ID: 1084351254

View in Genome Browser
Species Human (GRCh38)
Location 11:68601442-68601464
Sequence CCACACTGCCTGGGAGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 372}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084351254_1084351258 -6 Left 1084351254 11:68601442-68601464 CCAGTCTCTCCCAGGCAGTGTGG 0: 1
1: 0
2: 4
3: 35
4: 372
Right 1084351258 11:68601459-68601481 GTGTGGCTGAAAATAAGTAAAGG 0: 1
1: 0
2: 0
3: 24
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084351254 Original CRISPR CCACACTGCCTGGGAGAGAC TGG (reversed) Intronic
900547147 1:3235534-3235556 CCCCGCTGCCTGGCAGAGAAAGG + Intronic
900642088 1:3692584-3692606 ACACACCTCCTGGGAGAGTCTGG - Intronic
900664761 1:3807755-3807777 CCACTGTGCCTGGCTGAGACTGG + Intergenic
901026138 1:6279670-6279692 CCACCCGACCTGGGAGAGGCCGG + Intronic
902460584 1:16573133-16573155 CAACATTACCTGGGAGACACTGG + Exonic
902810024 1:18882915-18882937 CCTCTCTGCCTGGGAGACCCTGG - Intronic
903335044 1:22619055-22619077 CCACACTGCCCGGAAGTGATGGG - Intergenic
905646925 1:39631495-39631517 CCCCACTGCCTTTGAGAAACAGG - Exonic
905907954 1:41632195-41632217 CCACACTGACTGTGTGTGACAGG - Intronic
906478235 1:46184176-46184198 CCACACAGCTGGGGAGAGAGAGG - Exonic
906537836 1:46561669-46561691 CCACACTGCCAGGGATGGGCAGG + Intronic
907502082 1:54887936-54887958 CAACACTGCCTGGCACAGAGCGG - Intergenic
908993759 1:70127285-70127307 CAACACTGCCTGCAAGAGAATGG + Intronic
911182812 1:94876096-94876118 CCACGCTGCCTGGGCTAGGCCGG + Intronic
911244448 1:95501205-95501227 CAACACTGCATGGGACAGACTGG - Intergenic
912384490 1:109264440-109264462 CCGCACACCCTGGGAGGGACAGG - Exonic
912488149 1:110045712-110045734 CCACACTGCCTGGGACTGGTAGG - Intronic
913058062 1:115180120-115180142 CCACACTTCCTGGTGGTGACTGG + Intergenic
913604828 1:120455447-120455469 CAACATTACCTGGGAGACACTGG - Intergenic
913641697 1:120818161-120818183 CAACATTACCTGGGAGACACTGG - Exonic
913702317 1:121385074-121385096 CCACACTGATGGGGATAGACTGG - Intronic
914042880 1:144065570-144065592 CCACACTGATGGGGATAGACTGG - Intergenic
914083708 1:144433764-144433786 CAACATTACCTGGGAGACACTGG + Exonic
914135206 1:144894918-144894940 CCACACTGATGGGGATAGACTGG + Intronic
914189729 1:145399040-145399062 CAACATTACCTGGGAGACACTGG + Exonic
914211577 1:145584747-145584769 CAACATTACCTGGGAGACACTGG + Intergenic
914276781 1:146132177-146132199 CAACATTACCTGGGAGACACTGG + Exonic
914366033 1:146978997-146979019 CAACATTACCTGGGAGACACTGG - Exonic
914408344 1:147400257-147400279 CCACCCTGGCTGGGAAAGGCAGG + Intergenic
914486411 1:148114428-148114450 CAACATTACCTGGGAGACACTGG + Exonic
914537825 1:148583132-148583154 CAACATTACCTGGGAGACACTGG + Exonic
914586741 1:149069585-149069607 CAACATTACCTGGGAGACACTGG + Exonic
914628098 1:149482213-149482235 CAACATTACCTGGGAGACACTGG - Intergenic
914914994 1:151814212-151814234 GCACAATGCCTGGCAGAGAAGGG + Intronic
915297502 1:154931560-154931582 CTGCACTGCATGGGAAAGACAGG - Intronic
915671068 1:157489503-157489525 CCATTCTTCCTAGGAGAGACAGG + Intergenic
916431369 1:164732069-164732091 CCACACTTGCTGGGAAAGGCTGG - Intronic
916789522 1:168112995-168113017 CCAGACCTCCTGGCAGAGACTGG - Intronic
917384609 1:174457542-174457564 CTCCACTGCCTGGGTGACACTGG - Intronic
917964180 1:180168109-180168131 TGACTCTGCCTGGGAGAGGCTGG + Intronic
918100566 1:181369650-181369672 CCACACTGCCCTGGAGACACAGG + Intergenic
919069562 1:192736556-192736578 CCACCATGCCTGGCTGAGACTGG + Intergenic
920489743 1:206403816-206403838 CCACACTGATGGGGATAGACTGG - Intronic
920523495 1:206647657-206647679 CCTCACTGCCTATGAGAAACTGG + Exonic
922506310 1:226127987-226128009 CCACCCTGCCAGGAAGACACAGG - Intergenic
922739008 1:228005346-228005368 CCGCAGTGCCTGGGAGAAGCGGG + Intergenic
923676013 1:236081407-236081429 TCACACTAGCTTGGAGAGACAGG + Intergenic
924626455 1:245699838-245699860 CCACACTGGCTGGGGAAGACTGG - Intronic
1063590828 10:7394148-7394170 CCACCATGTCTGGTAGAGACGGG + Intronic
1064269532 10:13852394-13852416 CCACCATGCCTGGTAGAGACAGG + Intronic
1064274403 10:13892710-13892732 CCACTCTTCAGGGGAGAGACTGG + Intronic
1065964123 10:30756865-30756887 CCACATGTCCAGGGAGAGACCGG - Intergenic
1068987118 10:63117666-63117688 CCCCACTACCTGGTAGAGAGAGG - Intergenic
1069722896 10:70560911-70560933 GCACACTGCCTGGGGAGGACGGG - Intronic
1070573933 10:77662661-77662683 CCACACGGCCTGCGGCAGACTGG + Intergenic
1070829865 10:79411679-79411701 CCACACAGCCTGTGAGAGGCAGG + Intronic
1071506563 10:86235276-86235298 CCACACTGCCAGGTACAGAGAGG - Intronic
1071575034 10:86718878-86718900 CCCCACAGCCTGGGAGAAAGGGG + Intronic
1071730132 10:88239663-88239685 CCACCCAGCCTGGGAAAGAAAGG - Intergenic
1071789477 10:88939111-88939133 TCACATTGTCTTGGAGAGACAGG - Intronic
1072860128 10:98994844-98994866 CCACTCTGCCAAGGAGGGACAGG - Intronic
1073493678 10:103872498-103872520 CCACACAGCCTGGCAGGAACAGG + Intergenic
1073773660 10:106762714-106762736 CCATCATGCCTGGGGGAGACTGG + Intronic
1074147398 10:110728930-110728952 TCACACAGCCTGGGTGTGACAGG - Intronic
1074373350 10:112918716-112918738 CGACACTGCCTGGCACAGAGGGG - Intergenic
1074876913 10:117620918-117620940 CCACTCATCGTGGGAGAGACAGG - Intergenic
1075046173 10:119148215-119148237 CCACAACTCCTGCGAGAGACAGG + Intronic
1075049885 10:119175680-119175702 CCACAGTGCCTGGCTGAGATGGG + Intronic
1076517671 10:131057295-131057317 CCCCGATGCCTGGGAGAGGCAGG - Intergenic
1076865613 10:133164923-133164945 CCACACTGGCTGGGTGAGCAAGG - Intronic
1077381078 11:2237922-2237944 CCACTCTCCTTTGGAGAGACAGG + Intergenic
1077405590 11:2381119-2381141 CCAGACAGCCTGGGGGAGCCAGG - Intronic
1077537396 11:3131005-3131027 CCACACTGCCTGGGACATTCCGG - Intronic
1078152687 11:8772781-8772803 CCAAACTGCCTGGGGGTGGCAGG + Intronic
1078934151 11:15937684-15937706 TCAGACTCTCTGGGAGAGACTGG - Intergenic
1081622270 11:44625616-44625638 CCACAGTGCCTGGCATAGAGTGG - Intergenic
1083718125 11:64590853-64590875 CCACACAGCCTGGGAGGCGCAGG + Exonic
1084351254 11:68601442-68601464 CCACACTGCCTGGGAGAGACTGG - Intronic
1084371446 11:68747477-68747499 CCACCATGCCTAGTAGAGACAGG - Intronic
1084377000 11:68784387-68784409 CCACCATGCCTAGTAGAGACAGG - Intronic
1084423802 11:69073440-69073462 CCACACTGCCTGTGAGCACCTGG - Intronic
1085454963 11:76660458-76660480 CCACAATGCCCTGGAGACACTGG - Exonic
1087149779 11:94848613-94848635 CCCCACTGGCTGGGAGACCCTGG + Intronic
1087620636 11:100537678-100537700 CCACACTTTCTGGAATAGACTGG - Intergenic
1089376127 11:117996106-117996128 CCACACAGCCAGGAAGAGTCAGG + Intronic
1089706692 11:120283308-120283330 CCACGTGACCTGGGAGAGACAGG + Intronic
1090235007 11:125140526-125140548 CCACCCTGGCTGTGGGAGACTGG - Intergenic
1091398433 12:168699-168721 CCACACAGCCAGGGAGTGTCAGG + Intronic
1091838112 12:3600295-3600317 CCTCTCTCCCTGGGAGAGCCCGG - Intergenic
1092003874 12:5052612-5052634 CCACACTACCTAGGATTGACGGG - Intergenic
1093227844 12:16507081-16507103 CTACACAGCCTGGGAGAGTAGGG + Intronic
1095883672 12:47166155-47166177 CCACAGAGCCTGGGAGACAGGGG - Intronic
1096496416 12:52041836-52041858 CCAGGCTGCCTGGGAGGGGCAGG - Exonic
1096604527 12:52755101-52755123 CCTCACTGCAGGGGAGAGGCAGG - Intergenic
1098400847 12:70074026-70074048 TCACACTGCCTGTGGGAGTCTGG + Intergenic
1102055129 12:109890864-109890886 CCACATTGCCTGGCAAAGCCTGG - Intergenic
1103784237 12:123420310-123420332 CCACTGCGCCTGGCAGAGACGGG + Intronic
1103862820 12:124027929-124027951 CCACACGGTGTGGGAGAGCCAGG + Intronic
1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG + Intronic
1104771747 12:131368319-131368341 CCAGACCACCAGGGAGAGACTGG + Intergenic
1104969346 12:132524167-132524189 CCACAGTGCCAGGAAGAGCCGGG + Intronic
1106798752 13:33234018-33234040 CCACAGTGCCTGGGACAGTGAGG - Intronic
1107848199 13:44541216-44541238 CCAAACTGGCTGGCAGAGCCAGG - Intronic
1113255589 13:108501166-108501188 CCACAGTGCCAGGGAAAGTCCGG - Intergenic
1115081276 14:29453914-29453936 CCACATTGCCAAAGAGAGACAGG + Intergenic
1116738486 14:48725488-48725510 CCACACTGGCTTTTAGAGACAGG + Intergenic
1117292207 14:54344774-54344796 CCAGACGGCCTGGGACAGAGTGG - Intergenic
1117527511 14:56624592-56624614 GCACACTGCCTGGCATAGAACGG - Intronic
1118920108 14:70142214-70142236 GCAGACTGTCTGGGAGAGATTGG - Intronic
1119630511 14:76227892-76227914 GCCCTCTGCCTGGGAGAGGCTGG - Intronic
1119635659 14:76271212-76271234 CCTCACTGGCTGGGAAAGGCTGG + Intergenic
1120253392 14:82088421-82088443 CCACTATGCCTGGCTGAGACTGG + Intergenic
1121233083 14:92372569-92372591 CCATACTCCCTGAGAGAGTCAGG - Intronic
1121639753 14:95477314-95477336 CCCCAATGCCAGGGAGAGAGAGG - Intergenic
1122099480 14:99395770-99395792 AGACACTGCCTGGGAGACAGAGG + Intergenic
1122269988 14:100564724-100564746 CCACAGTGCCTGGCAGAGGCTGG - Intronic
1122497200 14:102166150-102166172 CCACCACGCCTGGCAGAGACCGG + Intronic
1122660774 14:103293571-103293593 CCCCTCTGTCTGGGAGACACAGG - Intergenic
1202904332 14_GL000194v1_random:59776-59798 CCATGCTGCCTGGCAGAGGCTGG + Intergenic
1124168634 15:27352610-27352632 CCACACTGCCCCGGGGAGGCAGG + Intronic
1124212346 15:27774275-27774297 CCTCACTGCCAGAGAGAGGCGGG - Intronic
1125426368 15:39553471-39553493 CCAGAATGCCTGAGAGAGAGTGG - Intergenic
1125685623 15:41561604-41561626 CCACACTGGCTGGGAGATCTCGG - Exonic
1126652530 15:50938766-50938788 CTACCCTGCCTGGGAGAGAGAGG - Intronic
1127043913 15:55006491-55006513 CCAGTCTGCAGGGGAGAGACTGG - Intergenic
1127542254 15:59952374-59952396 CCACTATGCCTAGTAGAGACGGG - Intergenic
1127844316 15:62856491-62856513 CTGCACTGCCTGGCAGAGGCCGG - Intergenic
1127902295 15:63349814-63349836 CCACAGTGCCTGGCACAGAGTGG + Intronic
1128344641 15:66845657-66845679 CCACGCTGCCTGGGACAGCACGG - Intergenic
1128598583 15:68975923-68975945 CCTCACTGCCTGGGACCGGCAGG + Intronic
1128906435 15:71471797-71471819 CAACACTGGCTATGAGAGACAGG + Intronic
1129379965 15:75158615-75158637 CCACTCTCCCTGGGAGGGTCAGG - Intergenic
1129530595 15:76261312-76261334 CCACACTGGCTGGGAGATCTGGG + Intronic
1129697604 15:77749512-77749534 CCACTCTGCTGGGGAGAGTCTGG - Intronic
1129779984 15:78264095-78264117 CCACACCCCCGGGGAGAGGCCGG + Exonic
1131199066 15:90381093-90381115 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1131619980 15:94057905-94057927 CCACAGTGCGTGGGACACACTGG + Intergenic
1131957124 15:97748537-97748559 TCTCTCTGCCTGGGAAAGACTGG + Intergenic
1132672158 16:1106377-1106399 CCAAGCTGCCTGGCAGAGTCTGG + Intergenic
1133124205 16:3634513-3634535 CCACTGTGCCTGGCCGAGACAGG + Intronic
1134189902 16:12112962-12112984 CCACGCTGCCTGGGACAGCGTGG + Intronic
1135183425 16:20294341-20294363 CCAGGCTGTCTGGGAGAGCCAGG + Intergenic
1138489732 16:57369736-57369758 CCACATTGCCTGGCACACACCGG + Intergenic
1140981436 16:80113385-80113407 CAACAATGTCTGTGAGAGACTGG + Intergenic
1141720591 16:85753172-85753194 CCTCACTGGCTGGGAGACCCAGG - Intergenic
1142135869 16:88451841-88451863 CCCCACTGCCATGGACAGACAGG - Intergenic
1142245240 16:88967352-88967374 ACACACTGCCTGGGAGCGACGGG + Intronic
1142411248 16:89918269-89918291 CCACTCTGGCTGGGCGAGGCTGG + Exonic
1144576859 17:16435026-16435048 CCACAAAGCCTTGGAGAGTCTGG + Intronic
1144879155 17:18422095-18422117 CTTCTCTCCCTGGGAGAGACAGG - Intergenic
1145906697 17:28520337-28520359 CCACACGGCCCAGGAGAGAGGGG - Intronic
1146150136 17:30460916-30460938 CCACAGTGCCTGGTAGTGCCAGG - Intronic
1146491155 17:33283308-33283330 CCACACTCGCTTTGAGAGACAGG - Intronic
1148340643 17:46871566-46871588 CCACAGTGCCTGGGACAAGCAGG - Intronic
1149537805 17:57445947-57445969 GAACAGTGCCTGGCAGAGACAGG - Intronic
1149828440 17:59850432-59850454 CAACACTGGCAGGCAGAGACGGG + Intergenic
1151495732 17:74457135-74457157 CACCACTGCCTGGGGGAGTCGGG + Intergenic
1152730496 17:81967442-81967464 CCCCAGTGCCTGGGAGTGAGTGG + Intergenic
1152760165 17:82103488-82103510 CCACACTGGCTGGCAGAGGGTGG + Intronic
1153340383 18:3967250-3967272 CCACAGTGCCTGGCAGTGCCTGG - Intronic
1153655088 18:7275010-7275032 CTACAGTGGCTGAGAGAGACAGG + Intergenic
1154020687 18:10661909-10661931 CCATCCTGGCTGGGAGAGAGAGG + Intergenic
1154388514 18:13916852-13916874 CCACTCTGATTGGGAGGGACAGG + Intergenic
1155176125 18:23302758-23302780 CCACCCTGGCTGGCTGAGACTGG - Intronic
1156486804 18:37471567-37471589 TCACACTGCCTGGGCAAGATCGG - Intronic
1156966860 18:43105078-43105100 GCACACTGCCTGTTAGAGAAAGG - Intronic
1158107853 18:53905524-53905546 CCACAGGGCCAGGGTGAGACTGG - Intergenic
1158174136 18:54635018-54635040 CCACACTGCCTCCGAGCTACCGG + Intergenic
1158546617 18:58403232-58403254 CCACTCTGCCTGGAGGTGACGGG - Intergenic
1158936714 18:62371249-62371271 CCACACTGTCAGGGGCAGACCGG + Intronic
1161123127 19:2541043-2541065 GCACCCGGCCTGGCAGAGACAGG + Intronic
1161210000 19:3061477-3061499 CCCCACTGCCTGGGGGTGGCGGG - Intronic
1161271057 19:3389542-3389564 CCACACTGCCTGGAGCACACAGG - Intronic
1161377981 19:3950003-3950025 CCTCCCTGCCTGGGAGGCACTGG + Intergenic
1161797953 19:6398382-6398404 CCACCGCGCCTGGGTGAGACAGG - Intergenic
1162274782 19:9644485-9644507 CCACCGTGCCTGGCCGAGACTGG + Intronic
1162485352 19:10956968-10956990 CCACCGTGCCTGGTTGAGACAGG + Intergenic
1163267341 19:16228966-16228988 CCAGGCTGCCTTGCAGAGACAGG - Intronic
1163800196 19:19360074-19360096 CACCACTGCCTGGGCGAGAGAGG + Intergenic
1165035523 19:33030902-33030924 TCACACATCCTGGGAGAGAGGGG + Intronic
1165385753 19:35509957-35509979 TCACACTGCCGGGGAGAGAAAGG + Exonic
1165791891 19:38497433-38497455 CCACACAGCCAGGGAGCGAGGGG - Intronic
1166872440 19:45879052-45879074 GCACACTGGCTGGGGGAGACTGG - Intergenic
1167423206 19:49415687-49415709 CTACACTCCCTTGCAGAGACTGG + Intronic
1167477906 19:49711612-49711634 TCACACAGCCAGGGAGAGCCAGG - Intronic
1167899890 19:52612123-52612145 CCACACTGCTTGGGAGACCGAGG - Intronic
1168333209 19:55581199-55581221 ACACAGTGCCTGGCACAGACAGG - Intergenic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
1202677018 1_KI270711v1_random:16862-16884 CAACATTACCTGGGAGACACTGG + Intergenic
925432247 2:3805142-3805164 CCACACTGCCTTCTAGAGACTGG - Intronic
926039160 2:9659054-9659076 CCACACTGCCTGGGCATGCCTGG + Intergenic
926308559 2:11657977-11657999 GCTCCCTGCCTGGGAGAGAATGG + Intergenic
927062833 2:19440573-19440595 CCAAACAGCTTGGTAGAGACTGG - Intergenic
927718000 2:25364838-25364860 CCCAGCTGCCTGGGAAAGACTGG - Intergenic
928300911 2:30122727-30122749 ACACCCTGGCTGGAAGAGACAGG - Intergenic
928340496 2:30439317-30439339 CCACCATGCCTGGCTGAGACTGG + Intergenic
929693709 2:44096549-44096571 CCACATTGCCTGGCAGAGGTAGG - Intergenic
930534608 2:52630438-52630460 ACAGACTGCATGGGAGAGAAAGG - Intergenic
931283138 2:60810896-60810918 CCACCATGCCTGGCCGAGACAGG - Intergenic
931911078 2:66901152-66901174 CCACACTTACTGGTAGAAACTGG - Intergenic
934853397 2:97715024-97715046 CCACACTGCCCGGCACATACAGG + Intronic
936947221 2:117941630-117941652 CCACCCTGCCAGGCAGGGACAGG + Intronic
937047696 2:118860684-118860706 CCACATGGCCAGGCAGAGACGGG - Intergenic
938289894 2:130143570-130143592 CCACACTGCCAGGCAGAACCTGG + Intronic
943954906 2:194176420-194176442 CCTCACTGCCTGGGACCGGCAGG - Intergenic
945498843 2:210543093-210543115 CCACAGTGGCTGGGAGAGGGGGG + Intronic
945814996 2:214593847-214593869 CCACAGAGACTGGGAGAGAGAGG + Intergenic
946143908 2:217714303-217714325 CCACACAGCCAGGGAGAGGATGG - Intronic
946151723 2:217778140-217778162 ACACACCTCCTGGGAGAGAAAGG - Intergenic
948140101 2:235666436-235666458 CCCCACTGCCTTAGAGAGATGGG - Intronic
948662634 2:239516494-239516516 CCACACTCCCTGCCAGAGTCGGG - Intergenic
1169278071 20:4246891-4246913 CCACACTGCCAGGCTGAGTCAGG - Intronic
1170446711 20:16435987-16436009 TCACACTTCATGGGAGAGAAGGG - Intronic
1171455830 20:25271656-25271678 CCACATGGCCTGGGAGAGCCTGG + Intronic
1172119880 20:32592019-32592041 CCTCCCTGCCTGGGTGAGGCTGG - Intronic
1172514944 20:35526946-35526968 CCACAGTGTCTGGGAGGGATGGG - Intronic
1172589183 20:36105612-36105634 CCACATTGCCAGGGAGTGATGGG + Intronic
1172672398 20:36643507-36643529 CCACACTGCCTGGATGAGGACGG + Intronic
1172838129 20:37886174-37886196 CCACACAGCCAGCGAGAGACAGG + Intergenic
1173154581 20:40596802-40596824 CCATCCTGCCTGGGTGAGGCAGG + Intergenic
1173690507 20:44957343-44957365 CCACCACGCCTGGTAGAGACAGG + Intronic
1174544746 20:51317005-51317027 GCATTCTGCCTGGGAGAGCCTGG - Intergenic
1174570963 20:51500841-51500863 CCAGACTGCCTGGGAGGGTGAGG - Intronic
1174801867 20:53570854-53570876 CCGCTCTGCCTGTGAGAGGCAGG - Intronic
1175580289 20:60093635-60093657 TTACACTCACTGGGAGAGACAGG + Intergenic
1175592862 20:60207319-60207341 CCACCATGCCTGGCCGAGACTGG + Intergenic
1175705642 20:61174594-61174616 CCAGTCAGCCTGGGAGAGGCAGG + Intergenic
1175819448 20:61900711-61900733 CCAAGCTGCATGGGAGAGATGGG + Intronic
1176195105 20:63833065-63833087 CCAGACATCTTGGGAGAGACTGG - Intergenic
1178495066 21:33079284-33079306 CCTCACTGGCAGGGAGAGCCTGG - Intergenic
1179134549 21:38668128-38668150 CCTACCTGCCTGGGAGAGAAGGG + Intergenic
1179537700 21:42062998-42063020 CCCCAGAGCCTGGGAGAGGCAGG - Intronic
1180137478 21:45871039-45871061 GCCCAGTGCCCGGGAGAGACAGG + Intronic
1180137523 21:45871178-45871200 GCCCAGTGCCTGGGAGAGACAGG + Intronic
1180174727 21:46082078-46082100 ACTCAGAGCCTGGGAGAGACAGG - Intergenic
1180252420 21:46597991-46598013 CCACACTGCCTGGGACAGGCAGG + Intergenic
1181016216 22:20070377-20070399 CCACACAGCCTGGGACTGACTGG - Intergenic
1182336248 22:29585453-29585475 CACCCCTGCCTGGGAGAGATGGG + Intergenic
1182418707 22:30238104-30238126 CCACATTCACTGGGAGAGAGTGG + Intergenic
1183040885 22:35177090-35177112 ACACAGTGCCTGGCACAGACAGG + Intergenic
1183071217 22:35397772-35397794 CCACAGAGCCTGGGAGACAGAGG + Intergenic
1183305326 22:37079998-37080020 CCCCACTGGCTGGGAGTGAGTGG + Intronic
1183734636 22:39637030-39637052 CCACACAGCCAGGGAGAGGCTGG - Intronic
1184103957 22:42356728-42356750 CCACACGGCCTCGGAAAGGCAGG - Intergenic
1184265635 22:43344255-43344277 CCACCGGGCCTGGGAGGGACGGG + Intergenic
1184336892 22:43859106-43859128 TCACTGTGCCTGGGAGAGACAGG - Intronic
1184848451 22:47103343-47103365 GCCCACTGCCTGGGAGAAAGGGG + Intronic
1185288792 22:50014012-50014034 CCACAATGCCCTGGAGAGAGTGG + Intergenic
1185331463 22:50253931-50253953 CCACACTGGCTGGGTGGGGCTGG - Intronic
1185402130 22:50624676-50624698 GCAAAGTGCCTGAGAGAGACGGG - Intronic
949791449 3:7796759-7796781 CCACACAGTATGGGAGAGATTGG - Intergenic
950545949 3:13637963-13637985 TCACACTGCGTGGGAGGGACTGG + Exonic
951768096 3:26223209-26223231 CCACTCTACCTTGGAAAGACTGG + Intergenic
953396200 3:42572537-42572559 CATCATTGCCTGGGAGAGATAGG - Intronic
954286025 3:49619905-49619927 CCACAGTGCCTGGCACAAACTGG - Intronic
954297503 3:49682388-49682410 CCACATTGCCTGGGAGGGAGAGG - Exonic
954636329 3:52072865-52072887 CCACACTGCCTGGGAGTGTAGGG - Intergenic
954917996 3:54164823-54164845 CCACACAGCCTGGAAGTGTCGGG - Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955370265 3:58345155-58345177 CCCCTCTGCCTGGGAGAGCAGGG + Intronic
955465779 3:59235915-59235937 CCACACTACTGGGGAGAGGCTGG - Intergenic
956360292 3:68440085-68440107 CCACATGGCATGGGAGAAACTGG + Intronic
956681763 3:71787610-71787632 TCACAGTGCCTGGAACAGACTGG + Intergenic
959473020 3:106775941-106775963 CCACAAGGACTGGGAGAGAAGGG + Intergenic
960939178 3:122922443-122922465 CCACACTGCCGCGGGGAGCCAGG + Exonic
962279445 3:134039096-134039118 TGACGCTGCGTGGGAGAGACAGG - Intronic
964343862 3:155736521-155736543 ACACACTGCCTGCAAAAGACAGG + Intronic
967036162 3:185649642-185649664 CCACACTCCCTGGGACACACAGG + Intronic
968452903 4:683478-683500 CCACCCTGGCTGGCAGAGGCTGG + Intronic
968907521 4:3461611-3461633 CCACACAGCCTGGAACACACAGG - Intergenic
969299379 4:6288745-6288767 CCACACGGCGAGGGAGACACGGG - Intronic
969537607 4:7766349-7766371 CCCCACTGCCTGGGAGGAAATGG - Intronic
972089185 4:35258324-35258346 CCACCGGGCCAGGGAGAGACAGG - Intergenic
972342200 4:38162311-38162333 GCAGACTTCCTGGGTGAGACAGG - Intergenic
972351780 4:38242917-38242939 CCACAATGCCAGGGAGTGATAGG - Intergenic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
974495950 4:62627219-62627241 CCACACTTAATGGGAGAGATGGG + Intergenic
978845317 4:113266588-113266610 CCACCATGCCTGGCAGAGATAGG - Intronic
980646191 4:135644707-135644729 CCACTCTACCTGGGAGAAATTGG - Intergenic
981643232 4:146968864-146968886 CAGCACAGTCTGGGAGAGACTGG - Intergenic
982554399 4:156841223-156841245 CCACACGTCATGGGAGTGACCGG + Intronic
982823582 4:159974816-159974838 CCACACTCCAAGGGAAAGACAGG + Intergenic
983239047 4:165210227-165210249 GCACAGTGCCAGGCAGAGACAGG - Intronic
983410451 4:167389687-167389709 CCGCACAGCCTGGGAGACAGGGG - Intergenic
984255224 4:177382181-177382203 CCACACTGCCGGTGGGAGCCAGG - Intergenic
984500843 4:180556957-180556979 AAACAATGCCTGGGAGAGACAGG + Intergenic
984710889 4:182883492-182883514 TCACACTTCCTGGGTGAGATGGG + Intergenic
985044229 4:185924241-185924263 CCACACTGCCAGGGAGTGAGTGG + Intronic
985486694 5:155901-155923 CCACCCTCCCTGGGACAGTCCGG + Intronic
985580291 5:692530-692552 CGCCACTGCCCGGGAGGGACAGG + Intronic
985594947 5:783911-783933 CGCCACTGCCCGGGAGGGACAGG + Intergenic
985715617 5:1458083-1458105 CTGACCTGCCTGGGAGAGACGGG + Intronic
986029050 5:3878507-3878529 CCACACTGCCTATGTGAAACGGG - Intergenic
986093723 5:4536004-4536026 CCACACTCCCTGAGGGAGTCTGG - Intergenic
986164999 5:5265469-5265491 CCACAGAGCCTGGGAGACAGGGG + Intronic
986517855 5:8582072-8582094 CCCCACAGCCTGGGGGAAACAGG - Intergenic
986625893 5:9723604-9723626 CCTCACTGCCAAGGAGAGGCAGG + Intergenic
986639301 5:9856546-9856568 CAGCATTGCCTGGGAGATACAGG + Intergenic
988499882 5:31775877-31775899 CCACAGGGCCCGGGAGAGCCAGG - Intronic
989738136 5:44733049-44733071 CCACATTTGCTGGGATAGACAGG + Intergenic
990929268 5:61069344-61069366 CCACACTGGGTTGTAGAGACAGG - Intronic
991019562 5:61965796-61965818 CCACACTGCCTGGGACCCACGGG + Intergenic
995051459 5:107710581-107710603 CCACCCACACTGGGAGAGACGGG + Intergenic
995380186 5:111523106-111523128 CCACCATGCCTGGCTGAGACAGG - Intergenic
997013940 5:129908121-129908143 CCTCTCTACCTGGGACAGACTGG + Exonic
997295155 5:132764410-132764432 CCTCACTGCCCAGGGGAGACCGG - Exonic
997381907 5:133444389-133444411 CCACCCTGCCTGGCAGTGCCCGG + Intronic
998181898 5:139951809-139951831 CCAGGCTGCCTGGGTGAGCCAGG - Intronic
998232116 5:140367421-140367443 CCACACTCCCTGGGCGTGGCTGG + Exonic
998949910 5:147383006-147383028 GCACACAGCCTGTGAGAGTCAGG - Intronic
999271248 5:150297535-150297557 CCACACGGCCTGGCGGACACTGG + Exonic
999721023 5:154399353-154399375 CAACTCTGCCACGGAGAGACAGG - Intronic
1000901229 5:166913955-166913977 CCACACAGCCTGGGAGTTAGTGG + Intergenic
1001432088 5:171670439-171670461 CTACACAGCCTGGGAGGGAGGGG - Intergenic
1002003120 5:176209676-176209698 CCACCATGCCTGGCATAGACTGG + Intergenic
1002223344 5:177701274-177701296 CCACCATGCCTGGCATAGACTGG - Intergenic
1002454983 5:179340875-179340897 CCACGCTGCCCAGGAGATACTGG + Intronic
1003116594 6:3287608-3287630 CCACACAGCCTGGAGGAGTCGGG + Intronic
1003696834 6:8415496-8415518 CCACTCTGCCTGGGACAGAAGGG - Intronic
1004023600 6:11797282-11797304 CCACCCTGCCTCAAAGAGACAGG - Intronic
1004276847 6:14244213-14244235 CAACCATGCCTGGGAGAGAGGGG + Intergenic
1004703935 6:18105109-18105131 CCACACTGCATGACACAGACTGG - Intergenic
1005450292 6:25965508-25965530 CCACTCTGCCAGGGTGAGGCAGG + Intronic
1005451586 6:25978172-25978194 CCACTCAGCCTGGGAGACAGAGG - Intronic
1006104282 6:31707252-31707274 CCTCACTGGCTGGGGGAGAGAGG + Intronic
1006699007 6:35956590-35956612 GCACACTGCCAGGTAGAGTCTGG - Intronic
1007074622 6:39058547-39058569 CCACGGTGCCTGGGTGAAACTGG - Intronic
1007339525 6:41181730-41181752 ACACCCTGCCTGGCAAAGACAGG + Intergenic
1007384379 6:41510726-41510748 CCACTCTGCTTGTGAGAGGCGGG - Intergenic
1007423258 6:41732316-41732338 TCACACAGCCTGGAAGTGACAGG - Intronic
1009789770 6:68386421-68386443 CCAGGCTGCCAGGCAGAGACTGG + Intergenic
1010470643 6:76223880-76223902 CCATCCTGCCTGTGAGAGACAGG + Intergenic
1011055927 6:83203386-83203408 CCACATGGCCTGGGAAGGACAGG - Intergenic
1015085074 6:129280868-129280890 CCACCCTTCCTGGGAGGGAGGGG + Intronic
1015279583 6:131418913-131418935 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1016270078 6:142278401-142278423 CCACATATCGTGGGAGAGACCGG - Intergenic
1016954069 6:149609515-149609537 CCACCATGCCTGGCCGAGACAGG - Intronic
1018005007 6:159613528-159613550 CCCCACTGCCTGGGTGACAGCGG + Intergenic
1018734389 6:166676409-166676431 CCACACTTTCTAGGGGAGACCGG - Intronic
1019599826 7:1875571-1875593 CCACACGGGCTGGGAGGGGCAGG + Intronic
1020108811 7:5436219-5436241 ACCCACTGCCTGGGTGAGCCTGG + Intronic
1020180727 7:5920392-5920414 CTACACTGAGTGGGAGAGGCGGG + Intronic
1020302203 7:6804490-6804512 CTACACTGAGTGGGAGAGGCGGG - Intronic
1021470412 7:20996166-20996188 CCACAGCGCCTGGCTGAGACTGG + Intergenic
1023277453 7:38535211-38535233 CCACACAGCCTGTGAGGGGCGGG - Intronic
1024151190 7:46572912-46572934 CCACACTGGCTGGTAGAAATTGG + Intergenic
1024216521 7:47253729-47253751 CCACACTGCCCCGGAGACACAGG - Intergenic
1029606346 7:101601586-101601608 CCACACAGCCAGGCAGTGACAGG + Intergenic
1031917735 7:127578905-127578927 CCAGACTGCCTGGGGGAAAAGGG + Intergenic
1032455800 7:132072637-132072659 CCCCACGGCCTGGGAGAGTTTGG + Intergenic
1033001364 7:137508734-137508756 CCACAGAGCCTGAGAGAGAGGGG - Intronic
1033582572 7:142750749-142750771 CCAGTCTGCCTGGGAGAGCTTGG + Intronic
1033584129 7:142761669-142761691 CCAGGCTGCCTGGGAGAGCTTGG + Intronic
1033585596 7:142772243-142772265 CCAGGCTGCCTGGGAGAGCTTGG + Intergenic
1035218596 7:157390623-157390645 CCACATCCCCTGGGTGAGACGGG - Intronic
1035333994 7:158114010-158114032 CCACACTGGCTGGGCAGGACAGG - Intronic
1035683699 8:1507851-1507873 CCACACTTCCTGGGAGGTTCAGG + Intronic
1035738434 8:1906820-1906842 CGGCACTGCCTGCGAGGGACAGG + Intronic
1035868719 8:3113210-3113232 CCTGTCTGCCTGGGAGACACTGG + Intronic
1037427152 8:18768353-18768375 CCACACTGCCTGGGAGGCCCAGG + Intronic
1037804895 8:22053695-22053717 CCCCCCTGCCTGAGAGATACAGG + Intronic
1037886418 8:22598675-22598697 CCACACTGCTAGGGAGCGCCGGG + Intronic
1038543845 8:28411041-28411063 CCACTATGCCTAGTAGAGACGGG - Intronic
1038994135 8:32902781-32902803 CCCCACTGCCTGACAGAGATTGG + Intergenic
1040455494 8:47593809-47593831 CCACCCTGGCTGGGAGGGCCAGG + Intronic
1040828224 8:51646846-51646868 TGCCACTGCCTGGGAGAGAAAGG + Intronic
1041159061 8:55018625-55018647 CCACCCTGGCTGGGAGTGGCAGG - Intergenic
1041497027 8:58496797-58496819 GCACAATGCCCGGGAGAAACTGG - Exonic
1042151761 8:65794594-65794616 CTACACTGGTTTGGAGAGACAGG - Intronic
1043443972 8:80301240-80301262 CCACACTCACTGGGCGAGCCAGG + Intergenic
1046175761 8:110573021-110573043 CCACCATGCCTGGTAGAGATGGG - Intergenic
1047262790 8:123276673-123276695 CCACAGTGCCTGGCATATACTGG - Intergenic
1047621652 8:126613661-126613683 CCACATTTCATGGGAGGGACCGG + Intergenic
1047747474 8:127855611-127855633 ACACACTCCCCAGGAGAGACTGG + Intergenic
1047957075 8:129984314-129984336 CAGCCCTGCCTGGGAGACACTGG - Intronic
1048250414 8:132862453-132862475 CCACCCTGCCTGGGAGGGTCAGG + Intergenic
1048989099 8:139750945-139750967 TCACACTGCCTGGCAGAGGGTGG - Intronic
1049716965 8:144097604-144097626 CCACACTGCATGGGACATCCTGG - Intergenic
1049824687 8:144661184-144661206 CCACACTGCCTGTGTGTGAAGGG - Intergenic
1051259080 9:15244368-15244390 CCACACTGCCCGCCAGTGACTGG - Intronic
1052882675 9:33613797-33613819 CCAGGCTGCCTGGGAGAGCTTGG - Intergenic
1052901312 9:33796837-33796859 CCAGGCTGCCTGGGAGAGCTTGG + Intronic
1056535023 9:87519499-87519521 CCATACTCCCTGGGAGTGTCTGG + Intronic
1058638202 9:107057254-107057276 CCACAGGGGCAGGGAGAGACAGG + Intergenic
1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG + Intergenic
1060317138 9:122522731-122522753 GCACACTGCCTGGCACAGACAGG - Intergenic
1060772575 9:126343256-126343278 CCACACTATCTGGGAGTGACTGG + Intronic
1061187429 9:129063111-129063133 CCACACTGCCAGGCTGAGGCAGG + Intronic
1061272862 9:129553483-129553505 TCACCCTGCTTGGGAGAGGCAGG - Intergenic
1061753263 9:132795364-132795386 CCACATTGCCTGTGAGGAACTGG + Intronic
1062083935 9:134638909-134638931 CCACAGTGCCTAGCAGAGAGTGG - Intergenic
1062114144 9:134798555-134798577 CCTCCTGGCCTGGGAGAGACAGG + Intronic
1062360769 9:136186881-136186903 CCACACTGCAGGTGAGAGAATGG + Intergenic
1203563220 Un_KI270744v1:74509-74531 CCATGCTGCCTGGCAGAGGCTGG - Intergenic
1186122714 X:6381183-6381205 CCCCACGACCTGGGAGAGGCAGG - Intergenic
1186393715 X:9186491-9186513 CCACACTGCGTGGAAGAGAGGGG + Intergenic
1186508786 X:10115304-10115326 CCACACAGCTTGTGAGTGACTGG + Intronic
1189304839 X:39979217-39979239 CCACACAGCCAGGGAGAGGCTGG - Intergenic
1189597522 X:42585049-42585071 CCACCCTGGCTGGGAGAGGCAGG - Intergenic
1189896850 X:45665031-45665053 CCTCACTGCCTGGGGCAGGCAGG + Intergenic
1190580032 X:51883370-51883392 CCACTCTGCTTGGGAGAGACTGG - Intronic
1191880704 X:65841616-65841638 CTTCACTGGCTGGGAGAAACAGG + Intergenic
1193978112 X:88148903-88148925 CCACAGTGCCTGTCAGAGCCTGG - Intergenic
1195363813 X:104108705-104108727 CTAGACTGGCTGGGAGAGTCTGG - Intronic
1195613525 X:106895035-106895057 GCACAGTGCCTGGGATAGAACGG + Intronic
1196924116 X:120615245-120615267 ACACACTGCCTGAGAGAAGCAGG - Intronic
1198957064 X:142144994-142145016 TCTCACTGCCTGCTAGAGACTGG - Intergenic
1198957245 X:142146638-142146660 TCTCACTGCCTGCTAGAGACTGG - Intergenic
1199674861 X:150180035-150180057 CCAGACTGGCTGGGAGAAGCAGG + Intergenic
1199700938 X:150375101-150375123 CCACACTTCCAGGGTTAGACGGG - Intronic
1200743161 Y:6877280-6877302 GCACACTGGCTGTGACAGACAGG - Intergenic