
1201886630 Y:18890994-18891016 CAGAGGGAGCAGAAGGCCACTGG + Intergenic
1201942339 Y:19473459-19473481 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1202058227 Y:20857987-20858009 GTGAGGAAGCACAAGGGGTCAGG - Intergenic
1202104985 Y:21354612-21354634 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1202170748 Y:22041120-22041142 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1202220615 Y:22545253-22545275 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1202322498 Y:23650410-23650432 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1202344419 Y:23906300-23906322 CCCAGGAAGCACAAGGGGTCAGG - Intergenic
1202526349 Y:25763783-25763805 CCCAGGAAGCACAAGGGGTCAGG + Intergenic
1202548275 Y:26019646-26019668 CCCAGGAAGCACAAGGGGTCAGG - Intergenic