ID: 1084356182

View in Genome Browser
Species Human (GRCh38)
Location 11:68640351-68640373
Sequence GCCCCAACCCAACAACTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084356182_1084356186 -2 Left 1084356182 11:68640351-68640373 CCTATCAGTTGTTGGGTTGGGGC No data
Right 1084356186 11:68640372-68640394 GCTGTAGGTGTTTTATTTTGGGG No data
1084356182_1084356184 -4 Left 1084356182 11:68640351-68640373 CCTATCAGTTGTTGGGTTGGGGC No data
Right 1084356184 11:68640370-68640392 GGGCTGTAGGTGTTTTATTTTGG No data
1084356182_1084356187 -1 Left 1084356182 11:68640351-68640373 CCTATCAGTTGTTGGGTTGGGGC No data
Right 1084356187 11:68640373-68640395 CTGTAGGTGTTTTATTTTGGGGG No data
1084356182_1084356188 0 Left 1084356182 11:68640351-68640373 CCTATCAGTTGTTGGGTTGGGGC No data
Right 1084356188 11:68640374-68640396 TGTAGGTGTTTTATTTTGGGGGG No data
1084356182_1084356185 -3 Left 1084356182 11:68640351-68640373 CCTATCAGTTGTTGGGTTGGGGC No data
Right 1084356185 11:68640371-68640393 GGCTGTAGGTGTTTTATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084356182 Original CRISPR GCCCCAACCCAACAACTGAT AGG (reversed) Intergenic