ID: 1084358118

View in Genome Browser
Species Human (GRCh38)
Location 11:68652743-68652765
Sequence GCCCCAGATGTAGATCCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084358118_1084358122 16 Left 1084358118 11:68652743-68652765 CCTAATGGATCTACATCTGGGGC No data
Right 1084358122 11:68652782-68652804 GAAAAAGGAAATGAAAGCAGAGG No data
1084358118_1084358121 1 Left 1084358118 11:68652743-68652765 CCTAATGGATCTACATCTGGGGC No data
Right 1084358121 11:68652767-68652789 ACAGGTGGAGAGAAAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084358118 Original CRISPR GCCCCAGATGTAGATCCATT AGG (reversed) Intergenic
No off target data available for this crispr