ID: 1084352607

View in Genome Browser
Species Human (GRCh38)
Location 11:68613566-68613588
Sequence ACAACTCCTTGTCGGCCTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084352607_1084352610 9 Left 1084352607 11:68613566-68613588 CCTCCAGGCCGACAAGGAGTTGT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1084352610 11:68613598-68613620 ATGCCCTCTAAGTGTTATTTTGG 0: 1
1: 0
2: 2
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084352607 Original CRISPR ACAACTCCTTGTCGGCCTGG AGG (reversed) Exonic