ID: 1084343719

View in Genome Browser
Species Human (GRCh38)
Location 11:68528368-68528390
Sequence ATATATTTCTTTAGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 834
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 771}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084343719_1084343730 29 Left 1084343719 11:68528368-68528390 CCCTCTTCTCTAAAGAAATATAT 0: 1
1: 0
2: 3
3: 59
4: 771
Right 1084343730 11:68528420-68528442 TAATTTGTGTGTGTGGGGGGGGG 0: 1
1: 6
2: 54
3: 399
4: 2133
1084343719_1084343724 23 Left 1084343719 11:68528368-68528390 CCCTCTTCTCTAAAGAAATATAT 0: 1
1: 0
2: 3
3: 59
4: 771
Right 1084343724 11:68528414-68528436 TTGATTTAATTTGTGTGTGTGGG 0: 1
1: 0
2: 9
3: 80
4: 697
1084343719_1084343726 25 Left 1084343719 11:68528368-68528390 CCCTCTTCTCTAAAGAAATATAT 0: 1
1: 0
2: 3
3: 59
4: 771
Right 1084343726 11:68528416-68528438 GATTTAATTTGTGTGTGTGGGGG 0: 1
1: 1
2: 13
3: 79
4: 701
1084343719_1084343725 24 Left 1084343719 11:68528368-68528390 CCCTCTTCTCTAAAGAAATATAT 0: 1
1: 0
2: 3
3: 59
4: 771
Right 1084343725 11:68528415-68528437 TGATTTAATTTGTGTGTGTGGGG 0: 1
1: 1
2: 16
3: 152
4: 1094
1084343719_1084343721 -10 Left 1084343719 11:68528368-68528390 CCCTCTTCTCTAAAGAAATATAT 0: 1
1: 0
2: 3
3: 59
4: 771
Right 1084343721 11:68528381-68528403 AGAAATATATTGACTCTAGTAGG 0: 1
1: 0
2: 0
3: 16
4: 198
1084343719_1084343727 26 Left 1084343719 11:68528368-68528390 CCCTCTTCTCTAAAGAAATATAT 0: 1
1: 0
2: 3
3: 59
4: 771
Right 1084343727 11:68528417-68528439 ATTTAATTTGTGTGTGTGGGGGG 0: 1
1: 1
2: 13
3: 162
4: 962
1084343719_1084343731 30 Left 1084343719 11:68528368-68528390 CCCTCTTCTCTAAAGAAATATAT 0: 1
1: 0
2: 3
3: 59
4: 771
Right 1084343731 11:68528421-68528443 AATTTGTGTGTGTGGGGGGGGGG 0: 1
1: 9
2: 118
3: 749
4: 3082
1084343719_1084343728 27 Left 1084343719 11:68528368-68528390 CCCTCTTCTCTAAAGAAATATAT 0: 1
1: 0
2: 3
3: 59
4: 771
Right 1084343728 11:68528418-68528440 TTTAATTTGTGTGTGTGGGGGGG 0: 1
1: 2
2: 18
3: 222
4: 1242
1084343719_1084343729 28 Left 1084343719 11:68528368-68528390 CCCTCTTCTCTAAAGAAATATAT 0: 1
1: 0
2: 3
3: 59
4: 771
Right 1084343729 11:68528419-68528441 TTAATTTGTGTGTGTGGGGGGGG 0: 1
1: 1
2: 35
3: 336
4: 1877
1084343719_1084343723 22 Left 1084343719 11:68528368-68528390 CCCTCTTCTCTAAAGAAATATAT 0: 1
1: 0
2: 3
3: 59
4: 771
Right 1084343723 11:68528413-68528435 TTTGATTTAATTTGTGTGTGTGG 0: 1
1: 5
2: 66
3: 752
4: 4559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084343719 Original CRISPR ATATATTTCTTTAGAGAAGA GGG (reversed) Intronic
900388746 1:2423936-2423958 ATAAAATTATTCAGAGAAGAAGG - Intergenic
901533040 1:9865426-9865448 ATATATTTTTTTAGTAGAGACGG - Intronic
902119216 1:14147619-14147641 ATATATTTTTTTAGTAGAGATGG - Intergenic
903251732 1:22058996-22059018 ATATATTTTTGTAGAGAATGGGG + Intronic
903692171 1:25182274-25182296 ATATATTTTTTTGGTGGAGATGG - Intergenic
904099374 1:28010555-28010577 ATATATATTTTTAGAGATGGGGG + Intronic
904252238 1:29233346-29233368 CTATAATCCTTGAGAGAAGAAGG - Intergenic
904264191 1:29308714-29308736 ATATATTTTTTAAAAGAAAAAGG - Intronic
904508093 1:30975910-30975932 ATATATTTTTTTAGTAGAGATGG - Intronic
904653826 1:32027100-32027122 ATATATTTTTTTAGTAGAGATGG + Intronic
904797643 1:33069432-33069454 AAATTTTTTTGTAGAGAAGAGGG - Intronic
905111882 1:35601239-35601261 ATATATTTTTTTAGTAGAGATGG + Intronic
905235088 1:36540885-36540907 ATATATTTTTTTAACAAAGATGG - Intergenic
906005826 1:42469203-42469225 AATTATTTTTTTAGAGACGAGGG - Intronic
906088676 1:43158327-43158349 AATTATTTGTTTTGAGAAGAAGG + Intergenic
906846793 1:49201102-49201124 ATATATTCCCTTAGAGAAAAGGG + Intronic
907172661 1:52483969-52483991 ATATATATTTTTAGAGACGGAGG - Intronic
907218148 1:52884048-52884070 ATATATTTTTTTAGTAGAGACGG + Intronic
907691682 1:56673419-56673441 TTTTATTTCTTTAGAGAACATGG - Intronic
908400583 1:63769431-63769453 ATATATTTCTACAGAGATGAGGG + Intergenic
909857489 1:80556373-80556395 ATATATTTCTCTAAAAATGAAGG - Intergenic
911288376 1:96026220-96026242 ATTTATTTATTTAGTAAAGACGG - Intergenic
911300326 1:96165028-96165050 ATATATTTAATTAAAGAACATGG - Intergenic
912092012 1:106089960-106089982 TGATATTTCTGTTGAGAAGAAGG + Intergenic
912423293 1:109562972-109562994 CTATATTTATTTAGAGTAAAAGG - Intronic
912671559 1:111632740-111632762 ATTTTTTTTTTTAGTGAAGACGG - Intronic
914738137 1:150438109-150438131 ATATATTTTTTTAGTTGAGATGG - Intronic
914809958 1:151020223-151020245 TTATTTTTTTTTAGAGAACAGGG - Intronic
915696073 1:157743429-157743451 AGATATTTTTGTAGAGATGAGGG - Intergenic
916068649 1:161156874-161156896 ATACTTTTCTTTTGAGGAGAGGG + Intronic
916627303 1:166572067-166572089 ATATATTGATATAGAGATGATGG + Intergenic
917250079 1:173049459-173049481 ATACATTTCTTGAGAGAGCAGGG + Intronic
917358543 1:174151625-174151647 ATATATTTCTTTTAATAAGATGG + Intergenic
917400287 1:174641336-174641358 ATATCTTTCTTCAGAGTAGGAGG + Intronic
917568633 1:176238565-176238587 AAATTTTTCTGTAGAGAAGGGGG + Intergenic
918006175 1:180544001-180544023 ATATATTCCTAAAGAAAAGAGGG - Intergenic
918434471 1:184497105-184497127 ATATTTATCTTTTGAGGAGAGGG - Intronic
918739545 1:188110516-188110538 TTATTTCGCTTTAGAGAAGATGG - Intergenic
919290667 1:195625620-195625642 AGTTATTTATTTAGAGAAAAAGG + Intergenic
919517149 1:198540044-198540066 ATTTATTTTTTAAGAGATGAGGG - Intronic
919648596 1:200122830-200122852 GTCTATTTTTTTAGAGAAGCAGG + Intronic
920274757 1:204795861-204795883 ATTTATTTTTGTAGAGATGAGGG + Intergenic
920616521 1:207497494-207497516 ATTTACTCTTTTAGAGAAGAAGG - Intronic
920664041 1:207947115-207947137 ATATATATGGTCAGAGAAGAGGG - Intergenic
921768485 1:219003811-219003833 ATATATGTCTTTATATAAAAAGG + Intergenic
922239040 1:223743496-223743518 GTTTATTTATTTAGAGATGAGGG + Intronic
923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG + Exonic
923340632 1:233004222-233004244 ATGTATTTTTTTAAAAAAGAGGG + Intronic
923379290 1:233398920-233398942 ATATTTTTCTCTAGGGGAGAAGG - Intergenic
923522776 1:234748800-234748822 ATGCATTTTTTTAGAGGAGAGGG - Intergenic
923747571 1:236716805-236716827 ATGTGTTGCTTTAGAGGAGAGGG - Intronic
923985035 1:239372146-239372168 AGAGAATTCCTTAGAGAAGAAGG - Intergenic
924764296 1:247017675-247017697 ATATATTTTTTTAGAGATGAGGG + Intergenic
1064043284 10:11987585-11987607 ATATATTTTTTTAGTAGAGACGG - Intronic
1064284873 10:13983561-13983583 ATATAATTCCCTAGAGAAGAAGG + Intronic
1064503590 10:16004065-16004087 ATATATTTTTTTGGTGAAGTGGG - Intergenic
1064973899 10:21093894-21093916 AAATATCTCTGTAGAAAAGAAGG - Intronic
1065240806 10:23702204-23702226 GTACAGTTCTTTAGGGAAGAGGG + Intronic
1065603987 10:27396944-27396966 AAATATTTCTTAGGATAAGAAGG + Intergenic
1066202630 10:33156915-33156937 AGATATTTCTATAGAGACGATGG - Intergenic
1066244482 10:33569314-33569336 ACATATTTCCTTAGAGAATTTGG - Intergenic
1066578999 10:36859538-36859560 ATATATTTTTTTAAAAAAGTTGG - Intergenic
1066722624 10:38355862-38355884 ATAAGTTTCTTTAGAGGAGGAGG + Intergenic
1067402259 10:45987789-45987811 TTAAATTTTTTTAGAGAAGGGGG + Intronic
1068003863 10:51369860-51369882 ATAAATGTCTTTAGTGTAGATGG - Intronic
1068098736 10:52525055-52525077 ATATATTTCTTTACCCAAAAGGG + Intergenic
1068149857 10:53118116-53118138 ATAGGTTGCTTTAAAGAAGAGGG - Intergenic
1068407729 10:56613112-56613134 TTATATTTCTTTACTGAATAAGG - Intergenic
1068691383 10:59919162-59919184 ACATATTGCTTTAGAGAATTTGG - Intergenic
1068750712 10:60588608-60588630 ATATATTTTTTGAGAGAATTAGG - Intronic
1068908688 10:62355284-62355306 ATATATTTTTTTACTGAATATGG - Intergenic
1069128418 10:64667897-64667919 ATATATGTTTCTAGAGAACAAGG - Intergenic
1069400540 10:68040456-68040478 ATTTATCTCTTTAGAAAAAATGG - Intronic
1069506650 10:69004358-69004380 ATTTATTTATTTAGAGATGGGGG - Intronic
1069528310 10:69194332-69194354 TTTTTTTTCTTTAGAGATGAGGG - Intronic
1070107142 10:73445424-73445446 ATATATTTGTATACTGAAGATGG - Intronic
1070222873 10:74469329-74469351 ATATTTTTCTTTTGAGACAAGGG - Intronic
1071184080 10:83020402-83020424 AAAGTTTTCTTTACAGAAGAAGG + Intergenic
1071198966 10:83195467-83195489 ATATATATATTTAGAGAATCAGG - Intergenic
1072077367 10:91990934-91990956 ATATATTTTTTTAGTAGAGATGG - Intronic
1072344171 10:94487189-94487211 ATATATGTCTTTATAGGTGAAGG + Intronic
1072366666 10:94718030-94718052 ATAAATTTCTTTAGATAGTATGG + Intronic
1073074316 10:100814174-100814196 GTATATTTTTTTAGTGGAGACGG - Intronic
1073364478 10:102927162-102927184 ATATATATATTTAGAGAAAAGGG - Intronic
1073734761 10:106333324-106333346 ACATATTTCTTTTTAGCAGAAGG - Intergenic
1074094632 10:110300293-110300315 ATATATTTCATCAAAGAAAAGGG + Intronic
1074388182 10:113034044-113034066 AATTATTTGTTTATAGAAGATGG + Intronic
1074398600 10:113121670-113121692 ATATATATATTGAGAGAAGGGGG - Intronic
1075482618 10:122795758-122795780 CTTTACTTCTTTGGAGAAGAAGG - Intergenic
1075578163 10:123596032-123596054 ATAACTTTCTTTAGATAAGAGGG - Intergenic
1077584211 11:3438168-3438190 AAATAATTCCTTAGAAAAGAGGG + Intergenic
1077693708 11:4374012-4374034 ACATATTTCTTGAGATAAAATGG - Intergenic
1077750903 11:4967901-4967923 ACATATTGCTTGAGAGAAAAGGG + Intronic
1078602941 11:12749420-12749442 ACAAATTTCTTTAGGGAAAAAGG - Intronic
1078619795 11:12896705-12896727 ATAAATTCCTACAGAGAAGATGG - Intronic
1078748515 11:14138170-14138192 ATGTCTTTCTTGAGAAAAGAGGG - Intronic
1079045317 11:17097118-17097140 ACATACTCCTTTAGACAAGATGG - Exonic
1079674435 11:23207914-23207936 ATATATTTTTTAAGAGAAACAGG - Intergenic
1079851261 11:25538328-25538350 AAATATATCTTCAGAAAAGATGG - Intergenic
1079893034 11:26082030-26082052 ATAGCTTTCATCAGAGAAGATGG - Intergenic
1080349031 11:31360310-31360332 ACATCTTTCTTTAGAGGAGTTGG - Intronic
1080454976 11:32410101-32410123 TTGTATTTCTGTAGAGAACAGGG + Intronic
1080822300 11:35819110-35819132 CAACATTTATTTAGAGAAGATGG + Intergenic
1081076831 11:38686005-38686027 ATACATTTCTTAAGAGATGTAGG - Intergenic
1081178841 11:39962768-39962790 ATGCATTTCTTTACAGAAAATGG - Intergenic
1081197293 11:40177123-40177145 TTTTGTTTCTTTAGAGGAGACGG + Intronic
1081221220 11:40464879-40464901 ATAGATTGCTTTGGAGAGGATGG - Intronic
1081393267 11:42555211-42555233 ATATATTTCTATACAGTATAGGG - Intergenic
1081466286 11:43320934-43320956 AGATATATATTTAGAGAAAAAGG - Intronic
1081829905 11:46100532-46100554 ATATATATCTTTGGTGTAGAGGG + Intronic
1081959598 11:47125490-47125512 TTATATTTATTTAGAAAAGAAGG + Intronic
1082188361 11:49211160-49211182 GCATATTTATTTAGAGAAAAGGG - Intergenic
1084343719 11:68528368-68528390 ATATATTTCTTTAGAGAAGAGGG - Intronic
1084478926 11:69405872-69405894 AGACATTTCTTTAAAGAAGATGG - Intergenic
1084622807 11:70285009-70285031 ATGTATTTCTTTATTTAAGATGG + Intronic
1085212605 11:74794976-74794998 TTTTATTTCTGTAGAGATGAGGG + Intronic
1085305717 11:75484710-75484732 ATTTATTTTTTTAGAGATGGAGG - Intronic
1086097289 11:83063183-83063205 GCATTTTTCTTTAGAGAAGCAGG - Intronic
1086297231 11:85383922-85383944 AGATATTTCTGTAGGGGAGAAGG - Intronic
1086836354 11:91628483-91628505 ATATATTTCTTTAGAAAATGGGG - Intergenic
1086990159 11:93294140-93294162 ACAGATTTATTTAGAAAAGAAGG - Intergenic
1087092801 11:94291960-94291982 CTATATTTTTTTAAAGAAAAAGG + Intergenic
1087229386 11:95642854-95642876 AAATGTTTCTCAAGAGAAGAAGG + Intergenic
1087369958 11:97271431-97271453 ATATCTTTCATTAAAGAAAATGG + Intergenic
1087437667 11:98143666-98143688 ATATCTCTCTTTATAAAAGAAGG - Intergenic
1087505807 11:99020043-99020065 ATATATTTCCATAGAGAATGTGG - Intergenic
1088181063 11:107111785-107111807 ATAAATGTTTTTAGAAAAGAAGG + Intergenic
1088276082 11:108087440-108087462 ACATATATTTTTAGAGAAGTAGG + Intronic
1088905583 11:114153278-114153300 ATAAAGTTCATTAGAGAAAAAGG - Intronic
1089486052 11:118846933-118846955 ATATATTCTTATAGAGATGAGGG - Intergenic
1091180742 11:133602196-133602218 GTATTTTTCTGTAGAGATGAGGG - Intergenic
1091423746 12:367524-367546 GTATATTTTTTTAGAAGAGATGG - Intronic
1091738261 12:2941013-2941035 ATATATCTCTTTAAACCAGAGGG - Exonic
1092236270 12:6811988-6812010 ATAATTTTTTTTAGAGACGAGGG + Intronic
1092787576 12:12041767-12041789 TTTTTTTTCTTTAGAGATGAGGG - Intergenic
1092935615 12:13360956-13360978 GTATATTGCTTTTGAGAAGTTGG + Intergenic
1092984137 12:13828896-13828918 ATATCTTTCTTTAGAGGCCAGGG - Intronic
1093596293 12:20964160-20964182 TTATATTTGTTTACAGAAAAGGG - Intergenic
1093709348 12:22312135-22312157 ATACGTTTATTTAGAGGAGAGGG - Intronic
1093737568 12:22639222-22639244 ATTTATTTTTTTAGAGAAGTGGG + Intronic
1093860926 12:24166230-24166252 ATGTGTTTCTTCATAGAAGAGGG + Intergenic
1093978151 12:25446535-25446557 ATATAATTCTTAAGAGACTATGG + Intronic
1095137286 12:38620919-38620941 ATTTATTTCTTTCAAGTAGAAGG - Intergenic
1095580745 12:43794364-43794386 ATATATTACCTTAGATAATAAGG + Intronic
1095785490 12:46104709-46104731 ATACACTTCTTTAAAAAAGAAGG - Intergenic
1095895026 12:47271228-47271250 TTAAAATTCTGTAGAGAAGAGGG - Intergenic
1096013507 12:48244416-48244438 ATGTATTTCTTTTGAGGAGTGGG - Intergenic
1096387192 12:51202499-51202521 ATTTATTTTTTTAGTAAAGACGG + Intronic
1096495096 12:52035400-52035422 ATACATTTATTTAGACAGGAAGG - Intronic
1096636929 12:52965939-52965961 ATATATTTATTTTGGGAGGAAGG - Intergenic
1096707634 12:53432381-53432403 ATTTATTTATTTAGAGACGGGGG + Intergenic
1096740047 12:53686542-53686564 ATATATTTGTCAAGATAAGAGGG - Intergenic
1097136389 12:56860333-56860355 ATTTATTTATTTTGTGAAGAAGG + Intergenic
1097443330 12:59638326-59638348 ATGGCTTGCTTTAGAGAAGAGGG + Intronic
1097518351 12:60636312-60636334 TTATCTTCCTTTAGAAAAGAAGG + Intergenic
1097696407 12:62779217-62779239 ATATATTTTTTTAGTAGAGACGG + Intronic
1097954704 12:65471572-65471594 ATATATGTCTTAAAAGGAGAGGG - Intronic
1098530185 12:71533027-71533049 ATTTATTTATTTAGAAACGAAGG - Intronic
1098617598 12:72548286-72548308 AAATATTTATTTATAGGAGAAGG - Intronic
1099118523 12:78658990-78659012 ATACATTGTTTTCGAGAAGACGG - Intergenic
1099176265 12:79426518-79426540 ATGAATTTTCTTAGAGAAGAGGG - Intronic
1099247577 12:80212609-80212631 AAATATTTCTCTATAAAAGATGG + Intronic
1099260187 12:80370002-80370024 AAATATTTCTTGAAAGAATAGGG + Intronic
1099506913 12:83489484-83489506 ATGTAATTCTTTAAGGAAGAGGG - Intergenic
1099812625 12:87604432-87604454 TTTTGTATCTTTAGAGAAGAGGG - Intergenic
1099925259 12:89009156-89009178 AAATATTTTTGTGGAGAAGAGGG - Intergenic
1099984984 12:89651662-89651684 AAAAATTACTATAGAGAAGAGGG + Intronic
1100021443 12:90074503-90074525 ACATATTTCTTAAAACAAGAGGG - Intergenic
1100042085 12:90332114-90332136 ATATAATTTTTTAAACAAGAGGG - Intergenic
1100060645 12:90570915-90570937 ATATATTTCTTTGGATAGTATGG + Intergenic
1100204082 12:92329310-92329332 ATATAGTCCTTTATAGAACATGG + Intergenic
1100242466 12:92723356-92723378 ATACTTTTCATGAGAGAAGATGG + Intronic
1100251826 12:92834012-92834034 ATACATTTATATAGAGCAGATGG - Intronic
1100415345 12:94367005-94367027 ATAAATATATTTAGAGGAGAAGG + Intronic
1101056040 12:100914991-100915013 ATATTTTTTTTTAGAGATGGAGG + Intronic
1101347507 12:103900176-103900198 ATATATATCTTTATATATGAAGG + Intergenic
1101394235 12:104330115-104330137 GTATTTTTTTTTAGAGAAAATGG + Intronic
1101895097 12:108750443-108750465 ATATCTTTTTTAAGAGAGGAAGG + Intergenic
1101955771 12:109211421-109211443 TTGTATTTTTTTAGTGAAGATGG + Intronic
1102358690 12:112263820-112263842 TTATAGTTCTTAAAAGAAGATGG + Intronic
1102407996 12:112690781-112690803 AAATATTTCTTTTTACAAGATGG + Intronic
1103715314 12:122941730-122941752 ATTTATTTTTTTTGAGAGGAGGG + Intronic
1103768062 12:123297187-123297209 TTATATTTTTTTAGTGGAGATGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104196849 12:126548488-126548510 ATATATTTTTTTAGTAGAGACGG + Intergenic
1104644733 12:130488872-130488894 ATATATTTCTGCAGATTAGAAGG - Intronic
1105276137 13:18928682-18928704 AAAAATTTCTTTAGAAAAGGAGG - Intergenic
1105393506 13:20005547-20005569 ATATATTTATTTAAACAAGCAGG + Intronic
1105646539 13:22324602-22324624 TTATATTTCTTTTGACTAGATGG - Intergenic
1106123241 13:26879505-26879527 AAAAATTTCTGTAGAGATGAAGG - Intergenic
1106232261 13:27829918-27829940 AAATCTTCCTTCAGAGAAGACGG - Intergenic
1106911507 13:34468060-34468082 CTTTATTTCTTTAGTAAAGATGG - Intergenic
1107050677 13:36045250-36045272 ATATATATATATATAGAAGATGG - Intronic
1107144791 13:37049399-37049421 ATATGTGTCTTTAGAAATGATGG - Intronic
1107235424 13:38162841-38162863 ATATATTTTTTTAAAGATGTGGG - Intergenic
1107645926 13:42494373-42494395 ATAAATTTCTCTAAAGAGGATGG + Intergenic
1108216089 13:48186017-48186039 ATATATTTTTTTAGTGGAGACGG - Intergenic
1108290262 13:48953026-48953048 ATATATTTTTTAAGACAAAATGG - Intergenic
1108834721 13:54528974-54528996 GTTTACTTCTTTAGAAAAGAAGG - Intergenic
1108837963 13:54574834-54574856 AAATATTTATTAAGAGGAGAGGG - Intergenic
1108922259 13:55691125-55691147 ATTTATTTATTTATATAAGATGG + Intergenic
1109068153 13:57727543-57727565 ATATAGTTCTCAAGAGAATAAGG - Exonic
1109097384 13:58134870-58134892 ATATACTTCTTTAAAAAACAAGG + Intergenic
1109271955 13:60266027-60266049 ATTTATTTATTTAGAGATGAGGG + Intergenic
1109363853 13:61330105-61330127 ATATTTTTTTTTAAAAAAGAAGG + Intergenic
1109480258 13:62943949-62943971 ATATAGTTAATTAGAGAAGGTGG - Intergenic
1109570410 13:64180849-64180871 ATATAGGTATTTAGAGAGGATGG - Intergenic
1109614329 13:64810095-64810117 AAATATTTTTGCAGAGAAGAAGG + Intergenic
1109903332 13:68803578-68803600 ATATATTTTTTGAGGGAGGATGG - Intergenic
1110386505 13:74918098-74918120 AAATGTTTATTTAGAGAAAATGG - Intergenic
1110801085 13:79695885-79695907 ATGTATATGTTTAGGGAAGAAGG + Intergenic
1110869878 13:80438378-80438400 AAATGTTTCTTTAGAGTACAAGG - Intergenic
1110988033 13:81998809-81998831 TTATTTTTGTTTAGACAAGAAGG - Intergenic
1111835405 13:93382846-93382868 AAATATTGCTTTAGGGAAGTAGG - Intronic
1112150254 13:96751863-96751885 ATAAACTTTTTTAAAGAAGAAGG - Intronic
1112767597 13:102762528-102762550 AAATATTTTTGTAGAGAACAGGG - Intergenic
1112892301 13:104252979-104253001 ATGTATTTATTTAAAGAAGTCGG - Intergenic
1112951585 13:105004339-105004361 TTATTTATCTCTAGAGAAGACGG - Intergenic
1112999658 13:105619285-105619307 ATATATTTATATATAGAATATGG + Intergenic
1113028614 13:105969495-105969517 ATATATTTCTTAACAGATGGGGG + Intergenic
1113276279 13:108734348-108734370 ATCAATTTTTCTAGAGAAGAAGG - Intronic
1114439502 14:22734807-22734829 ATATATTTTTTTAGTAGAGACGG - Intergenic
1114986288 14:28232976-28232998 ATATATATATTTAAAGGAGATGG - Intergenic
1115036363 14:28861533-28861555 CTATATTTATTGAGAGAAAAGGG - Intergenic
1115347227 14:32355947-32355969 ATATATTTTTTTCGTAAAGACGG + Intronic
1115848563 14:37567061-37567083 CTTTATTTCTTCGGAGAAGATGG - Intergenic
1116070910 14:40044419-40044441 AAATACTTATTGAGAGAAGATGG - Intergenic
1116411980 14:44634767-44634789 ATCAATTTCTTTAAAGCAGATGG - Intergenic
1116509943 14:45732430-45732452 ACATAATGCTTTAGAGAACATGG + Intergenic
1116649296 14:47568496-47568518 AAATATGTCTTTAGAGAAGGTGG + Intronic
1117419871 14:55533781-55533803 ATATATTTCTTTAAATAAACTGG + Intergenic
1118268849 14:64322362-64322384 AATTATTTTTTTAAAGAAGAGGG + Intronic
1118844251 14:69534751-69534773 TTGTATTTCTTTAGAAGAGACGG + Intergenic
1118946359 14:70391273-70391295 ATTTATTTTTTTAGAGAATAGGG - Intronic
1119074943 14:71628110-71628132 ATTTATTTTTTTAGAGACGGGGG - Intronic
1120094340 14:80371096-80371118 AGACATTTCTTTAAAGAAGATGG - Intronic
1121067194 14:90979256-90979278 ATTTATTTTCTTAGAGAAGTGGG + Intronic
1121165956 14:91799920-91799942 TTATATTTCTTTTGAGATGTAGG - Intronic
1121296134 14:92825980-92826002 AAATATTTTTTTAGAGATGATGG - Intronic
1121940487 14:98065761-98065783 ATTTATATTTTTATAGAAGAAGG + Intergenic
1121986465 14:98511612-98511634 ATATATGTCTAAAGAGTAGAAGG + Intergenic
1122151755 14:99729658-99729680 ATATATTTTTTTAGTAGAGACGG + Intergenic
1122683505 14:103485860-103485882 ATATATTTTTATAGAGACGGGGG - Intronic
1124711224 15:32014007-32014029 ATCTATGTGATTAGAGAAGAGGG - Intergenic
1124986080 15:34616312-34616334 AAATAATTCTTTAGAGACAATGG + Intergenic
1125058888 15:35395094-35395116 ATTTATTTCTGCAGAGAACAAGG - Intronic
1125146705 15:36478441-36478463 ATATATTTCTAAATAGAAAAAGG + Intergenic
1125195767 15:37044268-37044290 ATTTATTTCTTTAGCAGAGAGGG - Intronic
1126077744 15:44929660-44929682 ATTAATTTTTTTAGAGAAGGGGG + Intergenic
1126195934 15:45931911-45931933 ATATATGTATTTTGAGATGAAGG - Intergenic
1126229048 15:46304155-46304177 ATATATATTTTTAGTGAATATGG - Intergenic
1127046779 15:55034420-55034442 TTTGTTTTCTTTAGAGAAGATGG - Intergenic
1127048062 15:55048776-55048798 ATATATTTTTTTTGTAAAGAGGG - Intergenic
1127386354 15:58470268-58470290 AGAGATTTGTTCAGAGAAGAGGG + Intronic
1127387844 15:58481630-58481652 TTATATTTTTTTAGAAGAGATGG - Intronic
1127558613 15:60113057-60113079 ATATATTCCTTTACAGATTAAGG - Intergenic
1127938904 15:63672936-63672958 ATTTCTGTTTTTAGAGAAGAGGG + Intronic
1128089232 15:64907760-64907782 ATATATTTTTTTAGTAGAGATGG + Intronic
1128278581 15:66375345-66375367 ATTTATTTATTTAGAGACAAGGG + Intronic
1129489288 15:75907723-75907745 TTATATTTTTTTAGTGGAGACGG - Intronic
1129618796 15:77123733-77123755 AGATTTTTATTTAGAGAACAGGG + Intronic
1129958217 15:79658750-79658772 ATCTCTTGCTTTAAAGAAGAAGG - Intergenic
1130754035 15:86744010-86744032 ATATATATATTTAAATAAGATGG - Intronic
1131175863 15:90209378-90209400 ATATATTTTTTTAGTAGAGATGG - Intronic
1131637715 15:94255218-94255240 AAATACATCTTTAGGGAAGATGG + Intronic
1131944208 15:97601267-97601289 TTTTAGTTCTTTGGAGAAGAGGG + Intergenic
1132191479 15:99865912-99865934 ATTTATTTATTTTGAGAAGCAGG - Intergenic
1132259145 15:100406754-100406776 AAAGATTTCTGTAGAGAACAAGG + Intronic
1133252045 16:4489046-4489068 ATACATTTCTTTATATAAGGAGG + Intronic
1134138871 16:11699320-11699342 ATATATTTATTTATAGTAAAGGG - Intronic
1134415098 16:14036662-14036684 ATATATTTCTATATATATGATGG - Intergenic
1134478456 16:14596563-14596585 ATATATTTTTTTTGTGGAGAAGG - Intronic
1135239232 16:20788835-20788857 ACATATTTCTTTAGATAACTGGG + Intronic
1135600821 16:23781975-23781997 ATCTATTTATTTAGAGATGGAGG + Intergenic
1135684185 16:24484942-24484964 TTATATTTTTTTAGTGGAGATGG - Intergenic
1137071886 16:35910791-35910813 ATATATTTGGTTATAGAAAAAGG + Intergenic
1137942021 16:52697522-52697544 ATATGGTTGTATAGAGAAGAGGG + Intergenic
1138389515 16:56659900-56659922 ATTTATTTATTTAGAGACAAGGG - Intronic
1139784340 16:69379457-69379479 TTAGGTTTCTTTAGAGAACAAGG - Intronic
1140222182 16:73051818-73051840 ATATTTTTGTTTAAAAAAGAAGG - Intronic
1140672575 16:77293528-77293550 ATATATTCCTTTATAGCAGAGGG - Intronic
1140770169 16:78196234-78196256 AAATATTCCATTAGTGAAGAAGG + Intronic
1140853495 16:78956323-78956345 ATATATATTTTTAGTGAAGGCGG + Intronic
1141121932 16:81365874-81365896 TTATTTTTCTTTGGAGAACAGGG - Intronic
1141211922 16:81989338-81989360 ATATATTTGTATAGAAAACAGGG - Exonic
1142401353 16:89860431-89860453 ATATTTTTCTATAGAGCTGAGGG + Intronic
1143333949 17:6158599-6158621 ATTTATTTATTTAGAGACGGAGG - Intergenic
1143425866 17:6837129-6837151 AAATATTTCTATAAATAAGAGGG + Intergenic
1143493568 17:7297579-7297601 ATATATTTTTTTAATAAAGACGG - Intergenic
1143686380 17:8520069-8520091 ATATATTCATTGAGAAAAGATGG + Intronic
1143920146 17:10324829-10324851 ATTTATTTCTTTAGAGACAAGGG + Intronic
1143959124 17:10699841-10699863 ATATTTTTCTTGAGAGAAGCAGG + Intronic
1144358812 17:14471225-14471247 CAATATTTGTTTAGAGGAGAAGG + Intergenic
1144793566 17:17875898-17875920 CTAGATTTCTCTAGAGAAAATGG + Intronic
1146011957 17:29202200-29202222 ATATATTACCTTAGATAATAAGG + Intergenic
1146046430 17:29512228-29512250 ATATATTTTTTTAGTAGAGACGG + Intronic
1146207673 17:30919019-30919041 ATTTTTTTCTTTAGAGACAAGGG - Intronic
1146974258 17:37097456-37097478 ATAAATTCGTTTTGAGAAGATGG + Intronic
1147045608 17:37749662-37749684 ATTTATTTATTTAGAGAATGGGG - Intergenic
1147916652 17:43891590-43891612 AGTTATTTCTTTTGAGAAGTGGG - Intronic
1148457961 17:47821078-47821100 AGATACTTCATGAGAGAAGAGGG + Intronic
1148503959 17:48112906-48112928 ATATATTTTTTTAGTAGAGATGG + Intronic
1148538985 17:48464833-48464855 TTATATTTTTTTAGAGACGAGGG + Intergenic
1148540317 17:48475086-48475108 ATTTATTTTTTTAAAGAAAAAGG - Intergenic
1148999707 17:51744605-51744627 ATTTATTTATTTAGAGAGAAAGG - Intronic
1150044738 17:61901258-61901280 ATTTATTTATTTAGAGATGGGGG - Intronic
1151695355 17:75713189-75713211 ATATTTTTTTTTAAAAAAGATGG - Intergenic
1152400281 17:80062101-80062123 ATTTATTTCTTTAGAGACGGGGG - Intronic
1153090816 18:1340470-1340492 ATTTATTTCTTTGTAGACGACGG - Intergenic
1153206147 18:2704065-2704087 TTAAATTTCCTTAGAGATGATGG - Intronic
1153495984 18:5700170-5700192 CCATATTTCTTTATAGAATAGGG + Intergenic
1155601467 18:27553596-27553618 ATTTATTTCTTTACAAAACAAGG + Intergenic
1155644518 18:28061470-28061492 TTGTATTTCTTTAGTAAAGATGG - Intronic
1155646610 18:28085946-28085968 TTATTCTCCTTTAGAGAAGATGG - Intronic
1155869573 18:31009225-31009247 ATTTTTTTCTTTAGTAAAGATGG + Intronic
1156853267 18:41753161-41753183 ATTAATTTATTTATAGAAGAAGG + Intergenic
1157116692 18:44868861-44868883 ATATATTTCCTTAGAGAGATGGG - Intronic
1157135129 18:45046542-45046564 GTGTATTTATTCAGAGAAGAAGG + Intronic
1157907953 18:51586377-51586399 ATTTATTTTTTTAAAAAAGATGG + Intergenic
1158034778 18:53013748-53013770 ACATATTTCTTGAGAAAAGCAGG - Intronic
1159052051 18:63429652-63429674 ATATATTAATTCAGAGTAGATGG + Intergenic
1159068194 18:63592775-63592797 ATAAATTTATTTAGAGATGTTGG + Intronic
1159212566 18:65345034-65345056 ATATGTTTCTTAAGAGAAAGTGG - Intergenic
1159288626 18:66387605-66387627 ATATGTTTCTCTAGAGAGAAAGG - Intergenic
1159750891 18:72301839-72301861 AAATATTCCTATAGAGAAGGTGG - Intergenic
1159877175 18:73826111-73826133 ATATATATTTTTGGAGTAGAGGG - Intergenic
1159907993 18:74115663-74115685 ATGTATTTCTTTAGAAAGTATGG - Intronic
1160000485 18:75015464-75015486 ATATAATTCTTTAGACAACTTGG - Intronic
1162356926 19:10191820-10191842 ATTTTTTTTTTTAGAGATGAGGG - Intronic
1162516909 19:11153893-11153915 ATATATTTTTTTAGTAGAGACGG - Intronic
1162894947 19:13759593-13759615 ATTTATTTATTTAGAGATGCTGG - Intronic
1163273072 19:16265927-16265949 AAATATTTATTGAAAGAAGAGGG + Intergenic
1164031160 19:21406866-21406888 ATAGATTACTTTGGAGAATATGG + Intronic
1164579620 19:29426398-29426420 ATATATTTCTTTATGCCAGAAGG - Intergenic
1164806951 19:31124306-31124328 ATTTATTTATTTAGTAAAGACGG - Intergenic
1164887511 19:31794867-31794889 ATGTTTTTCTTTGGAGAATAAGG - Intergenic
1164973649 19:32553581-32553603 ATATATTTATATGGAGAAGTGGG + Intergenic
1165019196 19:32909188-32909210 CTAAATTTCCTTAGAGAAGTGGG - Intronic
1165533098 19:36420395-36420417 AAAGCTTTCTTTATAGAAGAAGG + Intergenic
1165583239 19:36888048-36888070 ATATATTTCTTTATATATTAAGG - Intronic
1166442851 19:42831037-42831059 GTATATTTCTTTGTAAAAGAAGG + Intronic
1166521507 19:43483449-43483471 TTAAATTTCTGTAGAGATGAGGG + Intronic
1166878407 19:45912281-45912303 ATATATTTTTTTAGTGGAGATGG - Intergenic
1167343489 19:48930492-48930514 ATATTTTTTTTTTGAGATGAAGG - Intergenic
1168480781 19:56718031-56718053 CTATATTTTTTTAGAACAGACGG - Intergenic
925776073 2:7337589-7337611 ATATATGTCTTTACACAAGGAGG + Intergenic
926538656 2:14146655-14146677 AGATATTTCTTTAGGGAGGCAGG + Intergenic
926630632 2:15133028-15133050 TGATATTTCTTGAGAAAAGATGG - Intergenic
927280550 2:21301721-21301743 ATATCTTTAATTACAGAAGAGGG - Intergenic
928269046 2:29838816-29838838 ATATATCTCAATAGGGAAGAGGG + Intronic
928822560 2:35379435-35379457 ATATATATCTTAAGAAAAAAAGG - Intergenic
929252757 2:39777822-39777844 TCATTTGTCTTTAGAGAAGATGG + Intronic
929315442 2:40472536-40472558 ATATTTTTTTTTAGAGACAAGGG + Intronic
929717419 2:44327125-44327147 ATGTAGCTCTTTAGAGAAAAAGG + Intronic
929932869 2:46272365-46272387 ATTTATTTCTTAGGAAAAGAAGG - Intergenic
929955013 2:46451082-46451104 ATATATATTTTTAGAGATGGGGG - Intronic
930154490 2:48092291-48092313 ATATATTTCCTTATATCAGAGGG + Intergenic
930842839 2:55866603-55866625 ATATATTTCTTTAGAAAATGGGG - Exonic
930855187 2:56008657-56008679 ATATATTTTTTGAAAAAAGATGG - Intergenic
931057946 2:58493879-58493901 TGATGTTTCTTGAGAGAAGAGGG + Intergenic
931840777 2:66145836-66145858 ATGTTTTACTTTAGACAAGATGG + Intergenic
932123252 2:69120491-69120513 ATATATTTTTTTAGTACAGATGG - Intronic
932254586 2:70273472-70273494 CTATATTTTTTTACAGAACAAGG - Intronic
933052823 2:77621127-77621149 ATAAATTTCTTTAGGTAATATGG - Intergenic
933172367 2:79138196-79138218 ATATATTTCTCTTGAGAATCTGG + Intergenic
933227919 2:79772402-79772424 ATACAGTACCTTAGAGAAGATGG + Intronic
933449500 2:82429064-82429086 AAATATTTCTTAGAAGAAGAAGG - Intergenic
933503760 2:83150686-83150708 GAATATTTCCTTATAGAAGAAGG - Intergenic
934031037 2:88047253-88047275 ATTTATTTATTTAAAGAACAGGG + Intronic
935233797 2:101121096-101121118 ATATATTTTCTTAGAAAAGAGGG - Intronic
936474288 2:112826185-112826207 ATAAATTTCTTTACGGAAGATGG + Intergenic
936799310 2:116247844-116247866 ATTTATTTCTTTAATGAAGCTGG - Intergenic
937038237 2:118800269-118800291 ATATATATCTGAAGTGAAGAGGG + Intergenic
937144025 2:119627035-119627057 ATATATGTATTGGGAGAAGATGG - Intronic
937617821 2:123946651-123946673 ATATATTTGTTTAAAAAAGGGGG + Intergenic
939028615 2:137043849-137043871 ACAGATTTATTAAGAGAAGATGG - Intronic
939298971 2:140308100-140308122 GTATATTGCTTTTGAGAAAATGG - Intronic
939302758 2:140367138-140367160 TATTATTTCTTTAAAGAAGAAGG + Intronic
939344835 2:140950658-140950680 TTGTATTTCTTTAGTAAAGATGG + Intronic
939381063 2:141436863-141436885 ATATAGTTCTTAACAGAACATGG + Intronic
939383311 2:141464602-141464624 ATATATTTTTTTAGTAGAGATGG + Intronic
939968572 2:148635397-148635419 ATTTATTTATTTAGAGACGGGGG - Intergenic
940232107 2:151466636-151466658 ATCTTTTACTTTAGAAAAGATGG + Intronic
940361526 2:152800988-152801010 ATATCTTTCTTTATAGCAGAGGG - Intergenic
940519653 2:154727932-154727954 ATATATTTATTTAAAGTATATGG + Intronic
940547915 2:155113996-155114018 ATTTATTTTTTAAGAGATGAGGG - Intergenic
941107016 2:161365517-161365539 ATATTTTTTTTTAGAAAAAAAGG - Intronic
941115142 2:161463057-161463079 ATAAATTTCTTAAGAGTACAGGG + Intronic
942182468 2:173393477-173393499 TTTCATTGCTTTAGAGAAGAGGG - Intergenic
942351977 2:175062395-175062417 ATATATAACTTTACAGAGGATGG - Intergenic
942671449 2:178380270-178380292 AAATTTTTTTTTAGAGATGAAGG - Intronic
942755319 2:179334403-179334425 ATAGGTTTCTTCAAAGAAGAAGG - Intergenic
943112885 2:183627911-183627933 ATGAATATCATTAGAGAAGAGGG - Intergenic
943363196 2:186945568-186945590 ATATATTTTTAAAAAGAAGAGGG - Intergenic
943551227 2:189341944-189341966 ATCTTTTTCTTTAGATAATACGG - Intergenic
943569244 2:189553585-189553607 ATGTATTTGTGTAAAGAAGAAGG - Intergenic
943784696 2:191864305-191864327 TTATTTTTCTTTTGACAAGACGG + Intergenic
943841956 2:192594790-192594812 ATATTTCTCTTTTGAGCAGAAGG + Intergenic
943952609 2:194149411-194149433 ATATTTTTCTTTAAAGAATTAGG + Intergenic
944261082 2:197677894-197677916 ATAAGTTTCTTTAGGGCAGAGGG - Intergenic
944649257 2:201812272-201812294 ATATATCACTTTAGTAAAGAGGG + Intronic
945459276 2:210085622-210085644 CTATATTTCTGTTGAGAAGATGG - Intronic
945609735 2:211984900-211984922 ATTTATTTTTTTAGTGGAGACGG + Intronic
945854688 2:215054848-215054870 ATATTTTTATTCAGAGAAAATGG + Intronic
945900874 2:215536145-215536167 ATTTTTTTCTATAGACAAGAAGG - Intergenic
946245491 2:218384893-218384915 ATTTATTTATTTAGAGATGGGGG + Intronic
946625644 2:221609796-221609818 ATTTATTTGTTTTGAGATGAGGG + Intergenic
946707181 2:222469783-222469805 ATATTTGTCTTTTTAGAAGAAGG - Intronic
946875392 2:224124944-224124966 ATATATATATTTAGAGATGGGGG - Intergenic
946928091 2:224645500-224645522 ATACATTTCTTTAGCCAACAAGG - Intergenic
947079762 2:226383068-226383090 ATTTAGTTCTGTAGGGAAGAGGG + Intergenic
947223911 2:227821842-227821864 CTATATTTTTTTAAAAAAGAGGG - Intergenic
948168703 2:235882992-235883014 ATTTATTTTTTTAGAGATGGGGG + Intronic
1168785746 20:538763-538785 TCATATTTTTTTAGAGGAGATGG - Intronic
1169592003 20:7154359-7154381 ATATATTTCTTCAGTGAAAAAGG - Intergenic
1169961780 20:11168207-11168229 GGATATTTCTTCAGAGAAGTGGG + Intergenic
1169984954 20:11433919-11433941 ATATATTTATTAAGAGAAGGTGG - Intergenic
1170020504 20:11832132-11832154 CTGTATTTCTATAGAGAAGATGG - Intergenic
1171036824 20:21719434-21719456 ATATATTTCACCAGAGAAAAAGG - Intergenic
1172494941 20:35373998-35374020 ATATATTTCTTTAGAGACAAGGG - Intronic
1172679695 20:36703389-36703411 ATATATATATTTAGAGACGAGGG - Intronic
1173598387 20:44275065-44275087 AAATTTTTCTGTAGAGAGGAGGG + Intronic
1173612779 20:44382791-44382813 ATTTATTTATTTAGTGTAGATGG - Intronic
1174233249 20:49064981-49065003 AAATTTTTTTGTAGAGAAGAGGG - Intronic
1174578715 20:51555820-51555842 AGATATTGCCTTAGAGAGGAAGG + Intronic
1174898713 20:54476270-54476292 AAATATTTATTTCGAGTAGATGG - Intronic
1175153531 20:56953941-56953963 ATATATTTATTTTTAGAAGTAGG - Intergenic
1175857122 20:62127571-62127593 TTATCTTCCTTTAGAGAAGTTGG + Intronic
1177127204 21:17209925-17209947 ATAAAATTCTTTCAAGAAGATGG + Intergenic
1177344063 21:19845744-19845766 AAATTTTACTTTAGAGAAAATGG + Intergenic
1179223328 21:39429350-39429372 ATATATTTCATCAGAAGAGAAGG - Intronic
1179932035 21:44577164-44577186 ATTTGTTTTATTAGAGAAGAAGG + Intronic
1181281656 22:21725077-21725099 TTATATTTTTTTAGTAAAGATGG + Intronic
1181541808 22:23577364-23577386 ATTTATTTTTTTAGAGATGGGGG - Intronic
1182155649 22:28070441-28070463 AGAAATTTCTGTAGAGAACAGGG + Intronic
1182179265 22:28328433-28328455 ATATATTTTTTTAAAGAAACAGG - Intronic
1182324596 22:29502796-29502818 ATTTATTTATTTAGAGACCAAGG + Intergenic
1183447038 22:37864225-37864247 TTATATTACTGTAGAGACGAGGG + Intronic
1183800366 22:40158333-40158355 ATTTATTTATTTATTGAAGATGG - Intronic
1183966526 22:41446027-41446049 TTATGTTTCTTTGGAGAACAAGG + Intronic
1184953026 22:47859295-47859317 ATATATTTGTATATAGAATAAGG - Intergenic
949148410 3:732900-732922 ATGTATTTTTTTAGAGAAAAAGG - Intergenic
949455754 3:4236580-4236602 ATTTATTTATTTAGAGATGGGGG - Intronic
949991947 3:9586714-9586736 ATATATTTATTTATTTAAGATGG + Intergenic
950884404 3:16350344-16350366 ATTTGTTTCTTTAGAAGAGATGG + Intronic
951126045 3:18984719-18984741 ATAAATTTTTATAGAGAAAAAGG + Intergenic
952110406 3:30117066-30117088 TTTTATTTCTTTTGAGAAGCAGG + Intergenic
952151436 3:30596990-30597012 ATATGTTTCATTAGAGCAGATGG + Intergenic
952242236 3:31543657-31543679 ATATTATTCTTTATAGAAGAAGG + Intronic
952495149 3:33909307-33909329 ATTTCTTCATTTAGAGAAGAGGG - Intergenic
952519652 3:34143871-34143893 AGATATTTTCTTAGAGAAGAAGG + Intergenic
954099967 3:48363629-48363651 ATATTTTACTTTAGAAAAGAGGG + Intergenic
954543678 3:51414850-51414872 TCATAAATCTTTAGAGAAGAAGG + Exonic
954719459 3:52548826-52548848 TTTCATTTCTTTAGAGTAGAAGG - Intronic
954948712 3:54449901-54449923 ATATATTTATTTAGATACAAAGG - Intronic
955432662 3:58864612-58864634 AGATATTTTTTTAAAGAAGCTGG - Intronic
956043576 3:65172046-65172068 TGTTATCTCTTTAGAGAAGATGG - Intergenic
956187635 3:66577589-66577611 AAGTATTTCTTTAGAAAAGGGGG + Intergenic
957267960 3:77991698-77991720 ATGTGTTTCTTTATAGATGAAGG + Intergenic
957303205 3:78420471-78420493 AAATCTTACTTTAGACAAGAAGG + Intergenic
957680919 3:83433225-83433247 GTATTTTTCTTTAGAAGAGATGG + Intergenic
957853216 3:85838557-85838579 ATATACTTTTTTGGAGGAGAGGG + Intronic
957858440 3:85909879-85909901 ATTCATTTCTTTGGGGAAGAAGG + Intronic
958075394 3:88669847-88669869 ATATTTTTCTTTCTATAAGAAGG + Intergenic
958528650 3:95294414-95294436 ATCTAATCCTTTAGAGAAGAAGG + Intergenic
959095908 3:101955456-101955478 ATATAGTTGTTCAGAGAAGAGGG + Intergenic
959098646 3:101985281-101985303 ATATATTTGTTTACAGAAAAAGG + Intergenic
959134946 3:102406241-102406263 GTTTATTTCTATAGTGAAGAAGG - Intronic
959148622 3:102580611-102580633 ATAGTTTTCTCTAGGGAAGATGG + Intergenic
959342899 3:105153484-105153506 ACAAATTTCATTAGAGAAGTTGG + Intergenic
959383734 3:105675516-105675538 AAATATTTCTTTTGAAAAGGAGG + Intronic
959734716 3:109645761-109645783 ATATATTATTTTTGAGAAGTAGG + Intergenic
959895827 3:111604758-111604780 ATCTAGCTCTTTACAGAAGAAGG - Intronic
960095949 3:113690112-113690134 ATAGATCTCTTAAGAGAAAAGGG - Intronic
960336255 3:116421069-116421091 CTATATAATTTTAGAGAAGAAGG + Intronic
960554042 3:119007904-119007926 ATATATTTTCTGAGGGAAGAAGG - Intronic
960600554 3:119453811-119453833 ATAAATTTGTTTGGAGAAGCAGG + Intronic
960864616 3:122186429-122186451 ATATAATTCTTAAGATAACACGG + Intronic
960881966 3:122354514-122354536 ATATTTGTCCTTAGAGAAGTAGG + Intergenic
962023946 3:131527636-131527658 ATGTATTTTTTTAGTGGAGACGG - Intergenic
963854485 3:150239641-150239663 ATATATTTCTTTACATAAATGGG - Intergenic
963917932 3:150877142-150877164 AGAGATTTACTTAGAGAAGACGG + Intronic
964044164 3:152301423-152301445 ATATATTTTTAAAGACAAGATGG - Intronic
964061134 3:152525231-152525253 ATATACTTCTCAAGAGAAAAAGG - Intergenic
964284277 3:155100846-155100868 ATTTATTTATTTATTGAAGATGG - Intronic
964737597 3:159932597-159932619 ATATATCACTTTGGAGGAGAAGG - Intergenic
964761021 3:160135061-160135083 ATTTATTTTTTTAGAGATGGAGG - Intergenic
964843584 3:161022445-161022467 ATGTATTTTTTTACAGAAGCAGG - Intronic
965346699 3:167559474-167559496 ATATATTTCTTCTGGGAGGAAGG - Intronic
965491063 3:169337245-169337267 ATAAATTTTTTTAGGCAAGAAGG + Intronic
965762711 3:172096545-172096567 ACATTTTACTTCAGAGAAGATGG - Intronic
965950114 3:174298585-174298607 AAATTTTTTTTTGGAGAAGAAGG - Intergenic
966062631 3:175778115-175778137 TTATATTGCTTTAGATAGGAAGG - Intronic
966214929 3:177492327-177492349 ATTTATTTATTTATTGAAGATGG + Intergenic
966280926 3:178227566-178227588 ATATCTTTCTTTAGAGCAAAGGG - Intergenic
966379921 3:179334572-179334594 ATATATTTATATACAGAAAATGG - Exonic
966528474 3:180945847-180945869 ATGTATTTCTAAGGAGAAGAGGG - Intronic
966604275 3:181806704-181806726 ATAAATTTGTTTAGAGCTGACGG - Intergenic
967327113 3:188252156-188252178 ATATATATGTTTGGGGAAGAAGG - Intronic
967472347 3:189876929-189876951 GTATTTTTCTTTATAGTAGAGGG + Intronic
967573636 3:191063429-191063451 TTATAATCCTGTAGAGAAGATGG + Intergenic
969378226 4:6777259-6777281 AAAAATTCTTTTAGAGAAGACGG - Intergenic
970663336 4:18310361-18310383 ATTTCTTGCTTTAGAGAACAAGG + Intergenic
970712871 4:18884747-18884769 ATATATTTTTTAATAGAGGAAGG + Intergenic
970790042 4:19846557-19846579 ATACATTTCTTTAAACAAAATGG - Intergenic
970971579 4:21990364-21990386 ATTTATTTATTTAGAGAAGGGGG - Intergenic
971031286 4:22640050-22640072 TTGTATTTCTTTAGTAAAGACGG - Intergenic
971083152 4:23239110-23239132 ACAGATTTCTTGAGAGAAGTTGG - Intergenic
971459925 4:26884069-26884091 TTATATTTCTCTGGAAAAGAAGG + Intronic
971528089 4:27647708-27647730 ATATATTTCTATAGATCAGTAGG - Intergenic
971598440 4:28562025-28562047 ATTTTTTTCTTTAGAGAATGTGG + Intergenic
971779463 4:31013183-31013205 CTCTTTTTCTTTAGAGAACAGGG - Intronic
971796540 4:31235892-31235914 ATATATTTCTATAGCAAAAAAGG - Intergenic
971839990 4:31838566-31838588 CTATATTTCTTTAGGGAACTAGG - Intergenic
972875947 4:43360214-43360236 ATATATTTCTTGAGTTCAGAAGG + Intergenic
973095058 4:46186543-46186565 ATATATATCTCTAGAGAGGAGGG + Intergenic
973598732 4:52519921-52519943 ATTTACTTTTTTAGAAAAGATGG + Intergenic
973618012 4:52699222-52699244 ATATATTATTCTATAGAAGAGGG - Intergenic
973857197 4:55024648-55024670 ATATATTTTTTTAGTAGAGATGG - Intergenic
973857517 4:55028250-55028272 ATATAATCCTTTTGGGAAGATGG + Intergenic
974338978 4:60589202-60589224 AAATATTTCTTAAGTGAACATGG + Intergenic
975070344 4:70128919-70128941 ATATATTTCTTTTAGGAAGTAGG - Intergenic
975147060 4:70980118-70980140 ACAAATTTCTTAAGAGAACAGGG - Intronic
975261432 4:72304388-72304410 ATATATTTCCTTAGAAAACTGGG + Intronic
975460667 4:74649957-74649979 AAATTTTTCATTTGAGAAGAAGG - Intergenic
975600044 4:76089629-76089651 AGATATTTCTTTATAGCAGTGGG + Intronic
975855254 4:78617700-78617722 ACATGTTTCTAGAGAGAAGACGG + Intergenic
975924262 4:79430061-79430083 AAATATTACTTTAGAGCAGCAGG - Intergenic
976017025 4:80568763-80568785 ATAGACGTTTTTAGAGAAGAGGG + Intronic
976089401 4:81440195-81440217 TCATATTTCTTTACAGAGGAAGG - Intronic
976156523 4:82150752-82150774 AAATATTTCTTTAGTGTCGATGG - Intergenic
976243891 4:82988169-82988191 AAATGTTTCTTTTGAGAAGTGGG + Intronic
976244658 4:82995118-82995140 TTATTTTTTTGTAGAGAAGAAGG - Intronic
976825509 4:89256236-89256258 ATATATCTCCCTAGAGGAGAGGG + Intronic
976958734 4:90939791-90939813 ATATATTTATTTACACAAAATGG + Intronic
977168601 4:93731559-93731581 GTACATTGTTTTAGAGAAGATGG + Intronic
977559067 4:98514371-98514393 ATAAATGTCTTTATAGAGGAGGG + Intronic
977588109 4:98797685-98797707 TTTTATTTCGTTAGAGATGAAGG + Intergenic
977679350 4:99781855-99781877 ATATATGTATTTATAGAAAATGG - Intergenic
977690996 4:99910730-99910752 ATATAATTATTTAGATAATAAGG - Intronic
977719752 4:100225115-100225137 ATATATTTTTTTAAAAAAGTGGG + Intergenic
977776274 4:100923176-100923198 ATACATTTCTTTGGATAACATGG - Intergenic
977871886 4:102100874-102100896 TAATATTTCTTAAAAGAAGAGGG + Intergenic
977968205 4:103180451-103180473 ATAGGTTTCTTTAGAGACGCGGG - Exonic
978847418 4:113290541-113290563 ATATATTTAATTTGTGAAGAGGG + Intronic
979310450 4:119197326-119197348 ATATATTTCTTTAAACAAGATGG - Intronic
979403986 4:120286294-120286316 ATATAGTTATTTAAAGAATATGG + Intergenic
979981283 4:127258478-127258500 TTTTTTTTCTTTAGAGATGACGG + Intergenic
980595028 4:134943397-134943419 TTATATTTTTTTTGAGAAGTTGG - Intergenic
980643430 4:135610054-135610076 ATATATATCTGGAGAGAAGCCGG - Intergenic
980684010 4:136201935-136201957 AGATATTTGTTTAGAGAGGTAGG - Intergenic
980780713 4:137488072-137488094 ATATAATTATTTGGAGAACATGG - Intergenic
980858437 4:138469278-138469300 TTGTATTTCTTTAGTCAAGACGG - Intergenic
980920312 4:139079100-139079122 ATTTTTTTTTTTAGAGACGAGGG + Intronic
981057434 4:140378554-140378576 ATTTATTTATTTAGAAATGAGGG - Intronic
981754460 4:148126446-148126468 AATTATTTCTATATAGAAGATGG + Intronic
981949107 4:150384390-150384412 TTAAATCTCTTTAGAAAAGAAGG - Intronic
982220273 4:153118638-153118660 TTGTATTTTTTTAGAGAAGAGGG + Intergenic
982470512 4:155784112-155784134 AAATATTTCCTTGGAGAGGATGG + Intronic
983028701 4:162771220-162771242 ATCAATTTCCTTAGAGAATATGG + Intergenic
983176093 4:164589277-164589299 ATATTTTTGTTTAAAAAAGATGG - Intergenic
983382843 4:167019771-167019793 TTATAATTCTTTAGAAAAGAAGG - Intronic
983816822 4:172139776-172139798 ATATATTTGTGTAAAGAACAGGG - Intronic
984025418 4:174537981-174538003 AAATATTTTTATAGAGATGAAGG + Intergenic
984067800 4:175070727-175070749 TTTTTTTTCTTTAGAGGAGAAGG - Intergenic
984118699 4:175714768-175714790 ATATATTTCTTAAAAAAAAACGG - Intronic
984152216 4:176147865-176147887 ATACTTTTCTTTATAGTAGATGG - Intronic
984198218 4:176685556-176685578 ATATAATTCTGTAGAAAAGTAGG + Intronic
984350703 4:178588283-178588305 TTTTTTTTCTTTAGAGAAGGAGG - Intergenic
984421600 4:179529555-179529577 ACATTTTTCTTTACAGAGGAAGG - Intergenic
984468418 4:180131063-180131085 CTATATTTGTTTAAATAAGAAGG + Intergenic
984594479 4:181652226-181652248 TGATATTTCTTCAAAGAAGAGGG + Intergenic
984636658 4:182118451-182118473 ATTTATTTTTTTAGAGATGGGGG + Intergenic
984668254 4:182451155-182451177 AAATATTTTTTTATAAAAGAGGG - Intronic
985126775 4:186702171-186702193 ACATTTTTCTTAAGAGAAAATGG - Intronic
985349749 4:189046667-189046689 ATACTTTTCATTACAGAAGATGG + Intergenic
985726922 5:1521417-1521439 ATTTCTTTCTTTGGGGAAGAAGG + Intronic
985922446 5:2988644-2988666 ACATATTTCTACAGACAAGAAGG - Intergenic
985969861 5:3366322-3366344 ATAAATTTGTTTTGAGAACATGG + Intergenic
986482000 5:8198854-8198876 CTGTATTTCTACAGAGAAGATGG + Intergenic
986766795 5:10935479-10935501 AGATAGGTCCTTAGAGAAGATGG + Intergenic
986811441 5:11363867-11363889 ATATATATCATTAGGAAAGAAGG + Intronic
986865977 5:11987702-11987724 ATACACTTCTTTCCAGAAGAAGG + Intergenic
987449455 5:18063738-18063760 TAATTTTTCTTTAAAGAAGAAGG + Intergenic
987687509 5:21224622-21224644 GAATATTTCTAAAGAGAAGATGG - Intergenic
987736597 5:21853095-21853117 ATATATTTTTGTAGAAAAGGTGG - Intronic
987749561 5:22021843-22021865 ATTTATTTATTTAGAGACTAAGG + Intronic
987950470 5:24668680-24668702 ATATTTTTTTTTAGCGATGAGGG + Intergenic
988100158 5:26665996-26666018 AAATATTTCTTTTGAAAACAAGG - Intergenic
988228715 5:28447747-28447769 AGATATTTCTTCTGAGATGAAGG + Intergenic
988593979 5:32574308-32574330 TTATATTTTTTTAGTGGAGATGG + Intronic
988711903 5:33787493-33787515 ACATGTTTCTTGAGAGAAGAAGG + Intronic
988838242 5:35055577-35055599 ATAGATTTTTTTAAAGAAGGAGG - Intronic
989160767 5:38388571-38388593 ATATATTTTTTTAGTAGAGATGG - Intronic
990047095 5:51446234-51446256 TTATCTTCCTTTAGAGAATAGGG + Intergenic
990206188 5:53432109-53432131 ATGTATTTCTTAAGGGAAAATGG - Intergenic
990561860 5:56991500-56991522 ATACATTTCTTTTCATAAGATGG - Intergenic
990705436 5:58523736-58523758 TTTTATTTTTTTAGAGATGAGGG + Intergenic
990964660 5:61432189-61432211 ATTTAATGTTTTAGAGAAGAGGG - Intronic
992437052 5:76764645-76764667 ATTTTTTTTTTTAGAGATGAGGG + Intergenic
992471783 5:77064363-77064385 AGACATTTCTTTATAGTAGATGG - Exonic
993348333 5:86814082-86814104 ATATTTTTTTTTTGAGAAAAAGG - Intergenic
993452138 5:88085219-88085241 ATAGATTGCATTAGAGAATAGGG - Intergenic
993925734 5:93863439-93863461 TTATATATATTTAGAGAGGAGGG + Intronic
994551152 5:101236844-101236866 ATATATTTCTTTGGACAGTATGG + Intergenic
994569406 5:101495558-101495580 ATATATTTCTATTGAGATTATGG + Intergenic
995067154 5:107875406-107875428 AAATATTTCTGTGGAGAAAATGG - Intronic
995486978 5:112649054-112649076 ATATATTTTTACAGAGGAGATGG - Intergenic
995516275 5:112957156-112957178 ATATGTTTGTTTAGAGAGTAGGG + Intergenic
995781255 5:115777771-115777793 ATATATTTATTGAGTAAAGAAGG - Intergenic
995940531 5:117576993-117577015 TTATATTTCTTTAGTATAGAGGG + Intergenic
996861996 5:128078186-128078208 ATATTTTTAATTAAAGAAGAAGG + Intergenic
997142082 5:131392597-131392619 ATATATTTATTTTGAGAGCAAGG + Exonic
997258380 5:132446341-132446363 ATATTTTTCCTTGGAGAAGGGGG - Intronic
997981656 5:138471215-138471237 CTCTATTTCTTTAAAGCAGAGGG + Intergenic
998047681 5:139002520-139002542 AAATGTTTATTTAGAGAAAATGG - Intronic
998455510 5:142269646-142269668 TTAGGTTTCTTTTGAGAAGAGGG - Intergenic
998844040 5:146287878-146287900 AAAAATTTCATTAGAGATGATGG - Exonic
998940478 5:147276843-147276865 ATTTTTTTCTTTTGAGAAAATGG + Intronic
999348788 5:150847292-150847314 ATATATTTCTCTGCTGAAGATGG - Intronic
999477079 5:151910306-151910328 ATATATTACTTTTGAAAAGCTGG - Intronic
999753995 5:154651039-154651061 ATAGATATTTTTAGAGAAAAGGG + Intergenic
1000678249 5:164150466-164150488 ATATATGTGTTTAAATAAGAAGG + Intergenic
1000681865 5:164194982-164195004 ATATGTTTCTTTGCATAAGATGG + Intergenic
1000796206 5:165668125-165668147 ATATATTTCAAAAGAGCAGATGG + Intergenic
1000905119 5:166956965-166956987 ATTTATTTCTGAAGAGGAGAGGG + Intergenic
1001068751 5:168564608-168564630 ATATATTTTTGTAGAGATGGGGG + Intronic
1001720059 5:173849642-173849664 ATTTATTTATTTAGAGATGGTGG + Intergenic
1003372225 6:5539402-5539424 ATATATTTTTTTAGTAGAGACGG + Intronic
1003582768 6:7357234-7357256 ATATATGTTGTTAGAGAAGTGGG - Intronic
1003942944 6:11045715-11045737 ATATATTTGTTTATAAAAGGCGG + Intergenic
1004063391 6:12220042-12220064 ATTTATTTATTTAGAGATGGGGG + Intergenic
1004161496 6:13218137-13218159 ATGTTTTTCTTTAGAAATGATGG + Intronic
1004304983 6:14492427-14492449 ATAAAATTAGTTAGAGAAGAAGG + Intergenic
1004790243 6:19017704-19017726 AAATACTTCTTAAGAGAACAGGG + Intergenic
1004912836 6:20303105-20303127 ATATACTTCCTGGGAGAAGACGG + Intergenic
1005118817 6:22368230-22368252 ATTAATTTATTTACAGAAGAAGG - Intergenic
1005780525 6:29186973-29186995 ATATATTTTGTAAGAGAAGAAGG - Intergenic
1006084703 6:31587626-31587648 ACATATATCTTCAGGGAAGAGGG - Exonic
1006220106 6:32482493-32482515 ATAGATTTTTTTCAAGAAGAAGG - Intergenic
1006324435 6:33342775-33342797 ATATTTTTTTTTAGTAAAGATGG + Intergenic
1006559783 6:34900922-34900944 ATATATTAGTTTAGAGAATGTGG + Intronic
1006667228 6:35704201-35704223 TTATACTTCTATAGAGAAGTGGG + Intronic
1007171819 6:39869412-39869434 TTATATTTTTTTAGTGGAGACGG - Intronic
1007428516 6:41762647-41762669 ATATATTTTTTTAGAGATGGGGG + Intergenic
1007580179 6:42953748-42953770 ATATATTTTTTTAGTAGAGATGG + Intergenic
1007612216 6:43157708-43157730 ATATATTTCTTTGGTAGAGACGG - Intronic
1007634565 6:43290818-43290840 ATTAATTTTTTTAGAGAAAAAGG - Intergenic
1007794284 6:44335051-44335073 AGATATTTCTTAAAAGTAGAAGG + Intronic
1007794356 6:44335576-44335598 AGATATTTCTTAAAAGTAGAAGG - Intronic
1008011528 6:46472785-46472807 ATATAAGTCTTGAAAGAAGAAGG + Intronic
1008379437 6:50825135-50825157 ATTTATTTTTTTAAAAAAGACGG + Intronic
1008608101 6:53159931-53159953 AAATATTACATTAGAGAAAATGG - Intergenic
1008821111 6:55631382-55631404 AAATAATTCCTTATAGAAGATGG - Intergenic
1008860187 6:56139670-56139692 ATATATATTTTGAGAGAACAGGG - Intronic
1009293464 6:61913473-61913495 ATATATTTCTTCACTGAGGAAGG - Intronic
1009342953 6:62580431-62580453 ATATATGTATTTAAAAAAGAAGG + Intergenic
1009477399 6:64110681-64110703 AGAGATTTCTTTAGAGAATATGG + Intronic
1010702060 6:79062518-79062540 AAATTTTACTTTAAAGAAGATGG + Intronic
1010773646 6:79861168-79861190 ATGTGTTGCTTTAGATAAGAAGG - Intergenic
1011139654 6:84139161-84139183 ACATTTTCCTTTAGTGAAGAGGG + Intronic
1011345256 6:86362307-86362329 ATTTATTTATTTATATAAGATGG - Intergenic
1011395778 6:86905353-86905375 ATATACTTCTGGAGAGGAGAAGG + Intergenic
1012152442 6:95771305-95771327 ATATATAACTTTGGAGAAAAAGG - Intergenic
1012333299 6:98021091-98021113 ATATACTTCTTTTCATAAGAGGG - Intergenic
1012499394 6:99871964-99871986 AGATTTTTCTCTGGAGAAGATGG - Intergenic
1012527239 6:100192700-100192722 ATATATTTCTTTAGAGAGATGGG - Intergenic
1012769299 6:103408601-103408623 ATATATTTTTGTAGATAAAAAGG + Intergenic
1013027895 6:106297109-106297131 ATATATTTCTAAAGACAAAAAGG + Intronic
1013219309 6:108063190-108063212 ATATATTTTTGTAGAGATGGGGG + Intronic
1013328902 6:109078052-109078074 ATTTATTATTATAGAGAAGAGGG - Intronic
1013395505 6:109734331-109734353 ATATATTTCTTAAGTGTTGAGGG - Intronic
1013753638 6:113436159-113436181 ATTTATTTATTTTGAGAAGGGGG - Intergenic
1013780599 6:113724533-113724555 ATATATTTCTTCAAAAATGAAGG + Intergenic
1014050230 6:116944096-116944118 AAATGTTTTGTTAGAGAAGATGG + Intergenic
1014524750 6:122489167-122489189 ATAGATTTTTTTAAAGAAGGGGG + Intronic
1014821048 6:125988592-125988614 AGTTATTTCTTGAGAGATGATGG + Intronic
1014885742 6:126779021-126779043 AAATATTTCATTAGGGAACAAGG + Intergenic
1015012270 6:128364301-128364323 ATATATTTCTTAAAAGCAAACGG + Intronic
1015808559 6:137138284-137138306 ATATATTGCTTTAGATAGTATGG - Intergenic
1016023329 6:139258494-139258516 ATCTTTTTCTTAAGAGAACATGG + Intronic
1016030556 6:139333099-139333121 ATATAGAACTTTAGAAAAGAAGG + Intergenic
1016053813 6:139557563-139557585 ATATAATCCTTTATAAAAGATGG - Intergenic
1016269702 6:142274357-142274379 ATATATTTCTCTAAAAAACATGG + Intergenic
1016369597 6:143358733-143358755 ATATATTTCATATGACAAGAAGG + Intergenic
1016370558 6:143369735-143369757 AAATATTTTTTTAGAGATGGGGG - Intergenic
1016805278 6:148206022-148206044 ATATATATTTTTACAGAGGAAGG - Intergenic
1017693094 6:156987004-156987026 TTATATTTTTGTAGAGATGAGGG - Intronic
1017714933 6:157202840-157202862 ATATATTTCTATATATAAAATGG - Intronic
1018312051 6:162520075-162520097 ATATATTTTTGTAGAGATGAGGG - Intronic
1019361973 7:609310-609332 AAATATTTTTTTAAAAAAGAGGG - Intronic
1019767385 7:2861740-2861762 AAATTTTTCTTTAGTGGAGATGG - Intergenic
1020427659 7:8087567-8087589 AAATATGTCTTTAGATAAAATGG - Exonic
1020505601 7:8983360-8983382 ATATATTCCCTTTGTGAAGATGG + Intergenic
1021209179 7:17824068-17824090 ATATATTGGTTTTGTGAAGATGG + Intronic
1021588137 7:22232081-22232103 CTATATTTTTTTAGACAAAATGG + Intronic
1021847188 7:24774535-24774557 ATATATTTATTTATTTAAGATGG + Intergenic
1022383280 7:29880722-29880744 ATTTATCTCTTTAGAGATGGAGG + Intronic
1022836636 7:34122957-34122979 TAATATTTCTTTATAGAATATGG + Intronic
1023001368 7:35811207-35811229 ATATATTTTTTTAAAAAATAAGG + Intronic
1023006543 7:35876191-35876213 ATATCTTTCTTTCTAGAAGTTGG + Intronic
1023758072 7:43438782-43438804 ATGTATTTCTTTAGGTAACAGGG + Intronic
1024356575 7:48419379-48419401 ATAAATTTTTTAAGAAAAGAGGG - Intronic
1024869765 7:53950327-53950349 CTATATCTGTTTAGAGAGGATGG - Intergenic
1025767259 7:64467211-64467233 ATATATTTTTTTAGTAGAGACGG + Intergenic
1026010602 7:66632869-66632891 ATATATTTTTTTAGTAGAGATGG - Intronic
1026113882 7:67480033-67480055 ACAAATTTCATTAAAGAAGAAGG + Intergenic
1026337773 7:69409631-69409653 ATATATTTTTTTAGTAGAGATGG + Intergenic
1026347781 7:69489856-69489878 ATTTATTTATTTAGAGAAGGAGG + Intergenic
1026418105 7:70203867-70203889 ATGTATTTGTAGAGAGAAGAAGG + Intronic
1026702953 7:72663584-72663606 ATATATATATTTAGTAAAGACGG - Intronic
1027752184 7:82163185-82163207 ATGTATTTCTTCAAAGAAGTTGG - Intronic
1028577143 7:92364599-92364621 ATATATTTCTTTAGAACTTAAGG + Intronic
1028867545 7:95731330-95731352 TTAAATTTTTTTAGAGATGAGGG + Intergenic
1029249587 7:99226253-99226275 TTTTATTTCTTTAGAGATGGAGG - Intergenic
1029294047 7:99525297-99525319 TTATATTTTTGTAGAGATGAGGG - Intronic
1029666997 7:102002119-102002141 ATATATTTTTATAGAGATGGGGG - Intronic
1031369894 7:120951671-120951693 ATATAGCTCTTTAGAGACCATGG + Intronic
1032480324 7:132240852-132240874 ATATATTTCTTAAGGGAATTTGG + Intronic
1032561811 7:132900255-132900277 TTATGTTTCTTTACAGAAGCTGG + Intronic
1033301209 7:140187570-140187592 ATATTTTTTTGTAGAGACGAGGG + Intergenic
1033399243 7:141006179-141006201 ATTTATTTCATTAGAGAATCAGG + Exonic
1034013629 7:147558220-147558242 ATATATTTCTTTTGACATTATGG + Intronic
1034073021 7:148206109-148206131 ATATATTTTTTTATAGAAATGGG + Intronic
1034083843 7:148305488-148305510 ATGTAGTTCTTTATAGCAGAAGG - Intronic
1034509862 7:151525339-151525361 ATATATTTTTTTAAAAAAGGTGG - Intergenic
1035855252 8:2967760-2967782 ATATTTTTCTTAAAAGAACATGG + Intronic
1036618875 8:10409763-10409785 AGATATTTCTTCATAGAAGCTGG + Intronic
1036794719 8:11747119-11747141 AGATTTTTCTCTAGTGAAGAGGG - Intronic
1036970381 8:13348386-13348408 ATATTATTCTTTAGAGGATAGGG + Intronic
1037330472 8:17738966-17738988 ATATATTTTTGTAGAGATGGGGG - Intronic
1037544211 8:19902075-19902097 ATTTTTTTCTTTAGAAAACAAGG - Intronic
1038176005 8:25182936-25182958 ATAAATTATTTTAGGGAAGATGG + Intergenic
1038245588 8:25851901-25851923 ATATATTTTTATAGGGAAGGAGG - Intronic
1038264075 8:26023569-26023591 AAGTAATTCTTTAGAAAAGAGGG - Intronic
1038464934 8:27753131-27753153 ACAAATTTCTATAGAGAAAAAGG - Intronic
1038817170 8:30916025-30916047 ATATATTTTTTTAGTAGAGATGG + Intergenic
1039113493 8:34066026-34066048 ATATATTTCCTAAGAGAAACTGG - Intergenic
1039278292 8:35955661-35955683 ATCTAGTTGTTTAGAGAAGTAGG - Intergenic
1039606797 8:38887410-38887432 ATACAATTCTTTAGAGAAAGTGG + Intergenic
1039923921 8:41911978-41912000 ATATTTTTTTTAAGTGAAGAAGG - Intergenic
1039933470 8:42017437-42017459 ATATATTTGTTTATAAAGGAAGG + Intronic
1040350665 8:46563718-46563740 ATTTATTTATTTAGAGATGAAGG - Intergenic
1040360557 8:46660254-46660276 ATAGATATCTTAAGAGAAAAAGG + Intergenic
1040366325 8:46721009-46721031 ATTTATTTATTTAGAGATGAAGG + Intergenic
1040928590 8:52711520-52711542 ATATATTTATTTATAGGAAATGG - Intronic
1041347489 8:56915372-56915394 AAATATTTCAATAGAGAATAAGG + Intergenic
1041703621 8:60820137-60820159 ATACATGTTTATAGAGAAGATGG + Intronic
1042587251 8:70354608-70354630 TTAAATTTCTTCAGAGATGAAGG - Intronic
1042818340 8:72902854-72902876 ATATATTTCTTCACAGATGGAGG - Intronic
1042977866 8:74490837-74490859 ATTTAATACTTCAGAGAAGAAGG + Intergenic
1043160870 8:76845077-76845099 ATAGAATTTTTTAGACAAGAAGG + Intronic
1043327114 8:79066044-79066066 ATGTATTTGTTTAGACAATAAGG + Intergenic
1043460853 8:80458531-80458553 ATATATTTTTTTAGTAGAGACGG - Intergenic
1043939865 8:86185291-86185313 TTAAATTTTTTTAGAGATGAGGG - Intergenic
1043970050 8:86518752-86518774 ATATTTTTTTTTAAAAAAGAAGG - Intronic
1044681528 8:94783332-94783354 ATATATTATTTTAGATAAGGTGG - Intronic
1044754208 8:95444918-95444940 ATAACCTTCTTTAGAGAGGAAGG + Intergenic
1045551615 8:103177911-103177933 AGCTATTATTTTAGAGAAGAAGG + Intronic
1045583496 8:103502158-103502180 GTATATTTCTGTGGAGAATATGG - Intronic
1045846577 8:106644063-106644085 AGATATTTATTGAGAGAATAAGG + Intronic
1046365170 8:113219570-113219592 ATAGATTGTGTTAGAGAAGATGG + Intronic
1046619171 8:116509595-116509617 ACCTCTTTCTTTAGAAAAGAGGG + Intergenic
1047136469 8:122084515-122084537 ATATATTTCTCAAGAGAGTAAGG + Intergenic
1047276866 8:123412437-123412459 ATTTATTTTTTAAGAGATGAGGG + Intronic
1048195922 8:132331614-132331636 AGATATTTTTTGAGAGAACAAGG - Intronic
1048432483 8:134383133-134383155 GAATATTTTTTTAGACAAGAGGG + Intergenic
1048713274 8:137238029-137238051 ATATATTCCTTTAGAGCTCAGGG + Intergenic
1050131110 9:2413806-2413828 ATATATTTATGTAGAGAGGAGGG + Intergenic
1050468407 9:5958334-5958356 GCATATTTCTTTACATAAGAAGG + Intronic
1050693399 9:8253536-8253558 TCTTATTTCTTTAGAAAAGAAGG + Intergenic
1050704271 9:8379176-8379198 AAATATTTCCTGAGAGAAAATGG - Intronic
1050810440 9:9739808-9739830 ATATATATATGTAGAGAAAAAGG - Intronic
1051436159 9:17034810-17034832 ATATGGTTTTTTAGAAAAGACGG + Intergenic
1052206385 9:25846297-25846319 AATTATTTCCTTAGAGAAAATGG - Intergenic
1053509962 9:38679176-38679198 ATATATTTTTTTAGTAGAGACGG - Intergenic
1055096286 9:72417915-72417937 ATATCTTTTTTAAGAGTAGATGG + Intergenic
1055228820 9:74035174-74035196 TTTTATTTCTTTCCAGAAGAGGG + Intergenic
1055378145 9:75673402-75673424 ATTTATTTATTTAGAGACAAGGG + Intergenic
1055594942 9:77856383-77856405 ATATATTTCTATAGGAAGGAAGG + Intronic
1056766622 9:89448146-89448168 CTATATTTTTATAGAGATGAGGG + Intronic
1057591407 9:96376432-96376454 ATATATTTTTTTAGTAGAGACGG - Intronic
1057634451 9:96750704-96750726 ATTTATTTATTTAGAGATGGAGG + Intergenic
1058137007 9:101318158-101318180 ATTTATTTATTTAGTAAAGATGG - Intronic
1058185328 9:101848135-101848157 ATATATTTCCTTAAGGAATATGG - Intergenic
1058639619 9:107070166-107070188 ATATATTATTTTAGGGGAGACGG - Intergenic
1059532129 9:115044912-115044934 ATATCTATCTTTAGACAAAAAGG + Intronic
1059813640 9:117886172-117886194 ATAAATTTCTTTAGAATATACGG - Intergenic
1060987394 9:127827658-127827680 TTATAATTTTTTAGAGACGAGGG + Intronic
1061153701 9:128844371-128844393 TTTTATATCTTTAGAGAAAATGG - Intronic
1062158917 9:135069184-135069206 AGACATTTCTTTGGTGAAGATGG + Intergenic
1185826335 X:3254907-3254929 AGATATTTCTTTATAGCAGTGGG - Intergenic
1186129869 X:6454932-6454954 AGAAATTTTTTTAGAGACGAGGG - Intergenic
1186633091 X:11371986-11372008 ATATATTTAAATGGAGAAGAGGG + Intronic
1186879155 X:13847527-13847549 ATCCATTTCTTTATAGAAAATGG + Intronic
1186900904 X:14054608-14054630 ATATATTTTTTTCCAGGAGATGG + Intergenic
1188133150 X:26462705-26462727 ATATTTTTATATAGAGAAAATGG + Intergenic
1188456578 X:30373185-30373207 CTACAGTTCTATAGAGAAGAGGG + Intergenic
1188603016 X:31992707-31992729 ATATACTTTTGTAGAGCAGAGGG + Intronic
1188758536 X:33995727-33995749 GTAAATTTCTTTGGAGAATATGG + Intergenic
1188930342 X:36101621-36101643 ATACATTTCTTTAGTTAAGGGGG + Intronic
1188976705 X:36684124-36684146 ATAAACTGCTATAGAGAAGATGG - Intergenic
1189055541 X:37695900-37695922 TTATAATTCCTTAGAGAACACGG - Intronic
1189113373 X:38317459-38317481 TTATTTTTCTTTATAGAGGATGG - Exonic
1189430954 X:40946827-40946849 ATATATTTTTTTTGTGGAGATGG - Intergenic
1189741333 X:44119905-44119927 ATTTATTTTTTTAGAAATGAGGG - Intergenic
1190273331 X:48884131-48884153 ATTTCTTTGTTTAGAGATGAGGG - Intergenic
1192058364 X:67797012-67797034 ATATATTTTTTTAAAGATGTTGG + Intergenic
1192690615 X:73359111-73359133 ATATATTCAATTAGTGAAGAAGG - Intergenic
1193250380 X:79283691-79283713 AAATATTTGTTTAGAAATGATGG - Intergenic
1193255356 X:79342434-79342456 ATATATTTCATCAGAAAAGTGGG - Intergenic
1193435149 X:81465750-81465772 ATATATTTTTTTCAAGTAGAAGG - Intergenic
1194567495 X:95510060-95510082 AGATATTGCTTTAAATAAGATGG + Intergenic
1194709388 X:97216628-97216650 ATATTTTTGTTAAGAGAAGAAGG + Intronic
1194955429 X:100173741-100173763 TTCTCTTTCTTTGGAGAAGATGG - Intergenic
1195118253 X:101721949-101721971 ATTTATTTTTTTAGAGTAAATGG + Intergenic
1195488588 X:105439630-105439652 AAATATTTTATAAGAGAAGATGG - Intronic
1195926555 X:110031493-110031515 ATATATTTTTTAAGAGATGGGGG + Intronic
1196084224 X:111667161-111667183 ATATATTTCTTTAGAAGAAATGG + Intronic
1196323069 X:114366943-114366965 ATATTTTTATATAAAGAAGAGGG + Intergenic
1196583351 X:117400850-117400872 AAATTGTTCTTTAGAGATGAAGG - Intergenic
1196997406 X:121399501-121399523 ATATATTTTTTTTGTGGAGACGG + Intergenic
1197014889 X:121612379-121612401 ATATTTTTCTTTATATTAGAAGG + Intergenic
1197798623 X:130325253-130325275 ATTTATTTTTTTAGAGATAAGGG + Intergenic
1197815923 X:130498491-130498513 ATATATTTCTTTTGTAAAGATGG + Intergenic
1198167663 X:134073011-134073033 ATATATTTATTTAAAGGAAAAGG - Intergenic
1198384080 X:136111704-136111726 AGATAATTCTTTGGAGAAGTTGG + Intergenic
1198546225 X:137695487-137695509 AAACATTTTTTTAGAGATGAGGG + Intergenic
1199570288 X:149260703-149260725 ATATATATATTTAGTAAAGATGG - Intergenic
1200330273 X:155288822-155288844 ATATATTACCTTAGATAATAAGG + Intronic
1200804680 Y:7421128-7421150 ATAAATTTTTTTGGAGAGGATGG + Intergenic
1200925230 Y:8648364-8648386 GTCTATTTGTTTAGAGAAGTAGG - Intergenic
1201433875 Y:13935176-13935198 ATATATTTCTTTAAAAATCAAGG - Intergenic
1202097664 Y:21268495-21268517 ATATATTTTTTTTTTGAAGAAGG - Intergenic