ID: 1084341383

View in Genome Browser
Species Human (GRCh38)
Location 11:68504644-68504666
Sequence CAGGGCTCTCAAATTGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084341383_1084341385 -9 Left 1084341383 11:68504644-68504666 CCTGGTACAATTTGAGAGCCCTG 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1084341385 11:68504658-68504680 AGAGCCCTGAAAGCAGCAATGGG 0: 1
1: 0
2: 1
3: 23
4: 218
1084341383_1084341384 -10 Left 1084341383 11:68504644-68504666 CCTGGTACAATTTGAGAGCCCTG 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1084341384 11:68504657-68504679 GAGAGCCCTGAAAGCAGCAATGG 0: 1
1: 1
2: 1
3: 40
4: 285
1084341383_1084341386 -8 Left 1084341383 11:68504644-68504666 CCTGGTACAATTTGAGAGCCCTG 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1084341386 11:68504659-68504681 GAGCCCTGAAAGCAGCAATGGGG 0: 1
1: 0
2: 1
3: 29
4: 274
1084341383_1084341389 18 Left 1084341383 11:68504644-68504666 CCTGGTACAATTTGAGAGCCCTG 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1084341389 11:68504685-68504707 CTACTATAGCTGTCTAGTGTAGG 0: 1
1: 0
2: 0
3: 3
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084341383 Original CRISPR CAGGGCTCTCAAATTGTACC AGG (reversed) Intronic
908040757 1:60109935-60109957 CAGGCCTCTCTAAATGGACCAGG + Intergenic
908571750 1:65418697-65418719 CAGGGGTCTAAAATTGTCTCTGG + Intergenic
912409128 1:109467382-109467404 CAGGGCGCTCACATTTCACCCGG + Intronic
914736018 1:150417502-150417524 CAGTGTTCTCAAACTGTAACTGG - Intronic
916754436 1:167755351-167755373 CTGGGCTCTCAAATCTTATCAGG - Intronic
921349334 1:214219590-214219612 CAGTGTTCTGAAATTTTACCAGG - Intergenic
923458696 1:234188287-234188309 CAGGGCTCAGAACTTGCACCAGG - Intronic
1065698233 10:28400250-28400272 CAGAGCCCTCAAATTGCAACCGG - Intergenic
1066282274 10:33929134-33929156 CAGGGTTCTGAAATTTTACAGGG - Intergenic
1069539227 10:69281142-69281164 TAGGGCTCTCAAACTTTAGCAGG + Intronic
1072631420 10:97149444-97149466 CATGGCTCTCACATTGAACCGGG + Intronic
1075198566 10:120382368-120382390 GAGGGATCTGAAATTGTCCCAGG - Intergenic
1076005984 10:126948582-126948604 CAGGGCCCTCAAAATGCTCCAGG + Intronic
1076142410 10:128090360-128090382 CTGGGCACTCAAAATGTAACAGG + Intergenic
1076210038 10:128632826-128632848 CAGGTCTCTCTGATTGTCCCAGG + Intergenic
1078609285 11:12806188-12806210 CAGGCCTCTAAATTTGAACCTGG - Intronic
1080319448 11:30989422-30989444 TAGGGCTCTCAGATTCAACCTGG - Intronic
1084341383 11:68504644-68504666 CAGGGCTCTCAAATTGTACCAGG - Intronic
1090344636 11:126059730-126059752 CAGGGCTCTCAAAAGGCACCAGG + Intronic
1092779636 12:11973448-11973470 CAGGCCTCACAGATTGTTCCTGG - Intergenic
1097448701 12:59709662-59709684 CAGGGCTGTCAAAGTGTACCTGG - Intronic
1102939463 12:116926475-116926497 CAGGAGTCTCAAGTTGTATCTGG + Intronic
1103147870 12:118611029-118611051 CAGGGCCCTCAAATAGTCCAGGG - Intergenic
1106920279 13:34555972-34555994 CAGGACTCTGAAATTATCCCTGG + Intergenic
1117631976 14:57703371-57703393 CATGGCTCTCAAATAGCACAGGG + Intronic
1118282496 14:64442369-64442391 CAGGGCTCTCAAGATGCACGGGG + Exonic
1118744909 14:68766779-68766801 CAGGACTCAGAACTTGTACCAGG - Intergenic
1119141618 14:72272492-72272514 CATGGCTCTCAATTTCTACAGGG + Intronic
1120113549 14:80586445-80586467 CAGGGCTTTTGAATTGGACCAGG + Intronic
1120842419 14:89097477-89097499 CACGGCTCTCAAATGCTCCCTGG + Intergenic
1122740404 14:103868703-103868725 CAGGCCTCTTTAACTGTACCGGG + Intergenic
1126821123 15:52505141-52505163 CAGGGCCCTCAATTCGTACATGG + Intronic
1132538688 16:497033-497055 CAGGGCTGTGAATTTGGACCTGG + Intronic
1139667323 16:68466730-68466752 CAGGGCTGTCAAATTCTACTGGG + Intergenic
1141133370 16:81449892-81449914 CAGGCATCTCAGATTGCACCAGG - Intronic
1144719483 17:17458353-17458375 AATGTCTCTCAAATTGTACAAGG + Intergenic
1145177807 17:20716904-20716926 CAGAGCCATCAAATTGTACTGGG + Intergenic
1148896815 17:50843713-50843735 CTGGGCTTTCCAGTTGTACCCGG - Intergenic
1151104274 17:71594332-71594354 CAGAGCTATCTAATTGTAGCAGG - Intergenic
1151598278 17:75091064-75091086 CAGGCCTCCCAAATGCTACCAGG + Intronic
1153804033 18:8696352-8696374 CAGGGCTCCCAGATAGTATCAGG - Intergenic
1158121007 18:54048421-54048443 AAGGGCTCTCAAATACTATCAGG + Intergenic
1158784519 18:60693414-60693436 CAGAGTTCTCAAGTTGTAGCTGG - Intergenic
1167637195 19:50661973-50661995 CCGGGCTCTCAAATTCTTCCTGG - Exonic
924987467 2:285346-285368 CAGGGCTCTCCAGCTGGACCAGG - Intronic
927009914 2:18892554-18892576 CAGGGCTCTCACTTTTTACCAGG - Intergenic
927477586 2:23425807-23425829 CAGTGCTCACAAATGGTACAAGG - Intronic
928425951 2:31177863-31177885 CAGGGCTCTCAGATGGTGCTTGG - Intronic
928813206 2:35254493-35254515 GAGGAGTCTCAAAATGTACCAGG + Intergenic
929401734 2:41590486-41590508 CTAGGCTCTCAAATGGTGCCTGG - Intergenic
931064090 2:58564952-58564974 CAGGGGTCTCAAGGTGTACAAGG - Intergenic
932952572 2:76311002-76311024 CAGAGCTCTCTAGTTCTACCTGG - Intergenic
935262431 2:101366882-101366904 CAGAGCACTTAAATTGTACTAGG + Intronic
940141442 2:150495604-150495626 CAGGGCTCTCAAACATTCCCCGG + Intronic
944692447 2:202170151-202170173 CAGGGCTCACAAATGGCACAGGG - Intronic
1169113471 20:3047584-3047606 AGGGGCTCTCAAATAGGACCTGG + Intronic
1169549471 20:6687519-6687541 CAGGGCTCTCATATTTTCCATGG - Intergenic
1173243027 20:41314889-41314911 CAGGGCTCAGAAACTGCACCTGG - Intronic
1173262294 20:41447284-41447306 CAGGGCTAGCAAACTGCACCTGG + Intronic
1175994920 20:62807750-62807772 CAGGGCTCTGAATCTATACCAGG - Intronic
1181716852 22:24737443-24737465 CAAGGCCCTCACATTCTACCTGG - Intronic
950745684 3:15086391-15086413 CAGGTCTCTCATATGGTACTTGG - Intronic
957681374 3:83440111-83440133 CAGGGCTATCAGATGGTAGCAGG - Intergenic
957745121 3:84330854-84330876 CAGGGCTCTTTAAATCTACCTGG + Intergenic
962014915 3:131429842-131429864 TAGGACTCTCAAATTGAACTTGG + Intergenic
963078462 3:141369255-141369277 CAGGGCTGTCATATTTTACCAGG - Intronic
964388546 3:156174790-156174812 CAGGGGTCTAAAAAGGTACCAGG + Intronic
965424094 3:168499619-168499641 TAAGCTTCTCAAATTGTACCTGG - Intergenic
970671848 4:18405662-18405684 CAGGGCTCTGAAATTGAAATTGG + Intergenic
973204886 4:47549417-47549439 CAGGGAACTCACATTCTACCTGG - Intronic
979156680 4:117401274-117401296 CAGGTCTCTGGAATTCTACCAGG + Intergenic
980081743 4:128351454-128351476 CAGGGCTCTGAATTTTTAACAGG - Intergenic
986499380 5:8383156-8383178 CAGGGTCCACACATTGTACCAGG - Intergenic
991649198 5:68834489-68834511 CAGGGCTCTCCCAGTGCACCAGG - Intergenic
992365083 5:76083060-76083082 CAGGGCTCTGAGTTTGTAGCAGG - Intergenic
994763548 5:103887142-103887164 AAGAGCTCTCAAACTGCACCTGG - Intergenic
996554629 5:124765599-124765621 CATGCTTCTAAAATTGTACCTGG + Intergenic
999202957 5:149829285-149829307 CAAGGCTCTCACAGTGCACCGGG + Intronic
1002283526 5:178147419-178147441 CAGGGCTCTAAAATGGTGCACGG - Intronic
1003054023 6:2803058-2803080 CAGGGCCCCCAACTTGAACCTGG - Intergenic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1011101379 6:83726721-83726743 CATGGCTACCAAATTTTACCTGG - Intergenic
1015474533 6:133645384-133645406 CAGGCCTCTCAAAATATTCCTGG + Intergenic
1018714875 6:166524482-166524504 CAGGCCTTTCATATTGTAACTGG + Intronic
1023546254 7:41320422-41320444 CAGAGCTCTCACATTATAACTGG + Intergenic
1026238239 7:68548173-68548195 CTGAACTCTCATATTGTACCTGG - Intergenic
1028057515 7:86265145-86265167 CAGGGCTCTGACATTTTCCCAGG - Intergenic
1030016014 7:105221946-105221968 GAGGGATCTCAAATTATATCTGG - Intronic
1036029148 8:4946488-4946510 GATGGCTGTCATATTGTACCTGG - Intronic
1038275624 8:26118433-26118455 CAGAGTTCTCAAGTTCTACCAGG + Intergenic
1041263693 8:56044029-56044051 CAATGCTCTCTCATTGTACCAGG + Intergenic
1042460060 8:69054856-69054878 CAAGCCTCTCATATTGCACCTGG - Intergenic
1045479803 8:102582845-102582867 AAGAGCTTTCAAATTGAACCAGG + Intergenic
1047935038 8:129767844-129767866 CTGGGCTCTGAAATTTTCCCTGG - Intronic
1053206968 9:36194475-36194497 CTGGGATCTGAAAGTGTACCTGG - Intronic
1056296047 9:85193991-85194013 CTGGGCTCTCAGACTTTACCTGG + Intergenic
1060584749 9:124778923-124778945 CAGGACACTCACATTCTACCAGG - Intronic
1061046176 9:128166317-128166339 CAGGGCTGTCAAAGCGTTCCGGG + Exonic
1189762107 X:44332461-44332483 CTGGGTGCTCAAATTCTACCTGG - Intronic
1190458162 X:50645088-50645110 CAGCACTCTCAAATTGTAGTGGG + Intronic
1192276560 X:69637360-69637382 AAGGACTCTGAAATTGTTCCTGG + Intronic
1192567516 X:72177805-72177827 CAGAGCTCTCACAGTGTTCCAGG + Intergenic