ID: 1084351232

View in Genome Browser
Species Human (GRCh38)
Location 11:68601293-68601315
Sequence CTCAGAGACGTGCACACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 251}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084351232_1084351237 -7 Left 1084351232 11:68601293-68601315 CCCTCTGTGTGCACGTCTCTGAG 0: 1
1: 0
2: 2
3: 26
4: 251
Right 1084351237 11:68601309-68601331 CTCTGAGTTTGTGGGAATGAGGG 0: 1
1: 0
2: 1
3: 27
4: 284
1084351232_1084351236 -8 Left 1084351232 11:68601293-68601315 CCCTCTGTGTGCACGTCTCTGAG 0: 1
1: 0
2: 2
3: 26
4: 251
Right 1084351236 11:68601308-68601330 TCTCTGAGTTTGTGGGAATGAGG 0: 1
1: 0
2: 7
3: 29
4: 276
1084351232_1084351238 3 Left 1084351232 11:68601293-68601315 CCCTCTGTGTGCACGTCTCTGAG 0: 1
1: 0
2: 2
3: 26
4: 251
Right 1084351238 11:68601319-68601341 GTGGGAATGAGGGATAAAAGAGG 0: 1
1: 0
2: 0
3: 38
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084351232 Original CRISPR CTCAGAGACGTGCACACAGA GGG (reversed) Intronic
900850973 1:5142847-5142869 CTCAGAGAAGTGAAGACTGAGGG + Intergenic
900926161 1:5707497-5707519 ATCAGAGACACACACACAGAGGG + Intergenic
900933270 1:5749866-5749888 TCCAGAGACATACACACAGAGGG - Intergenic
902199026 1:14820188-14820210 TTCTGTGACGTTCACACAGAGGG + Intronic
902232583 1:15037096-15037118 ATGAGAGAGGTGGACACAGAAGG - Intronic
903781268 1:25821337-25821359 CACAGAGCCTGGCACACAGAGGG + Intronic
904172831 1:28603685-28603707 CTCAGAGACCTGCAGTCACAAGG + Intronic
905340888 1:37276552-37276574 CTCAGGGAGGTGCAGGCAGAGGG + Intergenic
905475609 1:38225444-38225466 CACAGACACATACACACAGAGGG - Intergenic
906535678 1:46549859-46549881 GTCACAGACGAGCACACAAAGGG + Intronic
906724888 1:48037014-48037036 CTCAGAGACTGGCAGTCAGAGGG - Intergenic
907548860 1:55287312-55287334 CTCAGAGAAGAGGAAACAGAAGG + Intergenic
910998218 1:93131979-93132001 CTGAGAGACTTGTACAGAGAGGG + Intronic
911290054 1:96046416-96046438 ACCAGAGACGTGTAGACAGAAGG + Intergenic
915744297 1:158144291-158144313 CTCAGAGACTTGCCTACTGATGG - Intergenic
919921766 1:202170234-202170256 CACAGAGTCCAGCACACAGAAGG - Intergenic
920076493 1:203341109-203341131 CTCAGAGATGTGAAAGCAGAGGG + Exonic
920170628 1:204070348-204070370 CTCAGGGACTTGCAAAGAGATGG + Intergenic
920535763 1:206735682-206735704 GTCAGAGAAGTGACCACAGAAGG - Intergenic
920594562 1:207255834-207255856 GTCAGAGACCTTCACAGAGAGGG - Intergenic
923063808 1:230500136-230500158 CTGAGAGACCTGAACACAGAGGG + Intergenic
923212688 1:231819089-231819111 CTCTGAGATTTGCACCCAGAGGG + Exonic
1063124558 10:3127245-3127267 CACTGAGACGAGCACACAGTCGG + Intronic
1063578503 10:7283531-7283553 CTGAGAGATGGGTACACAGATGG + Intronic
1068712388 10:60149142-60149164 CCCAGAGATGTGTACACACAAGG + Intronic
1074281894 10:112059907-112059929 ATAAGAGACTTGGACACAGAGGG - Intergenic
1074588521 10:114790602-114790624 CTCAGGGCCCTGCACTCAGAAGG - Intergenic
1074864433 10:117536658-117536680 CAGACAGACGTACACACAGACGG - Intergenic
1074991513 10:118712703-118712725 CTGAGAGCTGTGCACACAGTGGG - Intronic
1075567007 10:123512236-123512258 CTCAGTGAGGTGCATGCAGATGG + Intergenic
1075671750 10:124267906-124267928 ATCAGAGGCCTGGACACAGATGG + Intergenic
1076663316 10:132069579-132069601 CACAGAGACCTGCACGCAGGGGG - Intergenic
1077232396 11:1463679-1463701 CTCAGAGCCCAGGACACAGAGGG + Intergenic
1077979204 11:7282573-7282595 CTCAGAGAGGTGCACACTAGAGG - Intronic
1078901769 11:15649299-15649321 CTCAGCTACTTGCACACAGAAGG - Intergenic
1079109882 11:17599437-17599459 CTCAAAGACTGGCACACAGTAGG - Intronic
1084351232 11:68601293-68601315 CTCAGAGACGTGCACACAGAGGG - Intronic
1084376901 11:68783784-68783806 CTCAGAGCTGTGCACACTCAGGG - Intronic
1085164675 11:74387316-74387338 CTCAGAGAAGTGTAGAGAGAGGG - Intronic
1085722281 11:78923171-78923193 CCCAGAGCCCTGCACTCAGAGGG + Intronic
1085925429 11:81013947-81013969 TTCAGGGACATGCTCACAGAGGG + Intergenic
1088642154 11:111883247-111883269 CTCAGTGACCGGCACATAGAAGG + Intronic
1090266754 11:125358263-125358285 CACATAGATGTGCACACACAGGG + Intronic
1091165787 11:133474917-133474939 ACCAGTGACGTGCACACATATGG + Intronic
1095253986 12:40011895-40011917 CCCAGAGCCCTGCACTCAGAAGG - Intronic
1095416454 12:41982464-41982486 CGCAGAGACCTGAACTCAGAAGG + Intergenic
1098314619 12:69180385-69180407 CACAGAGCCTGGCACACAGAAGG + Intergenic
1098635504 12:72779816-72779838 CTGAGAGAGGAGCACACAGAAGG - Intergenic
1102526333 12:113514942-113514964 CTCAGGGACCAGCGCACAGAGGG + Intergenic
1102561191 12:113763304-113763326 CACACACACGTGCACACACACGG - Intergenic
1102561192 12:113763332-113763354 CACACAGACATGCACACACACGG - Intergenic
1102610284 12:114105837-114105859 CTCACAGATGTGACCACAGATGG - Intergenic
1104810838 12:131619428-131619450 CACACAGATGTGCACACACATGG + Intergenic
1106100976 13:26695047-26695069 CTCAGGGGCGTGCAGACAGCAGG - Intergenic
1107861172 13:44662198-44662220 GGCACAGACATGCACACAGAAGG + Intergenic
1111964892 13:94851032-94851054 CTCAGAGTCAGGCACACAGAAGG + Intergenic
1113260700 13:108559190-108559212 CACAGAGACGTACACAGAGAGGG + Intergenic
1113807746 13:113119486-113119508 CACAGAGATATGCACACACACGG + Exonic
1115307158 14:31944879-31944901 CTCGGAGACGTGCAGACTAACGG - Exonic
1117553373 14:56858675-56858697 GCCAGAGACGTGCACAGAGCTGG + Intergenic
1118056092 14:62081206-62081228 CTCAGCCACCTGCACCCAGAAGG + Exonic
1119906186 14:78304216-78304238 CTCTGACACTTGCACACACAGGG - Intronic
1121109780 14:91304159-91304181 CGCATAGACGGGCACTCAGAGGG + Intronic
1121272907 14:92649887-92649909 CTCAGAGGGGTGCACACAGCTGG + Intronic
1122271799 14:100571611-100571633 CACAGAGACTGGCACACAGTAGG + Intronic
1122938180 14:104969544-104969566 CTCAGAGCCTGGCACACAGTAGG + Intronic
1124339909 15:28884380-28884402 CCCACACACGTTCACACAGATGG + Intergenic
1124421582 15:29527622-29527644 ATCAGAGATGTGCCAACAGAAGG + Intronic
1124895429 15:33772111-33772133 CTGAGTGACGTGCTCAAAGATGG - Exonic
1125585709 15:40817988-40818010 CACAAAAACCTGCACACAGATGG + Intronic
1126053337 15:44707344-44707366 CTCAGAGACGTGCAGGCTTAAGG - Intronic
1127919121 15:63479558-63479580 CTCAGAGACCTGCACTCAGGAGG - Intergenic
1129171352 15:73810089-73810111 CTCAGACACATGGACCCAGACGG + Intergenic
1129607524 15:77032100-77032122 CACAGGGCCTTGCACACAGAAGG + Intronic
1129719014 15:77867634-77867656 AACAGAGACGTGTACACACAGGG - Intergenic
1130149532 15:81300613-81300635 CTCAGACATCTGCACACACATGG - Intronic
1130459916 15:84153230-84153252 AACAGAGACGTGTACACACAGGG + Intergenic
1131796197 15:96019309-96019331 ATCACAGACATCCACACAGAGGG + Intergenic
1132371076 15:101299492-101299514 CTCAGACAAGTGCACAGCGAAGG + Intronic
1133139671 16:3734842-3734864 CTCACAGACGTGCTCTCATATGG + Intronic
1133343554 16:5055091-5055113 CACACAGACGTGTACACACAAGG - Intronic
1133575676 16:7086957-7086979 CTGAGAGCCCTGCACAGAGATGG + Intronic
1133770880 16:8866822-8866844 CACAGAGAAGTGCAAACAGGCGG + Intronic
1133825879 16:9277889-9277911 CTCAGAGGCCAGCACACAGTAGG - Intergenic
1133979096 16:10620253-10620275 CACAGAGACTGGCACACAGCAGG - Intergenic
1134099257 16:11440100-11440122 CTCAGAGATGGGAACAGAGATGG + Intronic
1135062806 16:19285505-19285527 CTCAGAGAAGTGCACACCCAAGG + Intergenic
1136791000 16:32968064-32968086 CACACATACGTGCACACACACGG + Intergenic
1136878813 16:33885868-33885890 CACACATACGTGCACACACACGG - Intergenic
1138438757 16:57021770-57021792 CTCAGTGCTGTGCAAACAGAAGG - Intronic
1139305068 16:65978433-65978455 CTCAGAGGTGTGGGCACAGAAGG + Intergenic
1139369436 16:66457669-66457691 CTCAGAGAGGAGGACACAGAAGG - Intronic
1140019230 16:71221443-71221465 CTCAGAGAGGTCCTCAGAGAAGG - Intronic
1141172868 16:81702146-81702168 CTCACACATGTGTACACAGAAGG + Intronic
1141573517 16:84948960-84948982 CACAGACACATGCACACACACGG - Intergenic
1141678661 16:85531210-85531232 CTCAGAGCTGTGCCCACAGTGGG - Intergenic
1143779044 17:9219825-9219847 CACACACACGTGCACACACACGG - Intronic
1147439103 17:40436615-40436637 CTTAGAGACGCCCCCACAGAGGG - Intergenic
1147536916 17:41327449-41327471 CTCAGTGCTGTGCACACAGGAGG + Intergenic
1148456928 17:47816194-47816216 CTCAGAGACCTGCAGGGAGAGGG + Exonic
1150571842 17:66393628-66393650 CACACACACGTGCACACACATGG - Intronic
1151092731 17:71461346-71461368 CTGAGAGACGTGCACAAATGGGG - Intergenic
1152323188 17:79620332-79620354 CACACAGACATGCACACACACGG + Intergenic
1152718884 17:81912878-81912900 CTGAGCGGCGTGCACACACAGGG + Intronic
1152886153 17:82851569-82851591 CTCAGACACGTGTACAGAAAAGG + Intronic
1154030773 18:10752063-10752085 CTCAGAGACAGCCAGACAGAAGG + Intronic
1154359882 18:13651256-13651278 CAGAGAGACTTGGACACAGACGG - Exonic
1155711859 18:28890983-28891005 CTCAGACACGCACACACACAGGG + Intergenic
1155799804 18:30087272-30087294 CTCAGAAAAGTGCATGCAGAAGG - Intergenic
1156664266 18:39386212-39386234 CTGAGAGAAGTTCACAGAGATGG - Intergenic
1157374963 18:47154059-47154081 TTCAGAGACATGCAAACACAGGG + Intronic
1159021115 18:63143990-63144012 CTCAGAGATATGCACACCTAAGG + Intronic
1160701913 19:511635-511657 CACAGAGCCCTGCACACCGAGGG + Intronic
1160896913 19:1407479-1407501 CTCAGGGACGCACGCACAGACGG + Intergenic
1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG + Intronic
1161219012 19:3109413-3109435 CTCAGAGATGGGCACACTGATGG - Intronic
1161270827 19:3388327-3388349 CTCGGAGCCTGGCACACAGAGGG - Intronic
1164175515 19:22770726-22770748 CACACAGAAGGGCACACAGAAGG + Intronic
1164649332 19:29880799-29880821 CTCAGAGACTGGCCCACGGAGGG + Intergenic
1165074548 19:33273611-33273633 CACAGGGACGTGCCCACACACGG - Intergenic
1165646679 19:37445009-37445031 TTCAGAAACATGCACACACAGGG + Intronic
1166546856 19:43639384-43639406 TTCAGAGACGGGCGGACAGAGGG + Intronic
1167023676 19:46898268-46898290 CTCAGAACCTTACACACAGAGGG - Intergenic
1167633900 19:50642290-50642312 CTCAGAGATGGGCACACAGATGG + Intronic
1167644170 19:50696719-50696741 CACAGTGACATGCACAGAGAGGG + Intronic
1167746828 19:51356582-51356604 CTCAGAGCCAGGCACACAGTGGG - Exonic
924960482 2:30083-30105 TTCACAGACGATCACACAGAAGG + Intergenic
925674225 2:6343240-6343262 CTCAGACAGGTGCACAGAGTCGG + Intergenic
925865576 2:8223401-8223423 CTCAGAGCCTGGCACACAGAGGG - Intergenic
926060076 2:9799752-9799774 CTCAGTGTCTTGCACACAGTGGG + Intergenic
927324145 2:21783711-21783733 CTCAGTGAGTTGCACACAGTAGG - Intergenic
927460083 2:23291419-23291441 CTCACACACTTGCACACACACGG + Intergenic
928102070 2:28444566-28444588 CGGAGAGAGGTGCACACTGAAGG + Intergenic
928200522 2:29245106-29245128 CTCAGTGCCCTGCACACAGTTGG + Intronic
928200531 2:29245171-29245193 CTCAGTGCCCTGCACACAGTAGG + Intronic
928200543 2:29245237-29245259 CTCAGTGCCCTGCACACAGTAGG + Intronic
928200555 2:29245302-29245324 CTCAGTGCCCTGCACACAGTAGG + Intronic
928200562 2:29245335-29245357 CTCAGTGCCCTGCACACAGTAGG + Intronic
928200569 2:29245368-29245390 CTCAGTGCCCTGCACACAGTAGG + Intronic
928200590 2:29245467-29245489 CTCAGTGCCCTGCACACAGTAGG + Intronic
928200612 2:29245597-29245619 CTCAGTGCCCTGCACACAGTAGG + Intronic
928200625 2:29245663-29245685 CTCAGTGCCCTGCACACAGTAGG + Intronic
928200642 2:29245759-29245781 CTCAGTGCCCTGCACACAGTAGG + Intronic
928200654 2:29245825-29245847 CTCAGTGCCTTGCACACAGTTGG + Intronic
928200660 2:29245858-29245880 CTCAGTGCCCTGCACACAGTAGG + Intronic
928395868 2:30942981-30943003 CTCAGAGACAGACACACAGAAGG + Intronic
930055338 2:47247677-47247699 GACAGAGACTTGCACACTGAAGG + Intergenic
930330234 2:49974161-49974183 ATCAGTGCCCTGCACACAGATGG + Intronic
930361950 2:50391870-50391892 TTCAGAGAGGTACATACAGAGGG + Intronic
932189275 2:69725664-69725686 CTCAGAGAAGAGCAAACAGTGGG + Intronic
935350286 2:102146748-102146770 CTCACAGACGTTCATACTGACGG - Intronic
935403798 2:102687172-102687194 CTCCGATCTGTGCACACAGAAGG - Intronic
935951035 2:108328924-108328946 CTCAAAGATGTGTCCACAGATGG - Intergenic
937470605 2:122171009-122171031 ATCAGAGAGGTGCACACTGCTGG + Intergenic
937879297 2:126852975-126852997 CACAGAGACCTGCACATAGTAGG - Intergenic
939684615 2:145183870-145183892 CACAGAAACGAGCACAGAGAGGG + Intergenic
940385095 2:153061796-153061818 TTCAGAGATGTTCACATAGAGGG - Intergenic
941391502 2:164920668-164920690 CTCTGAGTCCTGCACACACAGGG - Intronic
941648258 2:168065319-168065341 CTGAGAGTCGTGCACAGAGAGGG + Exonic
942152888 2:173095642-173095664 ATCAGAGATGTGCAGAAAGATGG + Intronic
947643528 2:231721346-231721368 TTCAGAGACGTGACCACAGTGGG + Intergenic
947860256 2:233353425-233353447 CTCAGAGCAGGGCAGACAGATGG + Intergenic
948018741 2:234712711-234712733 CTCAGAAACTGGCACACAGCCGG + Intergenic
948771238 2:240252257-240252279 CGCTGAGACGTGGGCACAGAAGG + Intergenic
948912759 2:241012736-241012758 GTCACACACGTGCACACACACGG - Intronic
1168902937 20:1380356-1380378 CTCAGATACATGCACTGAGAGGG - Intronic
1169058223 20:2641332-2641354 CTCAGAGACCTCCCCACTGATGG + Exonic
1169141837 20:3230941-3230963 CTCAATGACGAGAACACAGACGG - Exonic
1170583335 20:17715361-17715383 CTCAAGGCCTTGCACACAGATGG + Intronic
1172873608 20:38150878-38150900 CACAGGGCCGGGCACACAGAAGG + Intronic
1174619840 20:51865537-51865559 CTCAGAAAAGTGGTCACAGATGG - Intergenic
1175534746 20:59701435-59701457 CCCAGAGACTGGCAGACAGATGG - Intronic
1175677429 20:60958825-60958847 CTCAAAGCTGTGCAAACAGAGGG - Intergenic
1175748197 20:61476375-61476397 CACACACACGTGCACACACACGG - Intronic
1175824764 20:61930900-61930922 CTCACAGCCCTGCCCACAGAGGG - Intronic
1176094962 20:63336447-63336469 CGCACACACGTGCACACACAGGG - Intergenic
1176310208 21:5145326-5145348 TTCAGAGCCCTGCACACAGCAGG + Intronic
1177569193 21:22864402-22864424 CTTAAAGACATTCACACAGAAGG + Intergenic
1179846848 21:44116710-44116732 TTCAGAGCCCTGCACACAGCAGG - Intronic
1180102542 21:45595774-45595796 CACAGATACATGCAGACAGACGG - Intergenic
1181470432 22:23135854-23135876 CTCAGAGACGTGACCTCAGAAGG - Intronic
1181521253 22:23449943-23449965 CTGAGGGTCGTGCACACAGCAGG + Intergenic
1183065425 22:35359540-35359562 CTCAGAGCCTAGCACACAGTAGG - Intergenic
1184087567 22:42274369-42274391 CTCAGAGACTTGCACAAAGCAGG - Intronic
1185102303 22:48847794-48847816 CTCAGAAACCAGCACAGAGATGG + Intronic
952422116 3:33141949-33141971 CCCAGAGTCCAGCACACAGAAGG - Intronic
953996315 3:47522663-47522685 CTCAGAGACGGGCACACTCAGGG + Intergenic
954159643 3:48711707-48711729 CTCAGCAACGTGCAAAAAGATGG + Intronic
954422911 3:50428018-50428040 CTCGGAGAGGTGCAGGCAGAAGG - Intronic
954424285 3:50435170-50435192 CGCAGGCACGTGCACACAAACGG - Intronic
960046111 3:113200153-113200175 CACAGAGCCTTGCACTCAGAAGG + Intergenic
962755036 3:138460233-138460255 CTCAGAGAAGGTCACACAGATGG + Intronic
963082253 3:141404798-141404820 CACAGAGCTGTGCCCACAGAAGG - Intronic
963870997 3:150413041-150413063 CTGAGAGAGGTGTGCACAGAAGG - Intronic
966080025 3:175989388-175989410 CTCAGTGACCTGGGCACAGAAGG - Intergenic
967007085 3:185394299-185394321 CTCAGGGACTTGTACCCAGAGGG - Intronic
967333864 3:188320783-188320805 CTCTGAGAAGAGCACAGAGAAGG - Intronic
968844073 4:3030145-3030167 CCCAGAGCCAGGCACACAGAAGG - Intronic
968967377 4:3775920-3775942 CACAGAGGCCTGCACACAGCGGG + Intergenic
969297712 4:6279540-6279562 CTCAGAGAAGTGCACAGAGCAGG + Intronic
973736032 4:53872470-53872492 CTCAGTGATGGGCACACAGTTGG + Intronic
977428320 4:96898683-96898705 CACAAAAACCTGCACACAGATGG + Intergenic
977715771 4:100181862-100181884 GACACAGACATGCACACAGAGGG + Intergenic
979982999 4:127279507-127279529 CTCAGAGACAGTCAGACAGAGGG - Intergenic
980115059 4:128671538-128671560 CACAGTGACTTGCACACAGTAGG - Intergenic
982390207 4:154855640-154855662 CTCAGAGACCTGAACAATGAAGG - Intergenic
984481458 4:180308384-180308406 CTCACACACGTACACACAAATGG + Intergenic
985330285 4:188824291-188824313 CACAGGGACGCACACACAGAGGG + Intergenic
986174696 5:5341782-5341804 CTCAGTGAGGTGGTCACAGAGGG - Intergenic
986441740 5:7788690-7788712 CACACACACATGCACACAGATGG - Intronic
986749840 5:10776993-10777015 CTCAGAGCCTTGCATACAGTGGG - Intergenic
986846685 5:11764404-11764426 CTCAGAGACATGCCCACAATGGG - Intronic
989202745 5:38781433-38781455 CCCAGAGACTAGCACACAGTAGG - Intergenic
991984034 5:72264618-72264640 CACACACATGTGCACACAGAGGG + Intronic
992127728 5:73659087-73659109 CTCAAAGATGGGAACACAGAAGG - Intronic
992189347 5:74275941-74275963 CCCAGAGCCGAGAACACAGAGGG - Intergenic
997626252 5:135332842-135332864 CTCAGAGACTGAAACACAGAGGG - Intronic
997635248 5:135399528-135399550 CTCAGAGCCAGGCACACAGTAGG - Exonic
998112628 5:139513941-139513963 CTCAGGGTTGTGCAGACAGAAGG + Intergenic
999135713 5:149317570-149317592 CTCAGAGAAATGCACACCCAAGG + Intronic
1001941780 5:175744960-175744982 CTCAGAGTCTTGCACAAAGAAGG - Intergenic
1002328041 5:178422549-178422571 CTCAGGGACGTGCAGACAGCGGG - Intronic
1003023688 6:2534415-2534437 CACAGAGATGTGCACACAGGAGG - Intergenic
1003330762 6:5126513-5126535 CTCAGAAACGTGCACAAAGATGG + Intronic
1004481512 6:16023865-16023887 CTCAGAGACCTGCATAATGAGGG + Intergenic
1006447706 6:34089104-34089126 CCCAGAGACCAGCACACAGTTGG + Intronic
1009591055 6:65671770-65671792 CTCAGAAATGTGCAATCAGAAGG + Intronic
1015624824 6:135169913-135169935 CTCTGAGACAGGCAGACAGAGGG + Intergenic
1016832071 6:148444173-148444195 GACAGAGGCGTGCACACAGGGGG - Intronic
1017620771 6:156294108-156294130 CTCAGAGACGGGGAGACATAGGG + Intergenic
1017809641 6:157975674-157975696 CGCAGACATGTGCCCACAGAGGG - Intergenic
1018291170 6:162293631-162293653 CTCAGAGATGGGGACACAGAGGG + Intronic
1018417844 6:163616843-163616865 CTGAGAGAGATGCACACAGGAGG - Intergenic
1019205472 6:170358044-170358066 CACACAGAGGTGCACACACATGG - Intronic
1019590084 7:1826535-1826557 CTGAGGGTCGTGCACACAGCAGG - Intronic
1019884233 7:3890117-3890139 CTCAGAGTCCTGCAGACAGTTGG + Intronic
1019898624 7:4002215-4002237 CTCAGAGACGGGCACAGCCAGGG - Intronic
1020968922 7:14908370-14908392 CACAGAGCCCTGCACACAGAAGG + Intronic
1021126385 7:16854881-16854903 TACAGAGACATGCATACAGAAGG - Intergenic
1021492726 7:21236982-21237004 CTCGTAGAGGTGCACACAGCTGG - Intergenic
1023654490 7:42406328-42406350 CTCAGAAGCCTGCACCCAGAAGG - Intergenic
1024183265 7:46919290-46919312 TTCAGTGGTGTGCACACAGATGG - Intergenic
1026388117 7:69872125-69872147 CTCAGGGCCCTGCACTCAGAAGG - Intronic
1029288578 7:99484210-99484232 CTCAGCGTCTGGCACACAGAAGG - Intronic
1029513726 7:101012975-101012997 CTCAGAGCAATGCACCCAGAAGG + Exonic
1029548528 7:101223923-101223945 TTCAGACACCTGCAGACAGAGGG - Exonic
1031350177 7:120721747-120721769 AGCAGAGAGGTGCACACATAAGG + Intronic
1033048849 7:137986119-137986141 CTCAGAAAGGTGCTCACAGTAGG + Intronic
1033643015 7:143280695-143280717 CACAGAGACAAGCACACAGTGGG + Intronic
1033741158 7:144276830-144276852 CTCTGAGAAGAACACACAGAGGG + Intergenic
1033752747 7:144372784-144372806 CTCTGAGAAGAACACACAGAGGG - Intronic
1034346211 7:150386842-150386864 AGCAGAGCCGGGCACACAGAGGG - Intronic
1034899160 7:154896821-154896843 CTCTGCCACGTGCAGACAGAGGG - Intergenic
1034934377 7:155189213-155189235 GTCAGAGCCGTGGACACTGACGG + Intergenic
1034956373 7:155337972-155337994 CACAGAGACAGACACACAGAGGG + Intergenic
1035367395 7:158357963-158357985 AACAGAGACATGCACACACAAGG - Intronic
1038008442 8:23454543-23454565 CTCAGAGAAGAGCACAGAGAAGG + Intronic
1039313914 8:36350958-36350980 CTCAGAGGCTAGCAAACAGAGGG - Intergenic
1039971833 8:42326883-42326905 CATAGAGCCCTGCACACAGAAGG - Intronic
1047395059 8:124490093-124490115 TTCTGAGAAGTGCATACAGAGGG - Intronic
1047791116 8:128204947-128204969 CTCTGAGAAGCACACACAGAGGG + Intergenic
1048252133 8:132875539-132875561 CACAGAGCCTTGCACACAGCAGG + Intronic
1048257658 8:132917343-132917365 CTCAGACAAGAGCAGACAGAAGG + Intronic
1048290562 8:133178279-133178301 CTCAGGGGCGTACACACAGAAGG + Intergenic
1052558877 9:30057470-30057492 CTCAGAGACATCAACACAAAGGG + Intergenic
1052801281 9:32970486-32970508 CTCAGAGACAGGCCCAGAGAAGG + Intergenic
1055069026 9:72147927-72147949 GTCAGAACCATGCACACAGATGG - Intronic
1055270996 9:74558351-74558373 CTCAAAGAAGTGCCCACACAAGG - Intronic
1055689483 9:78813997-78814019 CACACACACGTGCACACACACGG + Intergenic
1056035279 9:82598201-82598223 CACACACACATGCACACAGAGGG - Intergenic
1056710207 9:88986424-88986446 CACAGAGACATGCACACACACGG + Intergenic
1059177621 9:112181602-112181624 CTCAAAGACGTCCCCAAAGAAGG - Intergenic
1060221658 9:121767297-121767319 GTCAGAGCCCAGCACACAGATGG - Intronic
1060228705 9:121811798-121811820 CTCAGTGAGGTTCACACAGCAGG - Intergenic
1060274695 9:122173502-122173524 CTCAGTGTCTTGCACACAGTAGG - Intronic
1060944284 9:127560700-127560722 CACAGCGCCGGGCACACAGAAGG + Intronic
1189997282 X:46651215-46651237 CTCAAAGAGCTGCACAGAGAAGG + Exonic
1195408639 X:104544885-104544907 CGCAAAAACCTGCACACAGATGG + Intergenic
1196783303 X:119401294-119401316 CTCAGCATCGTGCACACAGTGGG - Intronic
1197715648 X:129704448-129704470 CTCAGAGACTGGCACATAGCAGG - Intergenic