ID: 1084344945

View in Genome Browser
Species Human (GRCh38)
Location 11:68540575-68540597
Sequence CCGTCTGACCAAAATTTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 894
Summary {0: 1, 1: 16, 2: 385, 3: 306, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084344939_1084344945 26 Left 1084344939 11:68540526-68540548 CCATTGTCATTGATAACATCTTA 0: 280
1: 132
2: 40
3: 28
4: 237
Right 1084344945 11:68540575-68540597 CCGTCTGACCAAAATTTGTTAGG 0: 1
1: 16
2: 385
3: 306
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084344945 Original CRISPR CCGTCTGACCAAAATTTGTT AGG Intronic
900016574 1:154673-154695 CCATCTGACCAACATTTATTAGG - Intergenic
900046834 1:513265-513287 CCATCTGACCAACATTTATTAGG - Intergenic
900069039 1:754983-755005 CCATCTGACCAACATTTATTAGG - Intergenic
900939584 1:5789825-5789847 TGGTCTGACCAAAATTTATTAGG - Intergenic
901709844 1:11105258-11105280 CAGTCTGACCAAAATTTATTAGG - Intergenic
902964576 1:19990301-19990323 CGGTCTGACCAAAACTTACTAGG - Intergenic
906226886 1:44129827-44129849 CCTTCTGACGAAACATTGTTGGG + Exonic
906352669 1:45077632-45077654 TGGTCTGACCAAAATTTATTAGG + Intronic
906410761 1:45577058-45577080 CGATCTGACCAAAATTTATTAGG - Intergenic
906448930 1:45927313-45927335 CGGTCTGACCACAATTTATTAGG + Intronic
906623790 1:47307966-47307988 CGGTCTGACTACAATTTATTAGG - Intronic
907622551 1:55996196-55996218 CAGTCTGACCAAAATTTATTAGG + Intergenic
908045286 1:60161922-60161944 TGGTCTGACCAAAATTTATTAGG + Intergenic
909254927 1:73407970-73407992 CGATCTGACCAAAATTTATTAGG - Intergenic
909464813 1:75961284-75961306 CAGTCTGACCAAAATTTATTAGG - Intergenic
909556550 1:76960526-76960548 TGGTCTGACCAAAATTTATTAGG + Intronic
909577265 1:77188430-77188452 CGGTCTGACCAAAATTTATTAGG - Intronic
909812888 1:79953593-79953615 CGGTCTGACCAAAATTTATTAGG + Intergenic
910605603 1:89080326-89080348 TGGTCTGACCAAAATTTATTAGG - Intergenic
911083044 1:93952085-93952107 TGGTCTGACTAAAATTTATTAGG + Intergenic
911153646 1:94618960-94618982 TGTTCTGACCAAAATTTATTAGG + Intergenic
911893688 1:103403222-103403244 CAGTCTGACCAAAATTTATTAGG - Intergenic
911896091 1:103436790-103436812 CGGTCTGACTAAAATTTATTAGG + Intergenic
911940788 1:104044927-104044949 CAGTCTGACCAAAATTTATTAGG + Intergenic
912010085 1:104948317-104948339 TGGTCTGACCAAAATTTATTAGG - Intergenic
912807172 1:112766289-112766311 CAGTCTGACCAAAATTTATTAGG - Intergenic
912854889 1:113158889-113158911 GGGTCTGACCAAAATTTATTAGG - Intergenic
913024595 1:114824385-114824407 TAGTCTGACCAAAATTTATTAGG - Intergenic
915055361 1:153123856-153123878 CAGTCTGACCAAAATTTATTAGG + Intergenic
915167658 1:153957665-153957687 CCGTCCGACCATAAGTTGTGTGG - Intronic
915448412 1:155988251-155988273 CGGTCTGACCAAAATTTATTAGG - Intronic
915676541 1:157537404-157537426 CAGTCTGACCAAAATTTATTAGG - Intronic
915749494 1:158192904-158192926 CGGTCTGACCAAAATTTATTAGG - Intergenic
915886149 1:159723276-159723298 CGGTCTGACCAAAATTTATTAGG + Intergenic
915999432 1:160600606-160600628 CAGTCTGACCAAAATGTATTAGG - Intergenic
916008943 1:160686952-160686974 CAGTCTGACCAAAATTTATTAGG + Intronic
916055156 1:161063910-161063932 CGGTCTGACCAAAATTTATTAGG - Intronic
916290324 1:163158820-163158842 TGGTCCGACCAAAATTTATTAGG + Intronic
916318916 1:163480817-163480839 AAGTCTGACCAAAATTTATTAGG - Intergenic
916360021 1:163957988-163958010 CGGGCTGACCAAAATTTATTAGG - Intergenic
916626908 1:166567901-166567923 CAGTCTGACCAAAATTTATTAGG + Intergenic
917164620 1:172098123-172098145 CGGTCTGACCAAAATTTATTAGG + Intronic
917373435 1:174321175-174321197 CAGTCTGACTAAAATTTACTAGG - Intronic
917821156 1:178765617-178765639 CGGTCTGACCAAAATTTATTAGG + Intronic
918281518 1:183010802-183010824 CGGTCTGACCAAAACTTATTAGG + Intergenic
918532472 1:185538596-185538618 CAGTCTGACCAAAGTTTATTAGG - Intergenic
918744451 1:188182332-188182354 CGGTGTGACCAAAATTTATTAGG - Intergenic
919189984 1:194203908-194203930 TGGTCTGACCAAAATTTATTAGG + Intergenic
919296102 1:195702588-195702610 CGGTCTGACCAAAATTTATTAGG + Intergenic
919318555 1:196004670-196004692 TGGTCTGACCAAAATTTATTAGG + Intergenic
919383365 1:196886687-196886709 CCGTCTGACTAAAATTTACTGGG + Intronic
920125457 1:203690803-203690825 CCATCTGCCCAAAATTTGGTAGG - Intronic
920599049 1:207303853-207303875 CGGTCTGACCAAAATTTATTAGG + Intergenic
921037758 1:211398897-211398919 CGGTGTGACCAAAATTTATTAGG - Intergenic
921550119 1:216525602-216525624 CAGACTGACTGAAATTTGTTTGG + Intronic
921896979 1:220411900-220411922 TGGTCTGACCAAAATTTATTAGG + Intergenic
922104398 1:222500376-222500398 CCATCTGACCAAAATTTATTAGG - Intergenic
922264717 1:223972897-223972919 CCATCTGACCAAAATTTATTAGG - Intergenic
922361062 1:224821850-224821872 CAGTCTGACCAAAATTTATTAGG + Intergenic
922376234 1:224970275-224970297 CGGTCTCACCAAAATTTATTAGG - Intronic
922694621 1:227722923-227722945 TGGTCTGACCAAAATTTATTAGG - Intergenic
923129580 1:231063841-231063863 CCTTCTGCCCAAATTTTCTTTGG + Intergenic
923419588 1:233799250-233799272 TGGTCTGACCAAAATTTATTAGG + Intergenic
924120191 1:240789672-240789694 TGGTCTGACCAAAATTTATTAGG - Intronic
924346575 1:243077894-243077916 CCATCTGACCAAAATTTATTAGG - Intergenic
924358959 1:243215573-243215595 CAGTCTGACCAAAATTTATTAGG - Intronic
924490015 1:244527157-244527179 CAGTCTGATCAAAATTTATTAGG + Intronic
924731979 1:246720567-246720589 TGGTCTGACCAAAATTTATTAGG - Intergenic
924869626 1:248027247-248027269 CGGTCTGAACAAAATTTATTAGG - Intronic
1064372870 10:14769167-14769189 CCGACTGACAAAACTGTGTTTGG + Intronic
1064490473 10:15850607-15850629 CGGTCTGACTAAAATTTACTAGG - Intronic
1065125027 10:22565941-22565963 CGGTCTGACCAAAATTTATTAGG - Intronic
1065432517 10:25673901-25673923 CTGTCTGACCAAAATTTATTAGG - Intergenic
1065835274 10:29651737-29651759 CTGTCTGCCTAAGATTTGTTTGG + Intronic
1065936227 10:30522798-30522820 CGGTCTGACTAGAATTTGTCAGG - Intergenic
1066626567 10:37413008-37413030 CGGTCTGACCAAAATTTATGAGG + Intergenic
1066663987 10:37764311-37764333 CGGTCTGACCAAAATTTATTAGG - Intergenic
1066698470 10:38100329-38100351 CGGTCTGACCAAAATTTATTAGG + Intronic
1066729775 10:38426952-38426974 CCATCTGACCAAAATTTATTAGG + Intergenic
1067265430 10:44738272-44738294 CAGTCTAAGCAAAATTTGATCGG - Intergenic
1067303050 10:45032005-45032027 CGGTCTGACCAAAATTTATTAGG + Intergenic
1067403532 10:45999731-45999753 CGGTCTGACCAAAATTTATTAGG + Intronic
1067406248 10:46026032-46026054 CCGTTTGTCCAAAATGTCTTAGG - Intronic
1067543038 10:47170391-47170413 CAGTCTGACCAAAATTTATTAGG + Intergenic
1067920067 10:50446046-50446068 CGGTCTGACCAAAATTGATTAGG - Intronic
1067981788 10:51095328-51095350 CCGTTTGACCAAAACATTTTGGG - Intronic
1067995471 10:51268310-51268332 TGGTCTGACCACAATTTATTAGG + Intronic
1068247752 10:54394681-54394703 TGGTCTGACCAAAATTTATTAGG + Intronic
1069162206 10:65106316-65106338 CCGTCTGACCAAAATTTATTAGG + Intergenic
1069185262 10:65414494-65414516 CGGTCTGACTAAAATTTATTAGG + Intergenic
1069288132 10:66742306-66742328 TGGTCTGACCAAAATTTATTAGG - Intronic
1069650244 10:70042037-70042059 CGGTCTGACCAAAATTTATTAGG - Intergenic
1069737721 10:70668391-70668413 TGGTATGACCAAAATTTATTAGG - Intergenic
1070050328 10:72882599-72882621 TGGTCTGACCAAAATTTATTAGG - Intronic
1070314816 10:75299996-75300018 TGGTCTGACCAAAATTTATTAGG + Intergenic
1070582931 10:77736894-77736916 CTGTCTGACCAAAATTTATTAGG - Intergenic
1071049549 10:81429900-81429922 TGGTCTGACCAAAATTTATTAGG + Intergenic
1071183916 10:83019068-83019090 TGGTCTGATCAAAATTTATTAGG - Intergenic
1071380656 10:85056165-85056187 CAGTCTGACTAAAATTTACTAGG - Intergenic
1071588993 10:86853942-86853964 CAGTCTGACCAAAATTTATTAGG + Intronic
1071809675 10:89165764-89165786 CCGGCTGACTAAAATCTTTTTGG - Intergenic
1071945453 10:90638785-90638807 CGGTCTGACCAAAATTTATTAGG - Intergenic
1072387276 10:94943824-94943846 CAGTCTGACCAAAATTTATTAGG + Intronic
1072498328 10:95985945-95985967 CGGTCTGACCAAAATTTATTAGG - Intronic
1072884012 10:99257543-99257565 CGGTCTGACCAAAATTTATTAGG - Intergenic
1073678594 10:105677838-105677860 CGGTCTGACCAAAATTTATTAGG - Intergenic
1074211743 10:111341528-111341550 CAGTCTGACCAAAATTTACCAGG + Intergenic
1074494677 10:113969422-113969444 TGGTCTGACCAAAATTTATTAGG + Intergenic
1074646541 10:115459549-115459571 CAGTCTGACCAAAATTTATTAGG - Intronic
1074983820 10:118640409-118640431 CGGTCTGACCAAAATTTATTAGG + Intergenic
1075459036 10:122603637-122603659 TGGTCTGACCAAAATTTATTAGG + Intronic
1075459668 10:122607696-122607718 TGGTCTGACCAAAATTTATTAGG + Intronic
1075460300 10:122611755-122611777 TGGTCTGACCAAAATTTATTAGG + Intronic
1075460932 10:122615814-122615836 TGGTCTGACCAAAATTTATTAGG + Intronic
1075997610 10:126891293-126891315 CGGTCTGACCAAAATTTATTAGG - Intergenic
1076973164 11:149742-149764 CCATCTGACCAACATTTATTAGG - Intergenic
1077588322 11:3471702-3471724 CGGTCTGACCAAAGTTTATTAGG + Intergenic
1078777517 11:14407389-14407411 TGGTCTGACCAAAATTTATTAGG - Intergenic
1079272654 11:19003259-19003281 CGGTCTGACCAAAATTTATTAGG + Intergenic
1079586013 11:22127661-22127683 CGGTCTGACCAAAATTTATTAGG - Intergenic
1080203665 11:29704999-29705021 TGGTCTGACCAAAATTTGTTAGG - Intergenic
1080724511 11:34882124-34882146 CGGTTTGATCAAGATTTGTTTGG + Intronic
1081009918 11:37798161-37798183 CAATCTGACCAAAATTTATTAGG + Intergenic
1081254086 11:40871101-40871123 CGGTCTGACCAAAATTTATTAGG - Intronic
1081461235 11:43274604-43274626 CGGTCTGACCAAAATTTATTAGG + Intergenic
1081653816 11:44843549-44843571 CGGTCTGACCAAAATTTATTAGG + Intronic
1082299402 11:50488245-50488267 CTGTCTGACCAAAATTTACTAGG + Intergenic
1082300142 11:50494959-50494981 CGGTCTGACCAAGATTTACTAGG + Intergenic
1082309506 11:50629908-50629930 CGGTCTGACCAAAATTTAATAGG + Intergenic
1082570503 11:54732299-54732321 CCGTCTGACCAAAATTTACCAGG + Intergenic
1082572318 11:54758885-54758907 CAGTCTGACCAAAATTTATTAGG - Intergenic
1082573060 11:54765775-54765797 TGGTCTGACCAAAATTTATTAGG - Intergenic
1082662084 11:55924307-55924329 CAGTCTGACCATAATTTATTAGG + Intergenic
1082780287 11:57282167-57282189 CGGTCTGATCAAAATTTATTAGG + Intergenic
1082919204 11:58473911-58473933 CAGTCTGACCAAAATTTATTAGG - Intergenic
1084098006 11:66925235-66925257 TGGTCTGATCAAAATTTATTAGG + Intronic
1084244016 11:67843331-67843353 CGGTCTGACCAAAGTTTATTAGG + Intergenic
1084343441 11:68525588-68525610 CAGTCTGATCAAAGTTTGCTAGG + Intronic
1084344945 11:68540575-68540597 CCGTCTGACCAAAATTTGTTAGG + Intronic
1084828676 11:71751234-71751256 CGGTCTGACCAAAGTTTATTAGG - Intergenic
1085212952 11:74798450-74798472 CGGTCTGATCAAAATTTATTAGG - Intronic
1086261872 11:84949403-84949425 CAGTCTGACCAAAATTTATTAGG + Intronic
1087123642 11:94600652-94600674 CGGTCTGACCAAAATTTATTAGG + Intronic
1088008703 11:104973197-104973219 CAGTCTGACCAAAATTTATTAGG - Intergenic
1088380549 11:109187961-109187983 CGGTCTGACCAAAATTTATTAGG + Intergenic
1088458125 11:110053945-110053967 CTGTCTGACTAAAATTTACTAGG + Intergenic
1088494763 11:110421762-110421784 CAGTCTGATCAAAATTCATTAGG + Intergenic
1088967248 11:114736229-114736251 TGGTCTGACCAAAATTTATTAGG + Intergenic
1088975699 11:114814531-114814553 CCTGCTGCCCAAAATTAGTTAGG - Intergenic
1089858656 11:121569611-121569633 CAGTCTGACCAAAATTTATTAGG - Intronic
1090222882 11:125045946-125045968 CAGTCTGACCAAAATTTATTAGG - Intergenic
1090676215 11:128999319-128999341 CGGTCTGACTAAAATTTACTAGG - Intronic
1092414576 12:8280462-8280484 CGGTCTGACCAAAGTTTATTAGG + Intergenic
1092678186 12:10945689-10945711 CGGTTTGACCAAAATTTATTAGG + Intronic
1092900325 12:13053739-13053761 CGGTCTGACCAAAATTTACCAGG + Intronic
1092914869 12:13180533-13180555 CGGTCTGACCAAAATTTATTAGG + Intergenic
1093074724 12:14746039-14746061 CAGTCTGACCAAAATTTATTAGG + Intergenic
1093347942 12:18062973-18062995 CGGTCTGACCAAAATTTATTAGG + Intergenic
1094411750 12:30174314-30174336 CGGTCTGATCAAAATTTATTAGG - Intergenic
1094416582 12:30222614-30222636 CAGTCTGACCAAAATTTATTAGG - Intergenic
1094720282 12:33055987-33056009 CGGTCTGACCAAAATTTATTAGG - Intergenic
1094860545 12:34461484-34461506 TGGTCTTACCAAAATTTATTAGG + Intergenic
1094864976 12:34521760-34521782 CGGTCTGACCAAAATTTATTAGG - Intergenic
1094865967 12:34530335-34530357 TGGTCTGACCAAAATTTATTAGG - Intergenic
1095087159 12:38069461-38069483 CAGTCTGACCAAAATTTATTAGG - Intergenic
1095172736 12:39054942-39054964 CAGTCTGACCAAAATTTATTAGG - Intergenic
1096431167 12:51544329-51544351 AGGTCTGACCAAAATTTATTAGG - Intergenic
1098333766 12:69381087-69381109 CGGTCTGACCGAAATTTATTAGG + Intronic
1098459379 12:70715458-70715480 CGGTCTGACCAAAATTTATTAGG + Intronic
1098781152 12:74687999-74688021 CAGTCTGACCAAAATTTATTAGG + Intergenic
1098960568 12:76735815-76735837 CAGTCTGACCAAAATTTATTAGG - Intergenic
1099117764 12:78648884-78648906 TGGTCTGACCAAAATTTATTAGG - Intergenic
1099151486 12:79119613-79119635 CAGTCTTACAAAAATTTGTAAGG + Intronic
1099555202 12:84101749-84101771 AGGTCTGACCAAAATTTATTAGG - Intergenic
1099555997 12:84108742-84108764 CGGTCCGACCAAAATTTATTAGG + Intergenic
1099721312 12:86364990-86365012 TGGTCTGACCAAAATTTATTAGG + Intronic
1101500521 12:105299886-105299908 CAGTCTGACTAAAATTTACTAGG - Intronic
1101502129 12:105314030-105314052 CAGTCTGACTAAAATTTACTAGG - Intronic
1101660033 12:106757583-106757605 CTGTCTGACAAAGATTTTTTGGG + Intronic
1102308010 12:111821129-111821151 CCTTCTGACCAAAATTTATTAGG + Intergenic
1103218081 12:119218998-119219020 CGGTCTGACCAAAATTTATTAGG + Intronic
1103485614 12:121280787-121280809 CGGTCTGACCAAAATTTATCAGG - Intronic
1104693211 12:130842098-130842120 TGGTCTGACCAAAATTTATTAGG - Intergenic
1104877708 12:132047753-132047775 CAGTCTGACCAAAATTTATTAGG + Intronic
1105227652 13:18451396-18451418 CGGTCTGACCAAAATTTATTAGG + Intergenic
1105305228 13:19163916-19163938 CGGTCTGACTAAAATTTACTAGG + Intergenic
1105521556 13:21135705-21135727 CGGTCTGACCAAAATTTATTAGG + Intergenic
1105995896 13:25671657-25671679 CGGTCTGACCAAAATTTATTAGG - Intronic
1106341130 13:28827985-28828007 TAGTCTGACCAAAATTTATTAGG + Intronic
1106390932 13:29335313-29335335 CGGTCTGACCAAAATTTATTAGG - Intronic
1106746500 13:32714286-32714308 CGGTCTGACCAAAATTTATTAGG + Intronic
1106746519 13:32714438-32714460 CGGTCTGACCAAAATTTATTAGG + Intronic
1106961047 13:34998404-34998426 TGGTCTGACCAAAATTTTTTAGG + Intronic
1107520487 13:41175701-41175723 CGGTCTGACTAAAATTTACTAGG + Intergenic
1108294648 13:49001725-49001747 CGGTCTGACCAAAATTTATTAGG - Intronic
1109081141 13:57903059-57903081 CGGTCTGACCAAAATTTATTAGG + Intergenic
1109721987 13:66286919-66286941 CAGTCTGACTAAAATTTACTAGG + Intergenic
1109911881 13:68923252-68923274 CGGTCTGACTAAAATTTACTGGG + Intergenic
1110539405 13:76690880-76690902 CAGCCAGACCAAAAATTGTTGGG + Intergenic
1111429500 13:88133401-88133423 CAGTCTAACCAAAATTTATTAGG + Intergenic
1111509583 13:89243207-89243229 CGGTCTGACCAAAATTTATTAGG - Intergenic
1111684841 13:91489031-91489053 CGGTCTGACCAAAATTTATTAGG - Intronic
1111712118 13:91830022-91830044 CGGTCTGACCAAAATTTATTAGG + Intronic
1112449323 13:99494668-99494690 CAGTCTGACCAAAATTTATTAGG + Intergenic
1112746578 13:102533745-102533767 TGGTCTGACCAAAATTTATTAGG - Intergenic
1112821357 13:103340243-103340265 ACATTTGACAAAAATTTGTTGGG + Intergenic
1112960560 13:105120406-105120428 TGGTCTGACCAAAATTTATTAGG + Intergenic
1113290552 13:108901064-108901086 CGGTCTGACCAAAATTTATTAGG - Intronic
1114012089 14:18379858-18379880 CTGTCTGACCAAAATTTATTAGG + Intergenic
1114144272 14:19955293-19955315 TGGTCTGACCACAATTTATTAGG - Intergenic
1114157282 14:20118911-20118933 CGGTCTGACTAAAATTTACTAGG + Intergenic
1114215477 14:20654751-20654773 CGGTCTGACCAAAGTTTATTAGG + Intergenic
1114339728 14:21730516-21730538 CGGTCTGACCAAAATTTATTAGG + Intergenic
1114355546 14:21903979-21904001 CAGTCTGACCAAAATTTATTAGG - Intergenic
1114426877 14:22631229-22631251 CAGTCTGACCAAAATTTATTAGG + Intergenic
1114638463 14:24202624-24202646 CTGTCTGACCACAATTTATTAGG - Intronic
1114687133 14:24543827-24543849 CCGTCTGCCCAAAAGTTATTAGG - Intergenic
1114753061 14:25227583-25227605 CAGTCTGACCAAAATTTATTAGG + Intergenic
1114892421 14:26942253-26942275 CGGTCTGACCAAAATTTATTAGG + Intergenic
1115002100 14:28435280-28435302 TGGTCTGACCAAAATTTATTAGG - Intergenic
1115884709 14:37958462-37958484 CAGTCTGACCAAAATTTATTAGG - Intronic
1115958781 14:38811112-38811134 CGCTCTGACCAAAATTTATTAGG + Intergenic
1116181372 14:41540789-41540811 CGGTCTGACCAAAGTTTATTAGG + Intergenic
1116237460 14:42297390-42297412 CAGTCTGACCAAAATTTATGAGG + Intergenic
1116301779 14:43192410-43192432 TGGTCTGACCAAAGTTTATTAGG + Intergenic
1117230180 14:53708900-53708922 CCGTATGATCAAATGTTGTTTGG + Intergenic
1117382059 14:55174271-55174293 CAGTCTGACCAAAATTTATTAGG - Intronic
1117415854 14:55494816-55494838 CGGTCTGACCAAAATTTATTAGG - Intergenic
1117886329 14:60367899-60367921 CAGCCTGGCCAGAATTTGTTTGG - Intergenic
1118116345 14:62781422-62781444 CGGTCTGACCAAAATTTACTAGG + Intronic
1118372186 14:65146741-65146763 TGGTCTGACCAAAATTTGTTAGG + Intergenic
1118376166 14:65179036-65179058 CGGTCTGACTAAAATTTATTAGG + Intergenic
1118587194 14:67365685-67365707 CCATCTTACTATAATTTGTTAGG + Intronic
1119573262 14:75695294-75695316 CAGTCTGACTAAAATTTACTAGG - Intronic
1119959832 14:78842612-78842634 CAGTCTGACTAAAATTTATTAGG + Intronic
1120807297 14:88766511-88766533 CGGTCTGACCAAAATTTATTAGG - Intronic
1121099433 14:91240146-91240168 CAGTCTGATCAAAATTTATTAGG + Intronic
1123212885 14:106777712-106777734 CGGTCTGACCAAAATTTATTAGG - Intergenic
1123664281 15:22595829-22595851 TGGTCTGACCAAAATTTATTAGG - Intergenic
1123690359 15:22833553-22833575 CGGTCTGACCAAAATTTATTAGG + Intergenic
1123839172 15:24229265-24229287 CGGTCTGACCAAAATTTATTAGG + Intergenic
1123845554 15:24297553-24297575 TGGTCTGACCAAAATTTATTAGG + Intergenic
1123849047 15:24335076-24335098 CAGTCTGTCCAAAATTTATTAGG + Intergenic
1123864599 15:24505343-24505365 TGGTCTGACCAAAATTTATTGGG + Intergenic
1123868102 15:24542590-24542612 CAGTCTGTCCAAAATTTATTAGG + Intergenic
1123931574 15:25174257-25174279 CGGTCTGACCAAAATTTATTAGG + Intergenic
1124248191 15:28088895-28088917 CGGTCTGACCAAAATTTATTAGG + Intronic
1124318116 15:28690265-28690287 TGGTCTGACCAAAATTTATTAGG - Intergenic
1124565320 15:30807220-30807242 TGGTCTGACCAAAATTTATTAGG + Intergenic
1125407733 15:39370642-39370664 CGGTCTGACCAAAATTTATTAGG + Intergenic
1125567316 15:40686466-40686488 TGGTCTGACCAAAATTTATTAGG + Intergenic
1126276160 15:46883959-46883981 CAGTCTGACCAAAATTTATTAGG + Intergenic
1126556802 15:49997326-49997348 CCATCTGTCCAAAATATGTGTGG - Intronic
1126724038 15:51612777-51612799 CAGTCTGACCAATATTTATTAGG + Intronic
1127146028 15:56024911-56024933 TGGTCTGACCAAAATTTATTAGG - Intergenic
1127676352 15:61242956-61242978 CAGTCTGACCAAAATTTATTCGG + Intergenic
1127755097 15:62084461-62084483 CAGTCTGACCAAAATTTATTAGG + Intergenic
1128477199 15:68007346-68007368 CGGTCTGACCAAAATTTATTAGG - Intergenic
1128598791 15:68977513-68977535 CGGTCTGACCAAAATTTATTAGG + Intronic
1129218752 15:74118459-74118481 TAGTCTGACCAAAATTTATTAGG + Intronic
1129969160 15:79762141-79762163 TGGTCTGACCAAAATTTATTAGG + Intergenic
1130757288 15:86778358-86778380 CAGTCTGACCAAAATTTATTAGG + Intronic
1131382689 15:91976996-91977018 CAGTCTGACCAAAATTTATTAGG + Intronic
1131589701 15:93735256-93735278 CAGTCTGACCAAAATTTATTAGG - Intergenic
1131663969 15:94549865-94549887 CCATCTGGCCAAATTGTGTTTGG - Intergenic
1132166540 15:99597391-99597413 GTCTCTGACCAAAATTTATTAGG - Intronic
1132213723 15:100047180-100047202 CAGTCTGACCAAAATTTATTAGG - Intronic
1132226574 15:100146892-100146914 CAGTCTGACCAAAATTTATTAGG - Intronic
1132274056 15:100551092-100551114 CGGTCTGACCAAAATTTATTAGG - Intergenic
1133162076 16:3918694-3918716 CCGTCTGACCAAAATTTATTAGG - Intergenic
1134406561 16:13964579-13964601 CGGTCTGACCAAAATTTATTAGG + Intergenic
1135301148 16:21328545-21328567 TGGTCTGACTAAAATTTATTAGG - Intergenic
1135813495 16:25610979-25611001 TGGTCTGACCAAAATTTATTAGG + Intergenic
1136361553 16:29783624-29783646 CGGTCTGACCAAAATTTACCAGG - Intergenic
1136595417 16:31245757-31245779 CGGTCTGATCAAAATTTATTAGG + Intergenic
1136635274 16:31517397-31517419 CGGTCTGACCAAAATTTATTAGG - Intergenic
1137565628 16:49530961-49530983 CCTTCTGACCAGGATTTTTTTGG - Intronic
1138593695 16:58017744-58017766 CAATCTGACCAAAAATTATTAGG - Intronic
1138767515 16:59622329-59622351 CGGACTGACCAAAATTTATTAGG + Intergenic
1138875314 16:60941829-60941851 CAGTCTGACCAAAATTTATTAGG - Intergenic
1139497982 16:67335126-67335148 TGGTCTGACCAAAATTTATTAGG + Intronic
1140708355 16:77652604-77652626 CAGTCTGACAAAAAGTTGTAGGG + Intergenic
1142447087 16:90147784-90147806 CCATCTGACCAACATTTATTAGG + Intergenic
1142460405 17:87547-87569 CCATCTGACCAACATTTATTAGG - Intergenic
1144374584 17:14626677-14626699 CCTTATGACCAAAATGTGTGTGG - Intergenic
1145292438 17:21559181-21559203 GGGTCTAACCAAAATTTATTAGG - Intronic
1145387524 17:22426725-22426747 AGGTCTGACCAAAATTTATTAGG + Intergenic
1145819649 17:27822210-27822232 CAGTCTGACTAAAATTTACTAGG + Intronic
1146166771 17:30595731-30595753 TGGTCTGACCAAAATTTATTAGG + Intergenic
1146731847 17:35199875-35199897 CGGTCTAACCGAAATTTATTAGG - Intergenic
1147058959 17:37858654-37858676 CAGTCTGACCAAAATTTATAAGG - Intergenic
1147509098 17:41050366-41050388 CGGTCTGACCAAAAGTTATTAGG - Intergenic
1147591397 17:41685989-41686011 CGGTCTGACCAAAATTTATTAGG - Intergenic
1147840187 17:43365998-43366020 TGGTCTGACCAAAATTTATTCGG + Intergenic
1149028198 17:52054349-52054371 CAGTCTTACCAAAATTTATTAGG - Intronic
1150358841 17:64511247-64511269 CTGTCTGACCAAAATTTATTAGG + Intronic
1150807684 17:68332043-68332065 CGGTCTGACCAAAATTTATTAGG + Intronic
1150980943 17:70140797-70140819 CTATCTGACCAAAATTACTTTGG + Intergenic
1151591096 17:75045384-75045406 CGGTCTGACCAAAATTTATTAGG + Intronic
1153485491 18:5593631-5593653 CGGTCTGACCAAAATTTATTAGG + Intronic
1153795990 18:8622694-8622716 CGGTCTGACCCAAATTTATTAGG + Intronic
1153834616 18:8952583-8952605 CCTTTTGACCAGAATTTGCTGGG + Intergenic
1154047644 18:10921935-10921957 TGGTCTGACCAAAATTTATTAGG - Intronic
1154107626 18:11536473-11536495 CAGTCTGACCAAAACTTATTAGG + Intergenic
1154525730 18:15288080-15288102 CGGTCTGACCAAAATTTATTAGG - Intergenic
1156282194 18:35650473-35650495 CGGTCTGATCAAAATTTACTAGG + Intronic
1156649906 18:39213317-39213339 CAGTCTGATCAAAATTTATTAGG + Intergenic
1156761447 18:40596403-40596425 CGTTCTGGCCAAAATTTATTAGG + Intergenic
1157212736 18:45757907-45757929 CGGTCTGACCAAAATTTATTAGG + Intergenic
1157467656 18:47961265-47961287 CAGTCTGACTAAAATTTACTAGG - Intergenic
1158113027 18:53962917-53962939 CAGTCTGACCAAAATTTATTAGG - Intergenic
1158749288 18:60240339-60240361 CGGTCTGACCAAAATTTATTAGG - Intergenic
1159280151 18:66274548-66274570 CGGTCTGACTAAAATTTATTAGG - Intergenic
1159686202 18:71423932-71423954 CCGTCTGACCAAAATTTATTAGG - Intergenic
1160650120 19:220047-220069 CCATCTGACCAACATTTATTAGG - Intergenic
1162275372 19:9649647-9649669 TGGTCTGACTAAAATTTATTAGG - Intronic
1162281024 19:9698108-9698130 CGGTCTGACCAAAATTTATTAGG - Intronic
1162482059 19:10933262-10933284 CCGTCTAACAAAAATTAGCTGGG + Intronic
1162689508 19:12417549-12417571 CGGTCTGACCAAAATTTACCAGG - Intronic
1163079315 19:14925547-14925569 CCCTCTGCCCAGATTTTGTTTGG - Intergenic
1164013445 19:21230225-21230247 CTGTCTGACTAAAATTTACTAGG - Intronic
1164172130 19:22734549-22734571 CAGTCTGACCAAAATTTATTAGG - Intergenic
1164218054 19:23168395-23168417 CGGCCTGACCAAAATTTATTAGG - Intergenic
1164275993 19:23719248-23719270 CGGTCTGACCAAAATTTATTAGG - Intergenic
1164329762 19:24243287-24243309 TGGTCTGACTAAAATTTATTAGG - Intergenic
1164332252 19:24270882-24270904 CGGACTGGCCAAAATTTATTAGG - Intergenic
1164332516 19:24273121-24273143 CGGTCTGACCAAAATTTATTAGG - Intergenic
1164332937 19:24277985-24278007 CGGTCTGACCAAAATATATTAGG - Intergenic
1164339327 19:24372042-24372064 TGGTCTGATCAAAATTTATTAGG - Intergenic
1164340204 19:24387065-24387087 TGGTCTGACCAAAATTTATTAGG + Intergenic
1164365663 19:27579333-27579355 CGGTCTGACCAAAATTTATTAGG - Intergenic
1164377722 19:27703848-27703870 CGTTCTGACTAAAATTTATTAGG + Intergenic
1164388876 19:27799963-27799985 TGGTCTGACCAAAATTTATTAGG - Intergenic
1164430972 19:28188515-28188537 TGGTCTGACCAAAATTTATTAGG - Intergenic
1165812866 19:38622639-38622661 CGGTCTGACCAAAATTTATTAGG + Intronic
1166165921 19:40988560-40988582 CGGTCTGACCAAAATTTATTAGG - Intergenic
1166632619 19:44420480-44420502 CGGTCTGACCAAAATTTATTAGG - Intronic
1166912149 19:46166560-46166582 CGGTCTGACCAAAATTTATTAGG + Intergenic
1167799545 19:51731134-51731156 TGGTCTGATCAAAATTTATTAGG + Intergenic
1167818771 19:51907360-51907382 CGGTCTGACCAAAGTTTATTAGG - Intronic
926432868 2:12807506-12807528 CCCTCTCACCAAAACTAGTTGGG - Intergenic
926556309 2:14362288-14362310 CGGTCTGACCAAAATTTATTAGG + Intergenic
926859107 2:17290397-17290419 CGGTCTGACCAAAATTTATTAGG + Intergenic
926995980 2:18736364-18736386 TGGTCTGACCAAAATTTATTAGG - Intergenic
927195722 2:20545147-20545169 CGGTCTGACCAAAATTTATTAGG + Intergenic
928449315 2:31364620-31364642 TCTTCTGACCAAAATCTGTGAGG - Intronic
928708381 2:33976867-33976889 TGATCTGACCAAAATTTATTAGG - Intergenic
928901582 2:36323849-36323871 CAGTCTGACCAAAATTTATTAGG - Intergenic
929362728 2:41113817-41113839 CGGTCTGACCAAAATTTATTAGG + Intergenic
930161939 2:48167342-48167364 CGGTCTGACCAAAATTTATTAGG + Intergenic
930489534 2:52050890-52050912 CAGTCTAACCAAAATTTGTTAGG - Intergenic
930573195 2:53112720-53112742 CGGTCTGACCAAAATTTATTAGG - Intergenic
930595896 2:53387610-53387632 TGGTCTGACCAAAATTTATTAGG + Intergenic
930643498 2:53878730-53878752 TGGTCTGACCAAAATTTATTAGG - Intronic
930923997 2:56793425-56793447 CAGTTTGACCAAACTTTATTGGG - Intergenic
931562222 2:63573973-63573995 CAGTCTGACCAAAATTTATTAGG - Intronic
931583902 2:63806547-63806569 CGGTCTGACCAAAATTTATTAGG + Intronic
932139151 2:69260293-69260315 CCGTCTGACCAAAATTTACCAGG - Intergenic
932941971 2:76177539-76177561 CATTCTGACCAAAATTTATTAGG + Intergenic
933045535 2:77531830-77531852 CCCTCTGAAAAATATTTGTTGGG + Intronic
933459965 2:82570041-82570063 CAGTCTGACTAAAATTTACTAGG - Intergenic
933611850 2:84444636-84444658 CGGTCTGACCAAAAATTATTAGG + Intronic
934535573 2:95130418-95130440 GGGTCTGAACAAAATTTATTAGG + Intronic
935142104 2:100362382-100362404 CAGTCTGACCAAAATTTATTAGG + Intergenic
935331477 2:101980533-101980555 CCCTCTGACCAAAATAGGCTGGG + Intergenic
936160786 2:110082844-110082866 CGGTCTGACCAAAATTTATTAGG - Intergenic
936183878 2:110288510-110288532 CGGTCTGACCAAAATTTATTAGG + Intergenic
936874172 2:117168204-117168226 CGGTCTGACCAAAATTTATTAGG + Intergenic
937613329 2:123890425-123890447 CAGTCTGGCCAAAATTTACTAGG - Intergenic
937794685 2:126002916-126002938 CGGTCTGACTAAAATTTACTAGG - Intergenic
938308721 2:130271106-130271128 CGGTCTGGCCAAAATTTATTAGG + Intergenic
938524826 2:132119441-132119463 CGGTCTGACCAAAACTTATTAGG - Intergenic
938851878 2:135268592-135268614 CCTTCTGTCCAAAATTAGCTTGG + Intronic
938872809 2:135498854-135498876 CAGTCTGACCAAAATTTATTAGG - Intronic
939649962 2:144747819-144747841 CGGTCTGACCAAAATTTATCAGG - Intergenic
939796820 2:146655646-146655668 TGGTCTGACCAAAATTTATTAGG + Intergenic
940156504 2:150662276-150662298 TGGTCTGACCAAAATTTATTAGG + Intergenic
940299670 2:152163866-152163888 CAGTCTGACCAAAATTTACCAGG - Intronic
940487257 2:154311642-154311664 CAGTCTGACCAAAGTTTATTAGG + Intronic
940948553 2:159646035-159646057 GGGTCTGACCAAAATTTATTAGG + Intergenic
941571139 2:167172428-167172450 CAGTCTGACCAAAATTTATTAGG + Intronic
942312884 2:174671780-174671802 CTGTCTGACTAAAATTTACTAGG - Intronic
942380825 2:175388300-175388322 CGGTCTGACCAAAATTTATTAGG - Intergenic
942478291 2:176353096-176353118 TGGTCTGACCAAAATTTATTAGG + Intergenic
942802224 2:179888932-179888954 CAGTCTGACCAAAATTTACCAGG - Intergenic
943502684 2:188711693-188711715 TGGTCTGACCAAAATTTATTAGG - Intergenic
943606613 2:189984165-189984187 CTGTCTGACCAAAATTTATTAGG + Intronic
944178626 2:196862325-196862347 TGGTCTGATCAAAATTTATTAGG - Intronic
944244952 2:197521506-197521528 CGGTCTGACCAAAATTTATTAGG + Intronic
944397105 2:199280700-199280722 TGGTCTGACCAAAATTTATTAGG - Intronic
944780085 2:203008660-203008682 CGGTCTGACCAAAATTTATTAGG - Intronic
945066658 2:205953344-205953366 CAGTCTGACCAAAATTTATTAGG + Intergenic
945456605 2:210058294-210058316 CAGTCGGACCAAAATTTATTAGG - Intronic
945488314 2:210424866-210424888 CGGTCTGATGAAAATTTATTAGG + Intergenic
945488580 2:210427422-210427444 CAGTCTGACTAAAATTTATTAGG + Intergenic
945536539 2:211025207-211025229 CAGTCTGACTAAAATTTACTAGG + Intergenic
945897226 2:215497386-215497408 CGTTCTGACCAAAATTTATTAGG - Intergenic
945963623 2:216162560-216162582 CCGTCTAAACAAAATTAGCTGGG - Intronic
946863909 2:224025498-224025520 CAGATTGACCAAAATTTGTAGGG - Intronic
947270419 2:228328073-228328095 CAGTCTGACCAAAATTTATTAGG + Intergenic
947589347 2:231376527-231376549 CGGTCTGACCAAAATTTATTAGG - Intergenic
948012876 2:234664005-234664027 TGGTCTGACCAAAATTTATTAGG - Intergenic
1169280700 20:4264530-4264552 CGGTCTGACCAAAATTTATTAGG + Intergenic
1169613751 20:7414429-7414451 CGGTTGGACCAAAATTTATTAGG + Intergenic
1169731769 20:8793793-8793815 TGGTCTGACCAAAATTTATTAGG + Intronic
1170506144 20:17027605-17027627 CAGTCTGACCAAAATTTATTAGG - Intergenic
1171232227 20:23496624-23496646 TGGTCTGACCAAACTTTATTAGG + Intergenic
1171339428 20:24415695-24415717 CGGTCTGACTAAAATTTACTAGG - Intergenic
1171777444 20:29382290-29382312 AGATCTGACCAAAATTTATTAGG - Intergenic
1172264377 20:33598228-33598250 CGGTCTGACCAAAATTTATTAGG + Intronic
1176771696 21:13080407-13080429 CAGTCTGACAAAAATTTATTAGG + Intergenic
1177588837 21:23135412-23135434 CGGTCTGACCAAAATTTAGTAGG + Intergenic
1177993968 21:28072850-28072872 CAGTCTGACTAAAATTTACTAGG - Intergenic
1178014562 21:28329094-28329116 CAGTCTGACCAAAATTTATTAGG + Intergenic
1178836238 21:36099987-36100009 CGGTCTGACCAAAGTTTTTTAGG - Intergenic
1179003127 21:37482652-37482674 TGGTCTGACCAAAATTTATTAGG + Intronic
1179184609 21:39075396-39075418 TGGTCTGACCAAAATTTATTAGG + Intergenic
1179425289 21:41273288-41273310 TGGTCTGACCAAAATTTATTAGG + Intronic
1179660944 21:42874723-42874745 CGGTCTGACCAAAATTTATTAGG - Intronic
1179950319 21:44705673-44705695 CGGTCTGACCAAAATTTATTAGG - Intronic
1180155636 21:45976032-45976054 CGGTCTGACCAAAATTTATTAGG + Intergenic
1180436582 22:15310666-15310688 CTGTCTGACCAAAATTTATTAGG + Intergenic
1180518821 22:16174854-16174876 TGGTCTGACCAAAATTTATTAGG + Intergenic
1180894546 22:19320266-19320288 TGGTCTGACCAAAATTTATTAGG + Intergenic
1181377212 22:22469089-22469111 TAGTCTGACCAAAATTTATTAGG - Intergenic
1181601685 22:23956208-23956230 CGGTCTCACCAAAATTTATTAGG - Intergenic
1181606814 22:23985096-23985118 CGGTCTCACCAAAATTTATTAGG + Intergenic
1181874234 22:25927459-25927481 CGGTCTGACCAAAATTTATTAGG - Intronic
1181959689 22:26614042-26614064 CGGTCTGGCCAAAATTTATTAGG - Intronic
1182386069 22:29942496-29942518 TGGTCTGACCAAAATTTATTAGG + Intronic
1182486037 22:30639465-30639487 CAGTCTGACCAAAATTTATTAGG + Intronic
1182689373 22:32147447-32147469 CGGTCTGACCAAAATTTATTAGG - Intergenic
1182894369 22:33846809-33846831 CGGTCTGACCAAAATTTATTAGG - Intronic
1183171336 22:36190395-36190417 CGGTCTGACCAAAATTTATTAGG + Exonic
1183625409 22:38998470-38998492 CCGTCTGACCAAAATTTAGTAGG + Intergenic
1184054392 22:42034595-42034617 CGGTCTGACCAAAGTTTATTAGG + Intronic
1184062946 22:42095826-42095848 CGGTCTGACCAAAATTTATTAGG - Intergenic
949787898 3:7761818-7761840 CAGTCTGACCAAAATTTATTAGG - Intergenic
949919241 3:8988299-8988321 CCGAGTGACCCAAATTTCTTTGG - Intronic
950064082 3:10097281-10097303 AGGTCTGACCAAAATTTATTAGG + Intronic
950198597 3:11027138-11027160 CGGTCTGACTAAAATTTATTAGG + Intronic
950819074 3:15738772-15738794 TGGTCTGACCAAAATTTATGAGG + Intronic
951398432 3:22200619-22200641 TAGTCTGACCAAAATTTATTAGG + Intronic
952725357 3:36578512-36578534 CTGTCTGACCAAAATTTATTAGG + Intergenic
952934042 3:38381743-38381765 CAGTCTGACCAAAATTTATTAGG - Intronic
953509244 3:43518767-43518789 CGGTCTGACTAAAATTTACTAGG - Intronic
953519609 3:43628815-43628837 CGGTCTGACCAAAATTTATTAGG - Intronic
953994106 3:47506355-47506377 TGGTCTGACCAAAATTTATTAGG + Intronic
954219259 3:49142820-49142842 CTGTCTGACCAAAATTTATTAGG + Intergenic
955514846 3:59716358-59716380 CAGTCTGACTAAAATTTGCTAGG + Intergenic
955852531 3:63236160-63236182 GCCTCTGTCAAAAATTTGTTGGG + Intronic
956235049 3:67060346-67060368 CGGTCTGACCAAAATGTATTAGG - Intergenic
957373466 3:79326096-79326118 CGGTCTGACCAAAATTTATTAGG - Intronic
957457202 3:80467053-80467075 GAGTCTCACCAAAATTTATTAGG + Intergenic
957469184 3:80636435-80636457 CGGTCTGACCAAAATTTATTAGG + Intergenic
957874812 3:86131410-86131432 CAGTCAGACCAAAATTTATTAGG + Intergenic
957926594 3:86822054-86822076 CGGTCTGACCAAAATTTATTAGG + Intergenic
958271235 3:91502025-91502047 AGGTCTGACCAAAATTTATTAGG - Intergenic
958497200 3:94860550-94860572 CAGTCTGACCAAAATTTACCTGG - Intergenic
958509100 3:95022478-95022500 TGGTCTGACCAAAATTTATTAGG - Intergenic
958625258 3:96614855-96614877 CAGTCTGACCAAAATTTATTAGG + Intergenic
958684218 3:97371923-97371945 CGTTCTGACCAAAATTTATTAGG - Intronic
958761240 3:98311016-98311038 CGGTCTGACCAAAATTTATTAGG + Intergenic
958998981 3:100939764-100939786 CGGTCTGACCAAAATTTATTAGG + Intronic
959470551 3:106744608-106744630 CGGTCTGACCAAAACTTATTAGG - Intergenic
960112834 3:113862197-113862219 CAGTCTGACCAAAATTTATTAGG + Intronic
960308447 3:116090975-116090997 CCGTCTGACCAAAATTTATTAGG + Intronic
960374239 3:116878821-116878843 TGGTCTGACCAAAATTTATTAGG + Intronic
960541286 3:118865201-118865223 CAGTCTGACCAAAATTTATTAGG - Intergenic
960726705 3:120677511-120677533 TGGTCTGACCAAAATTTATTAGG - Intronic
960889860 3:122436207-122436229 CAGTCTGACTAAAATTTACTAGG - Intronic
961698168 3:128721018-128721040 CGGTCTGACCAAAATTTATCAGG - Intergenic
961892122 3:130139083-130139105 CGGTCTGACCAAAGTTTATTAGG + Intergenic
962290390 3:134131455-134131477 TGGTCTGACCAAAATTTATTAGG + Intronic
962651565 3:137498987-137499009 TGGTCTGACCAAAATTCATTAGG - Intergenic
962765317 3:138556949-138556971 CGGTCTGACCAAAATTTATTTGG + Intronic
963176567 3:142304015-142304037 CGGTCTGACCAAAATTTATTAGG + Intergenic
963349711 3:144137603-144137625 CGGTCTGACCAAAATTTGTTAGG + Intergenic
963414952 3:144983499-144983521 CGGTCTGACCAAAATTTATTAGG + Intergenic
963519559 3:146347100-146347122 TGGTCTGACCAAAATTTATTAGG - Intergenic
963659912 3:148112414-148112436 TGGTCTGACCAAAATTTATTAGG - Intergenic
963664031 3:148159529-148159551 TGGTCTGACTAAAATTTATTAGG - Intergenic
964196239 3:154068011-154068033 CGGTCTGACAAAAATTTATTAGG - Intergenic
964754467 3:160081244-160081266 TGGTCTGACCAAAATTTATTAGG + Intergenic
964880402 3:161417215-161417237 TGGTCTGACCAAAATTTTTTAGG + Intergenic
964908157 3:161743980-161744002 CAGTCTGACCAAAATTTATTAGG - Intergenic
964945889 3:162222994-162223016 CAGTCTGACCAAAATTTATTAGG - Intergenic
965400722 3:168209492-168209514 TGGTCTGACCAAAATGTATTAGG + Intergenic
965928914 3:174017919-174017941 TGGTCTGACCAAAATTTATTAGG + Intronic
966142589 3:176772601-176772623 CAGTCTGACCAAGATTTATTAGG - Intergenic
966151288 3:176869785-176869807 CGGTCTGACCAAAATTTATTAGG + Intergenic
967412769 3:189183460-189183482 CAGTCTGACCAAAATTTATTAGG + Intronic
967567169 3:190986705-190986727 CGGTCTGACCAAAATTTACTAGG - Intergenic
968100194 3:195959045-195959067 CCGTGAGACCAAAATTTGGAAGG - Intergenic
968192889 3:196683438-196683460 TGGTCTGACCAAAATTTATTAGG + Intronic
968367726 3:198200082-198200104 CCATCTGACCAACATTTATTAGG + Intergenic
968420985 4:484676-484698 CGGTCTGACCAAAATTTATTAGG - Intronic
969008655 4:4042517-4042539 CTGTCTGACCAAAGTTTATTAGG + Intergenic
969009319 4:4048488-4048510 CGGTCTGACCAAAGTTTATTAGG + Intergenic
969273314 4:6117608-6117630 CGGTCTGACCAAAGTTTATTAGG + Intronic
969745032 4:9063853-9063875 TTGTCTGAACAAAATTTATTAGG - Intergenic
970056534 4:11979765-11979787 CGGTCTGACCAAAATGTATTAGG - Intergenic
970342420 4:15120662-15120684 CGGTCTGACCAAAATTTATTAGG - Intergenic
970742635 4:19255708-19255730 TGGTCTGACCAAAATTTATTAGG + Intergenic
971064519 4:23015136-23015158 CCCTCAGACCACAATTTGTTGGG + Intergenic
971365835 4:25976468-25976490 CGGTCTGACCAAAATTTATTAGG - Intergenic
971718703 4:30216076-30216098 CGGTCTGACCAAAATTTATTAGG + Intergenic
971899866 4:32645941-32645963 CGGTCTGACTAAAATTTACTAGG - Intergenic
971987541 4:33845946-33845968 CGGTCTGACCAAAATTTATTAGG + Intergenic
972038216 4:34554122-34554144 CAGTCTGACCAAAATTTATTAGG + Intergenic
972847452 4:43006572-43006594 TGGTCTGACCAAAATTTATTAGG - Intronic
973043047 4:45497957-45497979 CGATGTGACCAAAATTTATTAGG + Intergenic
973585894 4:52390716-52390738 CGGTCTGACCAAAATTTATTAGG - Intergenic
973615383 4:52672655-52672677 TGGTCTGACCAAAATTTATTAGG + Intergenic
973798206 4:54450269-54450291 CTGTCTGATCAAAATTTATTAGG - Intergenic
973881924 4:55281388-55281410 CGGTCTGACCAAAATTTATTAGG - Intergenic
973943708 4:55936170-55936192 CGGTCTGATCAAAATTTATTAGG - Intergenic
974199448 4:58620221-58620243 CGGTCTGATCAAAATTTATTAGG - Intergenic
974214733 4:58829916-58829938 TGGTCTGACCAAAATTTATTAGG + Intergenic
974472659 4:62338355-62338377 CAGTCTGACAAAAATTTATTAGG + Intergenic
974548705 4:63345619-63345641 CAGTCTGACCAAAATTTATTAGG - Intergenic
974727003 4:65810841-65810863 CTGCCTGACCAAAATTTATTAGG + Intergenic
974983331 4:68989301-68989323 CTGTCTGACCAAAATTTATTAGG - Intergenic
974986569 4:69034490-69034512 CAGTCTGACTAAAATTTACTAGG - Intronic
975024909 4:69535709-69535731 TGGTCTGACCAAAATTTATTAGG - Intergenic
975248876 4:72153709-72153731 CGGTCTGACCAAAATTTATTAGG + Intergenic
975402471 4:73953541-73953563 CGGTCTGACCAAAATTTATTAGG + Intergenic
975587515 4:75965281-75965303 CAGTCTGACCAAAATTTATTAGG - Intronic
975605961 4:76154769-76154791 CAGTCTGACCAAAATTTATTAGG - Intergenic
975827008 4:78330704-78330726 CAGTCTGACCAAAATTTATTAGG - Intronic
975954811 4:79824798-79824820 CGGTCTGACCAAAATTTATTAGG + Intergenic
976375400 4:84339953-84339975 CGGTCTGACTAAAATTGATTAGG + Intergenic
976693046 4:87889283-87889305 CGGTCTCACCAAAGTTTATTAGG + Intergenic
976816314 4:89151419-89151441 CAGTCTGACCAAAATTTATTAGG - Intergenic
977140574 4:93366427-93366449 CAGTGTGACCAAAATTTATTAGG - Intronic
977388777 4:96381626-96381648 TGGTCTGACCAAAATTTATTAGG + Intergenic
977473516 4:97473481-97473503 CGGTCTGACCAAAATTTATTAGG - Intronic
977605789 4:98984131-98984153 CAGTCTGACCAAAATTTATTAGG + Intergenic
978023888 4:103848451-103848473 CGGTCCAACCAAAATTTATTAGG + Intergenic
978211987 4:106148077-106148099 TGGTCTGACCAAAATTTATTAGG - Intronic
978768077 4:112425195-112425217 CCATCTGAGGAAAATTTGTTTGG - Intronic
979016546 4:115441655-115441677 CGGTCTGACCAAAATTTATTAGG + Intergenic
979137128 4:117124089-117124111 CGGTTTGACCAAAATTTATTAGG - Intergenic
979147610 4:117264835-117264857 CGGTCTGACCAAAATTTATTAGG + Intergenic
979195910 4:117919815-117919837 TGGTCTGACCAAAATTTAGTAGG - Intergenic
979256145 4:118609793-118609815 CCACCTGACCAAAATTTATTAGG + Intergenic
979332202 4:119430744-119430766 CCATCTGACCAAAATTTATTAGG - Intergenic
979678280 4:123433241-123433263 TGGTCTGACCAAAATTTATTAGG - Intergenic
979970092 4:127123974-127123996 CGGTCTGACAAAAATTTATTAGG + Intergenic
980296634 4:130926931-130926953 CAGTCTGCCCATATTTTGTTTGG + Intergenic
980313179 4:131162221-131162243 TGGTCTGACCAAAATTTGTTAGG + Intergenic
981421133 4:144551491-144551513 CAGTCTGACCAAAATTTATTAGG + Intergenic
981448370 4:144866956-144866978 CGGTCTGACCAAAATTTATTAGG - Intergenic
981739743 4:147989382-147989404 CGGTCTGACCAAAATTTATTAGG + Intronic
982175372 4:152701095-152701117 CGGTATGACGAAAATTTATTAGG + Intronic
982391933 4:154874148-154874170 CGGTCTGACTAAAATTTACTAGG + Intergenic
982587273 4:157258455-157258477 CGGTCTGACCAAAATTTATTAGG - Intronic
982807879 4:159789149-159789171 CGGTCTGACCAAAATTTATTAGG - Intergenic
982830696 4:160055850-160055872 CGGTCTGACCAAAATTTATTAGG + Intergenic
982903812 4:161042873-161042895 TGGTCTGACCAAAATTTATTAGG + Intergenic
983419121 4:167495628-167495650 CGGTCTGACCAAAATTTATTAGG - Intergenic
984064251 4:175028501-175028523 CAGTCTGACCAAAATTTATTAGG + Intergenic
984324614 4:178236243-178236265 TGGTCTGACCAAAATTTATTAGG + Intergenic
985469242 5:27954-27976 TGGTCTGAGCAAAATTTATTAGG - Intergenic
987571924 5:19675317-19675339 CGGTATGACCAAAATTTATCAGG + Intronic
988222623 5:28368726-28368748 CGGTCTGACCAAAATTTATTAGG + Intergenic
988240297 5:28599612-28599634 CTGTCTGACTAAAATTTACTAGG - Intergenic
988245502 5:28675358-28675380 TGGTCTGAACAAAATTTATTAGG + Intergenic
988343439 5:30005851-30005873 CCGTCTGACCAAAATTTATTAGG - Intergenic
988717743 5:33844540-33844562 CGGTCTGACCAAAATTTATTAGG - Intronic
988830443 5:34981945-34981967 CGGTCTGACCAAAATTTATTAGG + Intergenic
989317892 5:40103568-40103590 CGGTCTGACCAAAATTTGTTAGG - Intergenic
989318919 5:40112367-40112389 CGGTCTGACCAAAATTTATTAGG - Intergenic
989455066 5:41634643-41634665 CAGTCTGACCAAAATTTATTAGG - Intergenic
989572274 5:42955664-42955686 TGGTCTGACCAAAATTTATTAGG + Intergenic
989580206 5:43025457-43025479 TGGTCTGACCAAAGTTTATTAGG - Intergenic
989624364 5:43415269-43415291 CAGTCTGACCAAAATTTATTAGG - Intergenic
989771536 5:45152147-45152169 CGGTCTGACCAAAATTTATTAGG - Intergenic
990300487 5:54444919-54444941 CAGTCTGATCAAACTTTATTAGG - Intergenic
990302365 5:54461568-54461590 GGGTCTGACCAAAATTTATTAGG + Intergenic
990339616 5:54809395-54809417 CGGTCTGACCAAAATTTACTAGG + Intergenic
990346427 5:54876232-54876254 CGGTCTGACCAAAATTTATTAGG - Intergenic
990395589 5:55375235-55375257 CGGTCTGACCAAAATTTATTAGG + Intronic
990529774 5:56661564-56661586 CCTTCTGGCAAAAATTTGTGGGG - Intergenic
991626035 5:68601917-68601939 TGGTCTGACCAAAATTTATTAGG - Intergenic
991712568 5:69422508-69422530 TGGTCTGACCAAAATTTATTAGG - Intronic
991991609 5:72345026-72345048 CGGTCTGACCAAAATTTATTAGG + Intronic
992160279 5:73994166-73994188 TGGTCTGACCAAAATTTATTAGG + Intergenic
992955188 5:81901185-81901207 CGGTCTGACCAAAATTTATTAGG - Intergenic
994734350 5:103533809-103533831 TGGTCTGACCAAAATTTATTAGG - Intergenic
994744683 5:103663948-103663970 CAGTCTGACTAAAATTTACTAGG + Intergenic
995098891 5:108274167-108274189 TGGTCTGACCAAAATTTATTAGG + Intronic
995120016 5:108526164-108526186 TGATCTGACCAAAATTTATTAGG - Intergenic
995149423 5:108825188-108825210 CGGTCTGACCAAAATTTATTAGG + Intronic
995593956 5:113729127-113729149 CCAACTGACCAAAATTTATTAGG + Intergenic
996100083 5:119436867-119436889 TGGTCTGACCAAAACTTATTAGG - Intergenic
996104266 5:119480680-119480702 CGGTCTGACCAAAATTTATTAGG + Intronic
996753320 5:126911068-126911090 TGGTCTGACCAAAATTTATTAGG - Intronic
996893184 5:128447499-128447521 CAGTCTGACCAAAATTTATTAGG - Intronic
997089763 5:130843202-130843224 CGGTCTGACCAAAATTTATTAGG - Intergenic
997244820 5:132338474-132338496 CGGTCTGACCAAAATTTATTAGG + Intronic
997765471 5:136499185-136499207 CGGTCTGACCAAAATTTATGAGG + Intergenic
997901351 5:137768203-137768225 CAGTCTGACCAAAATTTATTAGG - Intergenic
997920784 5:137977203-137977225 CGGTCTGACCAAAATTTATTAGG - Intronic
998259869 5:140621893-140621915 CAGTCTGACCAAAATTTATTAGG - Intergenic
998585170 5:143419820-143419842 TGGTCTGACCAAAATATATTAGG + Intronic
998777220 5:145616816-145616838 CAGTCTGACCAAAATTTATTAGG + Intronic
998940027 5:147271759-147271781 AGGTCTGACCAAAATTTATTAGG - Intronic
999093222 5:148955722-148955744 CGGTCTGACCAAAATTTATTAGG + Intronic
999308698 5:150537536-150537558 CAGTCTGACCAAAATTTGTTAGG - Intronic
1000004454 5:157170196-157170218 CGGTCTGACCAAAATTTATTAGG - Intronic
1000471771 5:161652024-161652046 GGGTCTGACCAAAATTTATTAGG + Intronic
1000562660 5:162810056-162810078 CCCTCTAACAAAAATTTATTAGG - Intergenic
1001189776 5:169618916-169618938 CAGTCTGACCAAAATTTATTAGG - Intergenic
1001521523 5:172397256-172397278 CGGTCTGACCAAAATTTATTAGG - Intronic
1001522110 5:172402261-172402283 CGGTCTGACCAAAATTTATGAGG - Intronic
1002726947 5:181305311-181305333 CCATCTGACCAACATTTATTAGG + Intergenic
1003068828 6:2928145-2928167 CGGTCTGACCAAAATTTATTAGG - Intergenic
1003079432 6:3009050-3009072 CGATCTGACCAAAATTTATTAGG + Intronic
1003351003 6:5317810-5317832 TTGTCTGAGAAAAATTTGTTTGG - Intronic
1003931408 6:10927736-10927758 CGGTCTGACCAAAATTTATTAGG + Intronic
1004164534 6:13244410-13244432 CAGTGTGACCAAAATTTATTAGG + Intronic
1004471300 6:15931806-15931828 CGGTCTGACCAAAATTTATTAGG + Intergenic
1004778258 6:18873330-18873352 AGGTCTGACCAAAATTTATTAGG - Intergenic
1005501631 6:26433944-26433966 CGGTCTGACCAAAATTTATTAGG - Intergenic
1005693306 6:28328252-28328274 CGGTCTGACCAAAATTTATTAGG + Intronic
1005971438 6:30764938-30764960 TGGTCTGACCAAAATTTATTAGG + Intergenic
1006218360 6:32465869-32465891 CGATCTGATCAAAATTTATTAGG + Intergenic
1006238384 6:32656143-32656165 CGGTCTGATCAAAATTTATTAGG + Intergenic
1006418057 6:33916680-33916702 CGGTCTGACCAAAATTTATTAGG + Intergenic
1006661781 6:35652592-35652614 TAGTCTGACCAAAGTTTATTAGG - Intronic
1006720760 6:36148731-36148753 TGGTCTGACCAAAATTTATTAGG + Intergenic
1008044974 6:46842543-46842565 CAGTCTGACCAAAATTTATCAGG - Intergenic
1008049245 6:46883190-46883212 TGGTCTGCCCAAAAGTTGTTAGG + Intronic
1008100493 6:47385364-47385386 TTGTCTGACCAAAATTTATTAGG - Intergenic
1008162183 6:48092090-48092112 TCTTCTGTCCTAAATTTGTTGGG + Intergenic
1008170731 6:48202406-48202428 TGGTCTGACCAAAATTTATTAGG - Intergenic
1008251235 6:49242525-49242547 CAGTCTGACCAAAATTTATTAGG + Intergenic
1008585482 6:52944558-52944580 TTGTCTGACCAAAATTTATTAGG - Intergenic
1008909695 6:56720032-56720054 CGGTCTGACCAAAATTTATTAGG + Intronic
1008983904 6:57519284-57519306 TGGTCTGACCAAAATTTATTAGG + Intronic
1009171963 6:60412192-60412214 CGGTCTGACCAAAATTTATTAGG + Intergenic
1009296543 6:61957602-61957624 CAGTCTGACCAAAAATTATTAGG - Intronic
1009536234 6:64890154-64890176 TGGTCTGACCAAAATTTATCAGG - Intronic
1009544163 6:65003353-65003375 CGGTCTGACCAAAATTTATTAGG - Intronic
1010102978 6:72131724-72131746 TGGTCTGACCAAAATTTATTAGG + Intronic
1010305057 6:74310228-74310250 TGGTCTGACCAAAATTTATTAGG + Intergenic
1010492966 6:76496015-76496037 CGGTCTGACTAAAATTTACTAGG + Intergenic
1011066094 6:83327562-83327584 TGGTCTGACCAAAATTTGTTAGG - Intronic
1011124822 6:83995834-83995856 TGGTCTGACCAAAATTTATTAGG - Intergenic
1011959811 6:93073573-93073595 CGGTCTGACCAAAATTTATTAGG - Intergenic
1012122651 6:95386823-95386845 CAGTCTGACCAAAATTTATTAGG + Intergenic
1012173188 6:96045358-96045380 CAGTCTGGCCAAATTTTGTCTGG - Intronic
1012216496 6:96592122-96592144 CTGTCTGACCAAAATTTATTAGG + Intronic
1012960341 6:105615479-105615501 CGGTCTGACGAAAATTTATTAGG + Intergenic
1013500282 6:110742752-110742774 CGGTCTAACCAAAATTTACTGGG - Intronic
1013610931 6:111794253-111794275 CCATCTGACAAAAAATTGTGTGG + Intronic
1013780006 6:113718669-113718691 CCATCTGACCAAAATTAATTTGG - Intergenic
1013833203 6:114299269-114299291 CGGTCTGACCAAAATTTATTAGG - Intronic
1013845328 6:114443927-114443949 CAGCCTGACCAAAATTCGTCAGG + Intergenic
1013865220 6:114688705-114688727 TGGTCTGACCAAAATTTATTAGG + Intergenic
1013923595 6:115440762-115440784 CGGTCTGACCAAAATTTATTAGG + Intergenic
1014119892 6:117712643-117712665 CGATCTGACCAAAATTTATTAGG + Intergenic
1014251418 6:119119112-119119134 CAGTCTGACCAAAATTTATTAGG - Intronic
1014290674 6:119554188-119554210 TGGTCTGACCAAAATTTATTAGG - Intergenic
1014319330 6:119907221-119907243 TGGTCTCACCAAAATTTATTAGG - Intergenic
1014352152 6:120358801-120358823 CAGTCTGACTAAAATTTGCCAGG - Intergenic
1014819445 6:125971113-125971135 CCAGGTGACCAAAATTTTTTTGG + Intronic
1015180828 6:130360688-130360710 CAGTCTGACCAAAATTTATTAGG + Intronic
1015206435 6:130644876-130644898 CAGTCTGACCAAAATTTATTAGG + Intergenic
1015545344 6:134356000-134356022 CCGTCTGACCAAAATTTATTAGG - Intergenic
1016192976 6:141293844-141293866 CCGTCTGACCAAAATTTTTTAGG + Intergenic
1016632001 6:146243758-146243780 TGGTCTGACCAAAATTTATTAGG + Intronic
1018985178 6:168630881-168630903 CCGTCTGATCAAAATTTATTAGG - Intronic
1019002827 6:168769936-168769958 CAGTCTGACTAAAATTTACTAGG + Intergenic
1020048467 7:5062618-5062640 CGGTCTGACCAAAATTTATTAGG + Intronic
1020615733 7:10458479-10458501 TGGTCTGACCAAAATTTATTAGG + Intergenic
1020738471 7:11983495-11983517 TGGTCTGACCAAAATTTATTAGG + Intergenic
1020803499 7:12760463-12760485 AGGTCTGACCAAAATTTATTAGG + Intergenic
1020834876 7:13136575-13136597 TGGTCTGACCAAAATTTATTAGG - Intergenic
1021139270 7:17003779-17003801 CGGTCTGACCAAAATTTATTAGG + Intergenic
1023016834 7:35976853-35976875 CCATCGGACCAAAATTTATTCGG + Intergenic
1023565918 7:41523583-41523605 TGGTCTGACCAAAATTTATTAGG + Intergenic
1024010593 7:45262982-45263004 CGGTCTGACCAAAATTTATTAGG - Intergenic
1024122809 7:46261909-46261931 CAGTCTGACCAAAATTTATTAGG - Intergenic
1024213091 7:47223700-47223722 CGGTCTGACCAAAATTTATTAGG - Intergenic
1024497424 7:50064419-50064441 CGGTCTGACCAAAATTTCTTAGG + Intronic
1024586431 7:50845780-50845802 TGGTCTGACCAAAATTTATTAGG - Intergenic
1024808144 7:53172970-53172992 ACATCTGACCACAATTAGTTTGG - Intergenic
1024892839 7:54223189-54223211 TGGTCTGACCAAAATTCATTAGG + Intergenic
1024901078 7:54319198-54319220 TGGTCTGACCAAAATTCATTAGG - Intergenic
1024942374 7:54776141-54776163 TGGTCTGATCAAAATTTATTAGG - Intergenic
1025009646 7:55385767-55385789 CGGTCTGACCAAAGTTTATTAGG + Intronic
1025116759 7:56264804-56264826 TGGTCTGACCAAAATTTGTTAGG - Intergenic
1025155242 7:56599334-56599356 CGGTCCGACCAAAATTTATTAGG + Intergenic
1025600143 7:62986657-62986679 CAGTCTGACCAAAATTTATTAGG + Intergenic
1025734768 7:64137218-64137240 TGGTCTGACCAAAATTTATTAGG - Intronic
1025749485 7:64280987-64281009 CGGTCTGACCAAAATTTATTAGG + Intergenic
1025760075 7:64381499-64381521 TGGTCTGACCAAAATTTATTAGG - Intergenic
1026514165 7:71053169-71053191 GGGTCTGACCAAAATTTATTAGG + Intergenic
1026730602 7:72908544-72908566 CGGTTTGACCAAAATTTATTAGG + Intronic
1027628804 7:80576733-80576755 CAGTCTGACCAAAATTTATTAGG - Intronic
1027793231 7:82658862-82658884 CAGTCTGACCAAAATTTATTAGG + Intergenic
1027976139 7:85158456-85158478 CGGTCTGACCAAAATTTATTAGG - Intronic
1028400870 7:90424075-90424097 CAGTCTGACCAAAATTTATTAGG - Intronic
1028435123 7:90794345-90794367 CGGTCTGACCAAAATTTATTAGG + Intronic
1028539377 7:91925390-91925412 CGGTCTGACCAAAATTTATTAGG + Intergenic
1028787034 7:94807289-94807311 CAGTCTGACCAAAATTTATTAGG + Intergenic
1028999809 7:97141144-97141166 CGGTCTGACCAAAATTTATTAGG - Intronic
1029068280 7:97874008-97874030 CGGTCTGACCAAAGTTTATTAGG + Intergenic
1029370105 7:100144576-100144598 TGGTCTGACCAAAATTTATTAGG + Intergenic
1030070970 7:105697194-105697216 CGGTCTGACCAAAATTTATTAGG + Intronic
1030417819 7:109267510-109267532 TGGTCTGACCAAAATTTATTAGG - Intergenic
1030489505 7:110214097-110214119 TGGTCTGACCAAAATTTATTAGG - Intergenic
1030599100 7:111572341-111572363 CGGTCTGACCAAAATTTATTAGG + Intergenic
1030601429 7:111597303-111597325 CAGTCTGACCAAAATTTATTAGG - Intergenic
1030663669 7:112250258-112250280 CCGTCTGACCAAAATTTATTAGG - Intronic
1031229319 7:119085027-119085049 TGGTCTGACCAAAATTTATTAGG + Intergenic
1031295093 7:119991781-119991803 CGGCCTGACCAAAATTTATTAGG + Intergenic
1031426993 7:121617153-121617175 CAGTCTGACCAAAATTTATTAGG - Intergenic
1031560093 7:123227967-123227989 CTGTCTGACCAAAATTTATTAGG - Intergenic
1031930466 7:127680343-127680365 TGGTCTGACCAAAATTTATTAGG + Intronic
1032048463 7:128630529-128630551 CCATCTGACCAAAATTTATTAGG + Intergenic
1032723513 7:134570223-134570245 CGGTCTGACCAAAATTTATTAGG - Intronic
1033721233 7:144061336-144061358 CGGTCAGACCAAAATTTATTAGG - Intergenic
1033859457 7:145606965-145606987 CCGTCTGACCAAAATTTATTAGG - Intergenic
1033904952 7:146191506-146191528 CGGTCTGAGTAAAATTTGCTAGG + Intronic
1034363459 7:150523118-150523140 TGGTCTGACTAAAATTTATTAGG + Intergenic
1034583843 7:152071168-152071190 CAGTCTGACCAAAATTTATTAGG + Intronic
1034929646 7:155151591-155151613 TGGTCTGACCAAAATTTATTAGG - Intergenic
1035592623 8:828206-828228 CAGTCTGACCAAAATTTATTAGG + Intergenic
1035686881 8:1530111-1530133 CGGTCTGATCAAAATTTATTTGG + Intronic
1036158361 8:6363420-6363442 CAGTCTGACCAAAATTTATTAGG - Intergenic
1036249934 8:7153175-7153197 CCGTCTGACCAAAGTTTATTAGG + Intergenic
1036250602 8:7159162-7159184 CCGTCTGACCAAAGTTTATTAGG + Intergenic
1036366882 8:8128291-8128313 CCGTCTGACCAAAGTTTATTAGG - Intergenic
1036367561 8:8134262-8134284 CCGTCTGACCAAAGTTTATTAGG - Intergenic
1036373713 8:8182394-8182416 CGGTCTGACCAAAGTTTATTAGG - Intergenic
1036514470 8:9430962-9430984 CGGTCTGACCAAAATTTATTAGG - Intergenic
1036877190 8:12483247-12483269 CGGTCTGACCAAAGTTTATTAGG + Intergenic
1036883319 8:12531399-12531421 CGGTCTGACCAAAGTTTATTAGG + Intergenic
1036883998 8:12537370-12537392 CCGTCTGACCAAAGTTTATTAGG + Intergenic
1036999288 8:13698463-13698485 CGGTCTGACCAAAATTTATTAGG + Intergenic
1037038417 8:14199323-14199345 CAGTCTGACCAAAATTTATTAGG - Intronic
1038786558 8:30622576-30622598 CGGTCTGACCAAAATTTATTGGG + Intronic
1038991897 8:32877414-32877436 CGGTCTGACCAAAATTTATTAGG - Intergenic
1039598451 8:38812091-38812113 CGGTCTGACCAAAATTTACCAGG - Intronic
1040124868 8:43725910-43725932 CTGTCTGGCCAAAATTTATTAGG - Intergenic
1040276102 8:46014540-46014562 TGGTCTGACCAAATTTTATTAGG + Intergenic
1040393088 8:46966628-46966650 CAGTCTGACCAAAATTTATTAGG + Intergenic
1040538846 8:48333347-48333369 TGGTCTGACCAAAATTTATTAGG + Intergenic
1040634324 8:49254643-49254665 CGGTCTGACCAAAATTTATTAGG - Intergenic
1040679060 8:49787163-49787185 TGGTCTAACCAAAATTTATTAGG + Intergenic
1040840096 8:51776101-51776123 CAGTCTGACCAAAATTTATTAGG - Intronic
1041164117 8:55074106-55074128 CGGTCTGACCAAAATTTATTAGG - Intergenic
1041584147 8:59496274-59496296 TGGTCTGACCAAAATTTATTAGG + Intergenic
1041649740 8:60290108-60290130 CGGTCTGACCAAAATTCATTAGG + Intergenic
1041664909 8:60433892-60433914 TGGTCTGACCAAAATTTATTAGG + Intergenic
1041824161 8:62073066-62073088 CAGTCTGACCAAAATTTATTAGG + Intergenic
1042155269 8:65838901-65838923 CCGAGTGACCAAAATTGATTTGG - Intronic
1042529237 8:69797723-69797745 CAGTCTGACCAAAATTTATTAGG - Intronic
1042709243 8:71696987-71697009 CGGTCTGACCAAAATTTATTAGG + Intergenic
1043281365 8:78470872-78470894 CGGTCTGACCAAAATTTACCAGG - Intergenic
1043327471 8:79070326-79070348 CGGTCTGACCAAAATTTATTAGG - Intergenic
1043584136 8:81747914-81747936 CGGTCTGACCAAAATTTATTAGG + Intronic
1043684777 8:83071637-83071659 TGGTCTGACCAAAATTTATTAGG + Intergenic
1043977509 8:86599716-86599738 CGGTCTGACCAAAATTTATTAGG - Intronic
1044590344 8:93908223-93908245 CAGTCTGACCAAAATTTATTAGG + Intronic
1045798730 8:106077449-106077471 TGGTCTGACCAAAATTTATTAGG - Intergenic
1046076659 8:109320190-109320212 CGGTCTGACCAAAATTTATTAGG + Intronic
1046153354 8:110256834-110256856 AGGTCTGACCAAAATTTATTAGG + Intergenic
1046868870 8:119181909-119181931 CAGTCTGACCAAAATTTATTAGG + Intronic
1047447619 8:124933598-124933620 CAGTGTGACCAAAATTTATTAGG - Intergenic
1047804269 8:128343040-128343062 CCGTCTGACAAATATTTACTGGG + Intergenic
1048002922 8:130394414-130394436 CGGTCTGACCAAAATTTATTAGG - Intronic
1048479060 8:134770913-134770935 CGGTCTGACCAAAATTTATTCGG - Intergenic
1048809678 8:138274565-138274587 CGGTCTCACCAAAATTTATTAGG + Intronic
1048820261 8:138373845-138373867 CGGTCTGACCAAAATTTATTAGG - Intronic
1048825713 8:138423738-138423760 CTATCTGACCAAAATTTATTAGG + Intronic
1049513395 8:143041143-143041165 CAGTCTGACCAAAATTTATTAGG + Intronic
1049965987 9:780383-780405 TGCTCTGACCAAAATTTATTAGG - Intergenic
1050401393 9:5259542-5259564 TGGTCTGACCAAAATTTATTAGG - Intergenic
1050817457 9:9833560-9833582 CGGTCTGACCAAAATTTATTAGG + Intronic
1051833802 9:21311498-21311520 CGGTCTGACCAAAATTTATTAGG - Intergenic
1052009485 9:23389109-23389131 CAGTCTGACCAAAATTTGTTAGG + Intergenic
1052083800 9:24239260-24239282 TGGTCTGACCAAAATTTATTAGG + Intergenic
1052354889 9:27494142-27494164 CGGTCTGACCAAAATTTATTAGG - Intronic
1052426455 9:28311380-28311402 CAGTCTGACCAAAATTTATTAGG + Intronic
1052602068 9:30646743-30646765 CGGTCTGACTAAAATTTACTAGG + Intergenic
1052741045 9:32393396-32393418 CGGTCTGACCAAAATTTATTAGG - Intronic
1053087582 9:35239584-35239606 TGGTCTGACCAAAATTTATTAGG + Intronic
1053651596 9:40175380-40175402 CGGTCTGACCAAAATTTATTAGG + Intergenic
1053703578 9:40727046-40727068 CGGTCTGACCAAAATTTATTAGG - Intergenic
1053901986 9:42804707-42804729 CTGTCTGACCAAAATTTATTAGG + Intergenic
1053902993 9:42813527-42813549 CAGTCTGACCAAAATTTACCAGG + Intergenic
1054413636 9:64850509-64850531 CGGTCTGACCAAAATTTATTAGG - Intergenic
1054532985 9:66200822-66200844 CGGTCTGACCAAAATTTATTAGG - Intergenic
1054978015 9:71171134-71171156 CAGTCTGACCAAAATTTATTAGG - Intronic
1055340175 9:75273141-75273163 CAGTCTGACCAAAATTTATTAGG + Intergenic
1055343824 9:75313279-75313301 CGGTCTGACCAAAATTTATTGGG + Intergenic
1055356097 9:75438601-75438623 CTGTCTGGCCAGAATTTCTTTGG - Intergenic
1055784853 9:79861865-79861887 CAGTCTGACCAAAATTTATTAGG - Intergenic
1055830444 9:80372099-80372121 CGGTCTGACCAAAATTTATTAGG + Intergenic
1055908043 9:81316364-81316386 CGGTCTGACCAAAATTTATTAGG + Intergenic
1056082856 9:83114742-83114764 CGGTCTGACCAAAATTTATTAGG - Intergenic
1056470332 9:86899537-86899559 CGGTCTGACCAAAATTTATTAGG + Intergenic
1057013329 9:91628050-91628072 CGGTCTGACCAAAGTTTATTAGG - Intronic
1057099162 9:92341163-92341185 TGGTCTGAACAAAATTTATTAGG - Intronic
1057145321 9:92755232-92755254 TGGTCTGACCAAAATTTATTAGG - Intronic
1057538804 9:95945043-95945065 TGGTCTGACCAAAATTTATTAGG + Intronic
1057715691 9:97493616-97493638 TGGTCTGACCAAAATTTATTAGG + Intronic
1058103542 9:100943739-100943761 CCTTCTGTACCAAATTTGTTGGG + Intergenic
1058225470 9:102356255-102356277 CGGTCTGACCAAAATTTACCAGG - Intergenic
1058288792 9:103211624-103211646 CGGTCTGACCAAAATTTATTAGG + Intergenic
1058922631 9:109631880-109631902 TGGTCTGACCAAAATTTATTAGG - Intergenic
1059281848 9:113141197-113141219 CAGTCTGACCAAAATTTATTAGG - Intergenic
1060013539 9:120065917-120065939 TTGTCTGACCAAATTTTGTCAGG - Intergenic
1061104570 9:128519538-128519560 CGGTCTGACCAAAATTTATTAGG - Intronic
1061530920 9:131212183-131212205 CGGTCTGACTAAAATTTACTAGG - Intronic
1062752067 9:138262787-138262809 CCATCTGACCAACATTTATTAGG + Intergenic
1186132081 X:6478766-6478788 CAGTCTGACCAAAATTTATTAGG - Intergenic
1186149972 X:6664519-6664541 CGGTCTGACCAAAATTTATTAGG + Intergenic
1186329155 X:8513884-8513906 CGGTCTGACCAAAATTTATTAGG - Intergenic
1186803611 X:13117696-13117718 TGGTCTGACCAAAATTTATTAGG + Intergenic
1187122467 X:16422755-16422777 CGGTCTGACCAAAATTTATTAGG - Intergenic
1187433729 X:19248152-19248174 CGGTCTGACCAAAATTTATTAGG - Intergenic
1188255775 X:27960676-27960698 CGGTCTGACTAAAATTTACTAGG - Intergenic
1188822838 X:34796661-34796683 CGGTCTGACCAAAATTTATTAGG - Intergenic
1188823574 X:34803027-34803049 CGGTCTGACCAAAATTTATTAGG - Intergenic
1188979409 X:36713677-36713699 CAGTCTGACCAAAATTTATTAGG + Intergenic
1189509199 X:41644873-41644895 TGGTCTGACTAAAATTTATTAGG - Intronic
1189978974 X:46490086-46490108 CGGTCTGACCAAAATTTATTAGG + Intronic
1190002015 X:46698025-46698047 CAGTCTGACCAAAATTTGTTAGG - Intronic
1190089924 X:47428647-47428669 CCGTCTAACAAAAATTAGCTGGG - Intergenic
1190185918 X:48234119-48234141 CGGTCTGACCAAAATTTATTAGG - Intronic
1190616309 X:52236580-52236602 TGGTCTGACCAAAATTTATTAGG - Intergenic
1190651381 X:52571993-52572015 CGGTCTGACCAAAATTTATTAGG - Intergenic
1191064334 X:56331319-56331341 CAGTACGACCAAAATTTATTAGG - Intergenic
1191126051 X:56954899-56954921 CAGTCTGTCCAAACTTTATTAGG - Intergenic
1191148407 X:57193309-57193331 CAGTCTGAACAAAATTTATTAGG - Intergenic
1191244866 X:58219285-58219307 CGGCCTGACAAAAATTTATTAGG + Intergenic
1191596144 X:62946160-62946182 CCGTGTGACCAAAATTTATTAGG + Intergenic
1191980865 X:66924020-66924042 CAGTCTGACCAAAATTTTTTAGG - Intergenic
1192077645 X:68016703-68016725 GGGTCTGACCAAAATTTATTAGG - Intergenic
1192731714 X:73807780-73807802 CGGTCTGACCAAAATTTATTAGG - Intergenic
1192752213 X:74005145-74005167 CTGTCTGACCAAAATTTATTAGG + Intergenic
1193025744 X:76844042-76844064 TGGTCTGACCAAAGTTTATTAGG - Intergenic
1193301727 X:79896959-79896981 TGGTCTGACCAAAATTTATTAGG - Intergenic
1193594754 X:83432639-83432661 TGGTCTGACCAAAATTTATTAGG - Intergenic
1193680632 X:84515060-84515082 CGGTCTGACCAAAATTTATTAGG + Intergenic
1194101987 X:89717282-89717304 CAGTCTGACCAAAATTTATTAGG - Intergenic
1194194953 X:90881571-90881593 CCGTCTGACCAAAATTTATTAGG - Intergenic
1194378867 X:93168928-93168950 CGGTCTGACTAAAATTTACTAGG - Intergenic
1194800783 X:98269744-98269766 CAGTCTGACCAAAATTTATTAGG - Intergenic
1194923272 X:99793993-99794015 CAGTCTGACCAAAATTTATTAGG - Intergenic
1195734305 X:107997138-107997160 CGGTCTGACCAAAGTTTATTAGG - Intergenic
1195785246 X:108512847-108512869 CGGTCTGACCAAAATTTATTAGG + Intronic
1195823125 X:108969113-108969135 CGGTCTGACCAAAGTTTATTAGG - Intergenic
1196238096 X:113306434-113306456 CCGTCTGACCAAAGTTTATTAGG + Intergenic
1197039239 X:121915835-121915857 ACCTCTGAACAAATTTTGTTTGG - Intergenic
1197086510 X:122482852-122482874 CGGTCTGACCAAAATTTATTAGG - Intergenic
1197364714 X:125549461-125549483 TGGTCTGACCAAAATTTATTAGG + Intergenic
1197473977 X:126897150-126897172 CGGTCTGACCAAAATTTATTAGG + Intergenic
1197630664 X:128853953-128853975 CGGTCTGACCAAAGTTTATTAGG - Intergenic
1197938540 X:131764839-131764861 CAGTCTGACCAAAATTTATTAGG - Intergenic
1198023206 X:132679635-132679657 CAGTCTGACCAAAATTTATTAGG + Intronic
1198072675 X:133164956-133164978 CAGTCTGACCAAAATTTATTGGG + Intergenic
1198912455 X:141629653-141629675 CGGTCTGACCAAAATTTATTAGG - Intronic
1199321282 X:146442225-146442247 CAGTCAGGCCAAAATTTATTAGG - Intergenic
1199337729 X:146640184-146640206 CGGTCTGACCAAAATTTATCAGG - Intergenic
1199374982 X:147097673-147097695 CAGTCTGACCAAAATTTATTGGG - Intergenic
1199476998 X:148256939-148256961 CAGTCTGACCAAAATTTGTTAGG + Intergenic
1199536449 X:148907804-148907826 CAGTCTGACCAAAATTTATTAGG + Intronic
1199561562 X:149169015-149169037 TGGTCTGACCAAAATTTATTAGG + Intergenic
1199604325 X:149564625-149564647 CAGTCTGACCAAAATTTATTAGG - Intergenic
1199884204 X:152002966-152002988 AAATCTGACCAAAATTTATTAGG - Intergenic
1200016289 X:153166137-153166159 TGGTCTGACCAAAATTGATTAGG - Intergenic
1200356413 X:155556727-155556749 CGGTCTGACCAAAATTTATTAGG + Intronic
1200541574 Y:4463979-4464001 CGGTCTGACCAAAATTTATTAGG - Intergenic
1200713021 Y:6506289-6506311 CGGTCTGACCAAAATTTATTAGG + Intergenic
1201020899 Y:9655751-9655773 CGGTCTGACCAAAATTTATTAGG - Intergenic
1201427867 Y:13874234-13874256 CAGTCTGACCAAAATTTATTAGG - Intergenic
1201478480 Y:14410706-14410728 CGGTCTGACCAAAATTTATTAGG + Intergenic
1201768729 Y:17597026-17597048 CGGTCTGACCAAAATTTATTAGG - Intergenic
1201778031 Y:17687754-17687776 CAGTCTGACTAAAATTTACTAGG - Intergenic
1201823527 Y:18218238-18218260 CAGTCTGACTAAAATTTACTAGG + Intergenic
1201832825 Y:18308959-18308981 CGGTCTGACCAAAATTTATTAGG + Intergenic
1201913177 Y:19154322-19154344 TGGTCTGATGAAAATTTGTTAGG - Intergenic
1201974036 Y:19829167-19829189 CGATCTGACCAAAATTTATTAGG + Intergenic
1202132716 Y:21628433-21628455 CGGTCTGACCAAAATTTATTAGG + Intergenic
1202328783 Y:23722618-23722640 CAGTCTGACCAAAATTTATTAGG - Intergenic
1202346290 Y:23931570-23931592 CGGTCTGACCAAAATTTATTAGG + Intergenic
1202524481 Y:25738520-25738542 CGGTCTGACCAAAATTTATTAGG - Intergenic
1202541988 Y:25947436-25947458 CAGTCTGACCAAAATTTATTAGG + Intergenic