ID: 1084336912

View in Genome Browser
Species Human (GRCh38)
Location 11:68463785-68463807
Sequence CTAGTTCAAGAGTTCTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084336911_1084336912 14 Left 1084336911 11:68463748-68463770 CCTTTCTTAACTTCAAATGATTG 0: 1
1: 0
2: 1
3: 21
4: 250
Right 1084336912 11:68463785-68463807 CTAGTTCAAGAGTTCTCAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084336912 Original CRISPR CTAGTTCAAGAGTTCTCAGT TGG Intronic
901358672 1:8676250-8676272 CTATCTTAGGAGTTCTCAGTGGG + Intronic
901380603 1:8871265-8871287 CTAGATCACGCATTCTCAGTGGG - Intronic
903761408 1:25701292-25701314 CTAGAACTCGAGTTCTCAGTGGG - Intronic
903881786 1:26515329-26515351 TTAGTTTGAGAGTTCCCAGTGGG - Intergenic
904441703 1:30535955-30535977 CCCATTCAAGAGTTTTCAGTGGG + Intergenic
904975523 1:34453154-34453176 CTAGTTCATGAGCTCCCAGAGGG + Intergenic
905966025 1:42096347-42096369 CTAGGTCATGAGGTCTCAGATGG - Intergenic
907529180 1:55076113-55076135 CTAGATCTATAGTTCTCTGTGGG + Intronic
908800729 1:67877596-67877618 CTAGTTCTAGAATTTTCATTTGG - Intergenic
911949659 1:104155959-104155981 ATATTTTAAGAGTTCTCACTGGG + Intergenic
919298149 1:195727564-195727586 CTAGTTAAATAATTCTCATTTGG + Intergenic
921423807 1:214979227-214979249 CTACTTCAAGAGTTTTCACAAGG + Intergenic
1068257010 10:54524744-54524766 CTAGTTCAAGAGCTTTCTGGTGG + Intronic
1069153723 10:64998795-64998817 CTAATTCAGGAGTTCTGGGTTGG + Intergenic
1073885768 10:108037854-108037876 CTAGATGGAGAGATCTCAGTAGG + Intergenic
1074873550 10:117596387-117596409 CTAGGTCCAGAATTCTCAGGGGG + Intergenic
1076431626 10:130407820-130407842 TTAATCCAAGAGTTCACAGTTGG + Intergenic
1076446860 10:130520429-130520451 CTTTTTCATGTGTTCTCAGTGGG - Intergenic
1082733968 11:56835928-56835950 CTAGTTCAACAGTTTTTGGTGGG + Intergenic
1084336912 11:68463785-68463807 CTAGTTCAAGAGTTCTCAGTTGG + Intronic
1086558816 11:88143575-88143597 CTAGTTCAAGAATCTTCTGTAGG - Intronic
1088874632 11:113924295-113924317 CTATTTCATGATCTCTCAGTTGG + Intronic
1091209847 11:133846797-133846819 CTAGATCAAAAGCTCTAAGTAGG - Intergenic
1094719763 12:33052319-33052341 CTGGTTCAAGTGTCCTCTGTCGG - Intergenic
1095448282 12:42303551-42303573 CTATTGCAAAAGTTCTCAGGTGG + Intronic
1098253064 12:68589180-68589202 TGAGTTCATGAGTTCTCAGATGG + Intergenic
1099616766 12:84945495-84945517 CAATTTCAAGAGTACTAAGTAGG - Intergenic
1103706273 12:122874984-122875006 CCAGTTTAACAGTCCTCAGTTGG - Intronic
1104073229 12:125365668-125365690 CTATTTGTAGAGTTCTGAGTTGG + Intronic
1105467414 13:20658804-20658826 TTACTTCAAGAGTTCTCAACTGG - Intronic
1105470262 13:20687503-20687525 CTTGTTCAAGAGTGCATAGTTGG - Intronic
1105578356 13:21673221-21673243 CTAGTTTAAGTGTTGTCAGGTGG - Intronic
1105733107 13:23239350-23239372 CTAGGTAAAGAGTTCTAGGTTGG - Intronic
1105825142 13:24115724-24115746 CCGGTTCCAGATTTCTCAGTGGG + Intronic
1108186309 13:47892025-47892047 CTAGTTCAAATGATTTCAGTGGG - Intergenic
1109524207 13:63554772-63554794 CTTTTTCAAGAGTTCTCACTAGG + Intergenic
1110762412 13:79245002-79245024 CTAGAACAAGCGTTCTCAATGGG + Intergenic
1112688869 13:101865997-101866019 TTAGTTCAAAACTTCTTAGTTGG + Intronic
1113165496 13:107436046-107436068 CTAGGTCAAAAGTTCTCCGAGGG + Intronic
1115370933 14:32614004-32614026 ATAGTTAAAAAGTTCTCACTAGG - Intronic
1118390593 14:65292058-65292080 CTGGCTCAGGAGTTCTCAGTTGG + Intergenic
1118502278 14:66372897-66372919 CTAGTTCACCAGTTTGCAGTTGG + Intergenic
1119987355 14:79153036-79153058 CTATTACAATAGTTATCAGTTGG - Intronic
1121108130 14:91293976-91293998 CAGTTTCTAGAGTTCTCAGTTGG - Intronic
1121542446 14:94738777-94738799 TTGGTTCAAGATTTCACAGTCGG + Intergenic
1124258795 15:28167828-28167850 CTAGTCCAAGAGTGCACAGTAGG + Intronic
1125836176 15:42753643-42753665 CTAGTGCCACAGTCCTCAGTGGG - Intronic
1126274122 15:46856188-46856210 CTGATTGAAGAATTCTCAGTAGG - Intergenic
1127255312 15:57286153-57286175 ACAGTTCCAGAGTTATCAGTAGG + Exonic
1130046478 15:80449656-80449678 CTTCTTCAAGAGTTTTGAGTGGG + Intronic
1135285231 16:21187572-21187594 CTAGATCAGCAGTTCTCAGTTGG + Intergenic
1135464883 16:22676688-22676710 CTAATTCAGTGGTTCTCAGTCGG - Intergenic
1136015142 16:27392985-27393007 CCAGATAAAGAATTCTCAGTTGG - Intergenic
1137063088 16:35809974-35809996 CTGGCTCAAGATTTCTCAGGTGG + Intergenic
1137985749 16:53106301-53106323 CTGGTTCAAGTGTTCTAACTTGG - Intronic
1139663533 16:68439033-68439055 CTCGTTCAAGTGTTTACAGTGGG - Intronic
1140178550 16:72690324-72690346 CTATTTCATGTATTCTCAGTGGG - Intergenic
1140855588 16:78975211-78975233 CTGGTTCAAGGGTTCTCAGATGG + Intronic
1148568588 17:48648113-48648135 ATATTTCAACAGTTCTCACTTGG - Intergenic
1151621426 17:75247779-75247801 CAAGTACTAGAGTTCTCAGAGGG + Intronic
1157289857 18:46401638-46401660 TTTGTTCAAGAGGGCTCAGTGGG - Intronic
1158621665 18:59037964-59037986 CTAGTTCCAAAGGTCTCAGAAGG + Intergenic
1162897963 19:13776644-13776666 CCAGTGCAAAAGTTCTCAGGTGG - Intronic
1168358963 19:55722102-55722124 CTAGCTCAGTAGTTCTCAATGGG - Intronic
1168570849 19:57467850-57467872 CTGCGTCAAGAGTTCTAAGTTGG + Intronic
926431858 2:12795130-12795152 TTTGATCAAGAGTTCTCAGCCGG - Intergenic
935109786 2:100081900-100081922 GTTGATCAACAGTTCTCAGTAGG + Intronic
935582287 2:104766986-104767008 CCAGTTAACCAGTTCTCAGTTGG + Intergenic
936125189 2:109783309-109783331 GTTGATCAACAGTTCTCAGTAGG - Intergenic
936219504 2:110588159-110588181 GTTGATCAACAGTTCTCAGTAGG + Intergenic
939376690 2:141377566-141377588 CTAGTTCAAAAATTCACTGTTGG + Intronic
939442759 2:142271215-142271237 TTAGGTCAAGAGTTCTCTGTTGG - Intergenic
940152708 2:150620343-150620365 CTAGTTCAAAAGATTTTAGTGGG - Intergenic
941090478 2:161168930-161168952 CTAGATTAAGAGTTCTAGGTTGG - Intronic
942571574 2:177320876-177320898 CTAACTCAAGAGTTCTGATTAGG - Intronic
943027842 2:182650784-182650806 CTCTTTCAAGTGTTTTCAGTTGG - Intergenic
944334803 2:198520057-198520079 CTAGCTGATGAGTTCTCTGTGGG + Intronic
947813140 2:233017203-233017225 CTGGTTCACAAGTACTCAGTAGG - Intergenic
947958168 2:234212862-234212884 GTAGTTCAGGAGTTAGCAGTAGG + Intergenic
1169665044 20:8023780-8023802 CTAGAGCAAGAGTTCCCAGAAGG + Intergenic
1169972040 20:11278668-11278690 CTAGTGCAAAAGTCCTTAGTGGG - Intergenic
1170439627 20:16365949-16365971 CTAAATCTAGAGTTCTCAGAAGG - Intronic
1171876292 20:30580228-30580250 GTAGTCCAGGAGGTCTCAGTAGG + Intergenic
1172995845 20:39069892-39069914 CCAGTTCAAGAGCTCTGAGCTGG - Intergenic
1175084092 20:56444566-56444588 CTAGTTCAGGAGGTCTGGGTGGG + Intronic
1175306135 20:57976944-57976966 CTGGTTCAAGGGTTCTCACCTGG + Intergenic
1178689814 21:34741521-34741543 CTAGTCCAAGATTGCTCAGCTGG - Intergenic
1179070459 21:38066149-38066171 CTAGATCAGGGGTTCTCACTGGG + Intronic
1179080625 21:38167330-38167352 GTAGAGCAAGAGTTCTCAGCTGG + Intronic
1182078229 22:27509840-27509862 CTAGATCATGAGTTCTCTGCAGG + Intergenic
1184638014 22:45850878-45850900 CCAGTTCAAGAATTTTCATTTGG - Intergenic
951409342 3:22343420-22343442 CCAGTTCCAAAGTCCTCAGTAGG - Intronic
952077030 3:29709226-29709248 CAAGTACAAGAATTCTAAGTGGG - Intronic
952728398 3:36613757-36613779 CTAGTTCCAGGCTTGTCAGTAGG - Intergenic
955010314 3:55007530-55007552 CTAATACAAGGGTTATCAGTGGG - Intronic
955627734 3:60937237-60937259 CTAATGTAAGAGTTCTTAGTAGG + Intronic
955986964 3:64583676-64583698 ATAATTCAATAGTTCTCAATTGG - Intronic
956452718 3:69390362-69390384 CTAGTTCAATGGTTCTCAACCGG + Intronic
956517500 3:70065592-70065614 CTACTGCAAGAGTTCTCCCTGGG + Intergenic
957199636 3:77116025-77116047 CAAGTTCAAGAGTTTTCTGCAGG + Intronic
957966947 3:87334154-87334176 CTAGTGGAAAAGTTCTAAGTAGG + Intergenic
958763947 3:98342607-98342629 CTAGCTAAAGTTTTCTCAGTTGG + Intergenic
963212683 3:142710543-142710565 CTAGGTCAAGCATTCTCAATAGG - Intronic
963820776 3:149890312-149890334 CTCAGTCAAGAGTTCACAGTAGG - Intronic
964667746 3:159192522-159192544 CTAGCTCCAGAGTTCCCAGTAGG - Intronic
966599317 3:181759794-181759816 CTTGTTAAAGAGGTCTGAGTTGG + Intergenic
967155458 3:186687625-186687647 CCAGTTCAAGATATCTCAGCAGG + Intergenic
967806800 3:193721618-193721640 CTAGTTATAGAATTCTAAGTTGG + Intergenic
970531256 4:16987797-16987819 TTAGTACTAGAGTCCTCAGTAGG - Intergenic
976325030 4:83761874-83761896 CAAGATCAAGATTTCTCAGCTGG + Intergenic
980015800 4:127648990-127649012 CTAGTTCAAGCCTTCACAGTTGG + Intronic
981340580 4:143617202-143617224 ATAGAGCAAGAGTTTTCAGTTGG + Intronic
983779491 4:171650772-171650794 CGTGTGCAAGAGTTCACAGTGGG - Intergenic
983896556 4:173087122-173087144 CTAGCTCCAGAGTTCCCGGTGGG + Intergenic
983909860 4:173225910-173225932 CTAGCTCCAGAGCTCTCTGTGGG - Intronic
987586867 5:19866615-19866637 CTGGGGCAAGATTTCTCAGTAGG + Intronic
994770512 5:103975094-103975116 TTAGTTCAAGAGTTTCCATTTGG - Intergenic
998502228 5:142643586-142643608 CTATTTGAAAATTTCTCAGTAGG + Intronic
998729306 5:145056084-145056106 CTATTTCAAATGTTCACAGTGGG - Intergenic
998794469 5:145803580-145803602 CTATTTCATGAGTTCTCACAAGG + Intronic
999095879 5:148977932-148977954 CTAGCTCAAGAGTTTATAGTGGG - Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999130794 5:149281810-149281832 CTAGGTAAAGATTTCTAAGTGGG + Intronic
1003795178 6:9593683-9593705 CTGGTTCAAGAGTGCACAATTGG - Intergenic
1005511335 6:26514393-26514415 CTGATTCAGGAGTTCTCAGTGGG - Intergenic
1007925500 6:45646587-45646609 CTCATCCAAGAATTCTCAGTCGG - Intronic
1008968681 6:57341205-57341227 CTAGTTCAGTGATTCTCAGTGGG + Intronic
1009157663 6:60243023-60243045 CTAGTTCAGTGATTCTCAGTGGG + Intergenic
1009942929 6:70309930-70309952 TGAGATCAAAAGTTCTCAGTAGG - Intergenic
1011026827 6:82878601-82878623 CTAGGTCAGGGGTTCTCAGTGGG + Intergenic
1012272181 6:97226964-97226986 CTAGTTCAGTAGTTCTCAACTGG - Intronic
1012492974 6:99802893-99802915 CTATTCCAAGAGTTTTCTGTAGG - Intergenic
1014252956 6:119133508-119133530 CTAGTTTCAGAGCTCTCTGTAGG - Intronic
1015788656 6:136944434-136944456 TTAGTGCTGGAGTTCTCAGTGGG + Intergenic
1021593824 7:22293637-22293659 CGAATTCTAGAGCTCTCAGTGGG - Intronic
1023028273 7:36071532-36071554 CTACTTCAGGACTTCTCATTAGG + Intergenic
1023101307 7:36721293-36721315 TTAGTCCCAGAGCTCTCAGTGGG + Intronic
1024940459 7:54758712-54758734 CTAGTTCGAGAGATCATAGTTGG - Intronic
1028723968 7:94066090-94066112 CTAGCACAGGAGTTCTCAGGAGG - Intergenic
1030899455 7:115104326-115104348 CTAGCTCCAGAGTTCTCCATAGG + Intergenic
1032887218 7:136153788-136153810 CTTGTCCAAGAGTGCTCAGCTGG + Intergenic
1033042875 7:137934206-137934228 CTAGCTCAAGGTCTCTCAGTAGG - Intronic
1036116036 8:5961758-5961780 CTAGATCAGGAGTCCCCAGTGGG - Intergenic
1037470876 8:19209477-19209499 CAAGTTCAAGAGATCTATGTAGG - Intergenic
1039346817 8:36713733-36713755 CCAGTTCCACAGTTCTCTGTTGG + Intergenic
1041539274 8:58964490-58964512 CTGGTTCCAGGGTTCTCAGCAGG + Intronic
1045129317 8:99130963-99130985 CTAGTTCAAGAACTTTCATTAGG + Intronic
1045790087 8:105973222-105973244 CTAGCCCATAAGTTCTCAGTGGG - Intergenic
1048962381 8:139591232-139591254 CCAGTTCCAGAGTTCCCTGTGGG + Intergenic
1052323782 9:27195552-27195574 CTAATTCATGCATTCTCAGTAGG - Intronic
1052380286 9:27763483-27763505 CAACTTCAAGAGTAGTCAGTAGG + Intergenic
1053207648 9:36200471-36200493 CTAGTTCAACAGTTCCCAAGAGG - Intronic
1057264005 9:93602125-93602147 CCAGTTCACGAGTTCTCTGAAGG + Intronic
1061655211 9:132084369-132084391 CTATGTAAAGAATTCTCAGTGGG - Intergenic
1187354611 X:18555277-18555299 CTAGTTCAATAGTTCTCCCTTGG - Intronic
1190703705 X:53007415-53007437 CAGGTTGAAGAGGTCTCAGTTGG - Intergenic
1193707715 X:84843355-84843377 TTAGTCCAGCAGTTCTCAGTGGG + Intergenic
1193711798 X:84889535-84889557 CTAGTCCGGCAGTTCTCAGTGGG - Intergenic
1195641666 X:107182374-107182396 CTAGTTCAGTAGTTCTCAGCTGG - Intronic
1197317702 X:124988436-124988458 CTAGTTCAAAAGTTCCCTTTTGG - Intergenic
1197512030 X:127381461-127381483 CTATTTCAAGAGTTTTAAATAGG + Intergenic