ID: 1084345827

View in Genome Browser
Species Human (GRCh38)
Location 11:68548213-68548235
Sequence AATTCTGACCTGCTGTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084345826_1084345827 5 Left 1084345826 11:68548185-68548207 CCAGGCAAGATGTGCTGAATGTG 0: 1
1: 0
2: 0
3: 24
4: 467
Right 1084345827 11:68548213-68548235 AATTCTGACCTGCTGTTGACTGG 0: 1
1: 0
2: 0
3: 12
4: 144
1084345825_1084345827 6 Left 1084345825 11:68548184-68548206 CCCAGGCAAGATGTGCTGAATGT 0: 1
1: 0
2: 2
3: 15
4: 149
Right 1084345827 11:68548213-68548235 AATTCTGACCTGCTGTTGACTGG 0: 1
1: 0
2: 0
3: 12
4: 144
1084345824_1084345827 12 Left 1084345824 11:68548178-68548200 CCACAGCCCAGGCAAGATGTGCT 0: 1
1: 0
2: 3
3: 18
4: 265
Right 1084345827 11:68548213-68548235 AATTCTGACCTGCTGTTGACTGG 0: 1
1: 0
2: 0
3: 12
4: 144
1084345823_1084345827 15 Left 1084345823 11:68548175-68548197 CCTCCACAGCCCAGGCAAGATGT 0: 1
1: 0
2: 3
3: 31
4: 228
Right 1084345827 11:68548213-68548235 AATTCTGACCTGCTGTTGACTGG 0: 1
1: 0
2: 0
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084345827 Original CRISPR AATTCTGACCTGCTGTTGAC TGG Intronic
900940599 1:5796168-5796190 GATTCAGCCCTGCTGATGACTGG - Intergenic
907167927 1:52431268-52431290 AATACTGAGCTGGTGGTGACTGG + Exonic
908444112 1:64185500-64185522 AAATGTGGCCTGTTGTTGACTGG + Intergenic
909349114 1:74628566-74628588 ACTTGTAACCTACTGTTGACTGG - Intronic
909644612 1:77903043-77903065 AATTCTCACCTGGGCTTGACAGG - Intronic
910128892 1:83879532-83879554 GATTCTGATCTGCCTTTGACTGG + Intronic
913053958 1:115140518-115140540 AAGCCTGGCCTGCTCTTGACTGG - Intergenic
916919786 1:169452301-169452323 ATATCAAACCTGCTGTTGACAGG + Intronic
918254307 1:182734789-182734811 ATTGCTGACCTTCTATTGACTGG - Intergenic
918720317 1:187844183-187844205 AATTCTCAGCTTCAGTTGACTGG - Intergenic
920242160 1:204561050-204561072 AATTCTGAATTGCCTTTGACAGG - Intergenic
923094479 1:230763764-230763786 AATTCTGTCCTGCTGATTTCAGG - Intronic
1063334268 10:5196175-5196197 AATTCTGACATGATGTTTATTGG - Intronic
1065023461 10:21519125-21519147 AATTCTGACCTGTGGTGAACAGG - Exonic
1067354884 10:45514924-45514946 AATACTGACCTGCTGATCACAGG - Intronic
1069782321 10:70964736-70964758 ATCTCTGACCTGCTGTTTCCTGG + Intergenic
1071013900 10:80971733-80971755 AATTCTGCCCTGCTGTTCTGTGG - Intergenic
1073706108 10:105986378-105986400 AATATTGAGTTGCTGTTGACAGG - Intergenic
1073722916 10:106194622-106194644 AATTCTGACGGACTGTTGTCTGG - Intergenic
1075416393 10:122267670-122267692 AATTCTGACCTGGTTCTGACTGG - Intergenic
1075844047 10:125530682-125530704 AACTCTGCCCTGCTGCTGACAGG - Intergenic
1078641342 11:13099401-13099423 ACATCTGACCTGCTGATGACTGG - Intergenic
1081561346 11:44219970-44219992 AAGTCTGACCTAGTGATGACTGG + Intronic
1084345827 11:68548213-68548235 AATTCTGACCTGCTGTTGACTGG + Intronic
1088272692 11:108051112-108051134 AAATTTGATCTGATGTTGACAGG + Intronic
1088767195 11:112994218-112994240 TATTCTGTCCTGCTGATTACAGG + Intronic
1088861405 11:113803216-113803238 AATGCTGCCCTGCTGATGAAGGG - Exonic
1098915699 12:76254778-76254800 TATTTTGAACTGCTGTTGACAGG + Intergenic
1102436131 12:112925363-112925385 AATACTGGCCTGCGGTTGGCTGG - Intronic
1106615303 13:31321362-31321384 GATTCTGACTTGCTGTTAAAAGG - Intronic
1108161298 13:47642691-47642713 ATTTCAGACCTGCTGATGAGGGG - Intergenic
1109134147 13:58625772-58625794 CCTTCTGCCCTGCTGCTGACAGG + Intergenic
1111063928 13:83065172-83065194 CATCCTGACCTTCTGTTCACAGG + Intergenic
1112942589 13:104883271-104883293 AATTCTAACATGCAGTTTACAGG - Intergenic
1113242872 13:108359267-108359289 ATTTCTGACCTACTGTTGGGAGG - Intergenic
1115697470 14:35914727-35914749 ACTAATAACCTGCTGTTGACTGG + Intronic
1115885660 14:37968995-37969017 AATTCTGTCATCCTGTTAACAGG - Intronic
1118177317 14:63454596-63454618 ATGTCTGACCTGCTGTTTGCGGG - Intronic
1123486917 15:20749094-20749116 AATACTAATATGCTGTTGACGGG + Intergenic
1127792248 15:62408418-62408440 AATTCTGAGCTGCTGGTCAGAGG + Intronic
1130924761 15:88376734-88376756 AGTTCTGAGCTACTGTTGCCAGG + Intergenic
1202951724 15_KI270727v1_random:45277-45299 AATACTAATATGCTGTTGACGGG + Intergenic
1137982480 16:53081566-53081588 CCTGCTGACCTGCTGTTGGCAGG - Intronic
1138414491 16:56863575-56863597 AATTCTGACCTGCTGAGCTCTGG + Intergenic
1139570880 16:67811327-67811349 AATTCTGAGAAGCTGTTGAATGG - Intronic
1140153560 16:72398751-72398773 AACTCTTACCTACTGTTGATGGG + Intergenic
1150929259 17:69566313-69566335 AATTCTGTCCTGATGAAGACAGG + Intergenic
1151113409 17:71705271-71705293 ATTTTTGTCCTGCCGTTGACTGG - Intergenic
1151267005 17:72964219-72964241 AATTCTGTCCTGCAGTGGTCTGG - Intronic
1151333935 17:73428952-73428974 ATTTCTGACCTGCAGTTCACTGG + Intronic
1152408977 17:80112501-80112523 AGCTCTGCCCTGCTGGTGACAGG + Intergenic
1152535187 17:80946632-80946654 AATTCTGACGTGCTGTAGCTTGG - Intronic
1152564756 17:81095343-81095365 AACTGTGACCTGCTGTTGGACGG - Intronic
1152630074 17:81406949-81406971 CATTCTGACCTGCTGTGGCGAGG + Intronic
1154047769 18:10922951-10922973 AATTCTGAGCTGCCTTTGAATGG + Intronic
1154173164 18:12065330-12065352 AATTCTGAGCTGCCTTTGAACGG - Intergenic
1154474001 18:14734591-14734613 AATCCTTACCTGTTGTGGACAGG + Intronic
1155135414 18:22986923-22986945 AATTCTGTTCTGCTGCTGCCAGG + Intronic
1155363343 18:25025842-25025864 AATTCTCACATGCTGTTGGTGGG - Intergenic
1156593818 18:38522890-38522912 AAATCTTACCAGCTGCTGACAGG + Intergenic
1157445561 18:47744150-47744172 ACTAATGGCCTGCTGTTGACTGG - Intergenic
1157462364 18:47910827-47910849 ACTTACGACCTACTGTTGACTGG - Intronic
1158220273 18:55143499-55143521 TTTTCTGAACTGCTGATGACGGG - Intergenic
1159603446 18:70450830-70450852 AATACTGACCTCCTGTGGCCAGG + Intergenic
1160013687 18:75125355-75125377 ATTTCTTACCTGCCGTTCACTGG + Intergenic
1161233032 19:3184800-3184822 AATTCTCACATGCTGCTGGCAGG + Intergenic
1165278829 19:34779674-34779696 AAATCTCACTTGCTGTTGAAAGG + Intergenic
1165680663 19:37771945-37771967 AATTCAGACCTGCTGAGGAATGG + Intronic
927421745 2:22940852-22940874 AAATCTGTTCAGCTGTTGACAGG + Intergenic
929577118 2:43058894-43058916 AATTCTGACTTCCTTTTGGCTGG - Intergenic
932084122 2:68742826-68742848 CATGCTGATCTGCAGTTGACTGG + Intronic
932292066 2:70590299-70590321 AAGTCTTACCTGGGGTTGACTGG - Intergenic
933048527 2:77571582-77571604 AATTCTTATTTGCTGTTGGCAGG - Intronic
933485316 2:82914441-82914463 ACTCATAACCTGCTGTTGACTGG + Intergenic
934028820 2:88023207-88023229 ACTAATGGCCTGCTGTTGACTGG + Intergenic
935757957 2:106291906-106291928 ACTGCTAACCTACTGTTGACCGG + Intergenic
938405177 2:131028503-131028525 ACTTCTGAACTCCTGTTGTCAGG - Intronic
938991717 2:136636442-136636464 AATTCTGATCTGATGTGGAAAGG + Intergenic
946455461 2:219822010-219822032 TATTATGACCTGCAGTTGAAAGG + Intergenic
948637034 2:239345178-239345200 GATTCTGAGCTTCTGGTGACAGG - Intronic
948815709 2:240509391-240509413 AATCCTAACCTGCTGTGGAGTGG - Exonic
1170418414 20:16168865-16168887 AACTCTTACCTGGTTTTGACTGG - Intergenic
1170507783 20:17046416-17046438 AATCCTGACCTGTAGATGACTGG - Intergenic
1170637503 20:18120405-18120427 AATTCTATCCTGCTGTTGTTGGG - Intergenic
1172228437 20:33320890-33320912 AATTCTGAACTGCAGCTGATTGG + Intergenic
1172487218 20:35305524-35305546 AATTCTGATACTCTGTTGACTGG - Intronic
1173347358 20:42213252-42213274 AATTCAGACCTGCTGAAGAGTGG - Intronic
1173401149 20:42727098-42727120 AAGACTGCCCTGCTGCTGACAGG + Intronic
1174084762 20:47999097-47999119 AATTTGGACCTGCTGCTGAGAGG - Intergenic
1174129147 20:48329451-48329473 TGTTCTGACGTTCTGTTGACGGG + Intergenic
1174970360 20:55268164-55268186 AATTCTGCTCTGCTGTTTAAAGG - Intergenic
1175082370 20:56431540-56431562 AATTTTGACCTGCTGTCTTCAGG - Intronic
1178162100 21:29929697-29929719 AACTCTTACATGCTGTTGGCAGG + Intronic
1182027180 22:27129309-27129331 GATGCTGACCTGCTGCTTACGGG + Intergenic
1185167573 22:49271134-49271156 AAATCTTGCCTGCTGTTGGCTGG - Intergenic
949750379 3:7345595-7345617 TATTCTGACTTGCTGATGCCCGG + Intronic
949824805 3:8154289-8154311 AATCCTGACCTGAGGTTGAAAGG + Intergenic
949908398 3:8878805-8878827 CATTCTGAGCTGATGTTGATGGG + Exonic
950081098 3:10222700-10222722 TATTTTGACCTTTTGTTGACAGG - Exonic
950562835 3:13745369-13745391 AATTCTGACCTCCTGCAGGCAGG + Intergenic
951149690 3:19274485-19274507 AATTCTTACCTACAGTTGAAAGG - Intronic
952239070 3:31511247-31511269 AATGCTGCTCAGCTGTTGACAGG - Intergenic
955612724 3:60775240-60775262 AATTTTTACCTGGTGTTTACAGG - Intronic
955846199 3:63165401-63165423 AATTATTACCTTCTGTTGACTGG - Intergenic
956755605 3:72383102-72383124 AATGCTCACCTGTTGTTGAGGGG - Intronic
959270245 3:104198278-104198300 AACCCTTACCCGCTGTTGACAGG - Intergenic
962878345 3:139553217-139553239 ACTTCTGGCCTGCTGATGGCAGG + Intergenic
963926051 3:150952057-150952079 GATGCTGACCTCCTGTTGTCAGG + Intronic
965879469 3:173371075-173371097 AATTGAGAACTGCTGTGGACTGG - Intergenic
967477435 3:189937983-189938005 AATTCTCACCAGATGTTAACTGG - Intergenic
968076963 3:195821296-195821318 AAGGTTGACCTGCTATTGACTGG + Intergenic
970172923 4:13307002-13307024 AATGCTGTCCTGCTGTGGCCCGG - Intergenic
972602837 4:40587803-40587825 AATGCTGACATGCTGGTTACTGG + Intronic
973968529 4:56187983-56188005 AATTCTGAACTGCAGTTCAGAGG + Intronic
975690269 4:76956152-76956174 TACTCTGACCTGCTGTTGGAGGG + Intronic
980974379 4:139597057-139597079 AGTCCTGAGCTGCTGTTGCCTGG - Intronic
986173671 5:5333934-5333956 AACTCTGTCCTGCTGCTGAGGGG - Intergenic
986226631 5:5821651-5821673 TATTGTGACCTGCAGTTGAGGGG + Intergenic
990266066 5:54077152-54077174 AACTCTGACCTCCTTTTGGCTGG + Intronic
995524244 5:113038092-113038114 AATTATGACCTGCTGACGAGAGG + Intronic
995923965 5:117346738-117346760 AATTCTTCCTTGCTTTTGACTGG + Intergenic
997317264 5:132947454-132947476 AATTCTGACCTCCACTTGAATGG - Intronic
1001357300 5:171041070-171041092 AGTTCTAGCCTGTTGTTGACAGG + Intronic
1003436854 6:6098293-6098315 AATGCTTACCTACTGTTGACGGG - Intergenic
1004191360 6:13466597-13466619 ATTTCTGACCTGCAGTTGCTTGG + Intronic
1004551333 6:16650855-16650877 ATTTCTGACATGCTGTTGTGTGG - Intronic
1004622369 6:17342350-17342372 ATTTCTAACTTGCTGTTGATGGG - Intergenic
1005496763 6:26394406-26394428 AATTCTCTCCTTCTGTTGGCTGG + Exonic
1009662965 6:66637097-66637119 AGTTCTTACCTCCTGTTTACTGG - Intergenic
1011786970 6:90857852-90857874 AATTCAGACCTGCTCCAGACTGG - Intergenic
1012537485 6:100316581-100316603 ACTTCTTACTAGCTGTTGACTGG + Intergenic
1012951222 6:105520029-105520051 AATTCTAACCTGAAATTGACTGG + Intergenic
1013085410 6:106852658-106852680 CATTCCAACCAGCTGTTGACTGG - Intergenic
1013858273 6:114602241-114602263 AATTCTACCCTGCCATTGACTGG - Intergenic
1017452356 6:154565894-154565916 GAGTTTGACCTGCTGTTTACAGG + Intergenic
1021062846 7:16134527-16134549 ACTACTAACCTACTGTTGACCGG - Intronic
1021655378 7:22869119-22869141 ACATATGACCTGCTGTTCACCGG + Intergenic
1023291813 7:38675950-38675972 AATTCTGCCTTGCTGGTGCCTGG - Intergenic
1024000997 7:45189348-45189370 AACTCTGGCTTCCTGTTGACAGG + Intergenic
1024714231 7:52056683-52056705 AATTCTAACCTGCTGTCAGCTGG - Intergenic
1024898553 7:54290099-54290121 AACTCTTAAATGCTGTTGACAGG + Intergenic
1028298468 7:89166330-89166352 ACTAATAACCTGCTGTTGACAGG + Intronic
1031805130 7:126298505-126298527 AATTCTGAGCTGCTGTAGAAAGG + Intergenic
1035427865 7:158793538-158793560 ACGTCTTACCTGCTGTTGATTGG - Intronic
1042046988 8:64664257-64664279 AATGCTGAGCTCCTGTTGGCTGG - Intronic
1042520612 8:69707598-69707620 AATTCTGAGCTGCGGCTGACAGG + Intronic
1042705574 8:71662972-71662994 AATTCTGGAGTGCTGTTCACAGG + Intergenic
1043364563 8:79517575-79517597 ACTAATGGCCTGCTGTTGACTGG + Intergenic
1047148836 8:122237651-122237673 AGTTATGACCTGCTGTACACAGG - Intergenic
1051061023 9:13045078-13045100 AATTCTGACTTTCTATTGCCTGG + Intergenic
1051718861 9:20014262-20014284 AATTCTTACATGCTGTTGGTGGG + Intergenic
1052448977 9:28601814-28601836 AGTTCTGACCTGCTGCAGACAGG - Intronic
1056905462 9:90643848-90643870 AATTCTGCCCTGCTATTCACAGG + Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1186837442 X:13451697-13451719 AGTTCTGTCCTTCTGTTGAGTGG + Intergenic
1189665761 X:43353179-43353201 TATTCTGACCTTCAGTGGACTGG - Intergenic
1193371409 X:80701655-80701677 AATTCTGACCTAGTATTGATTGG - Intronic