ID: 1084361947

View in Genome Browser
Species Human (GRCh38)
Location 11:68674382-68674404
Sequence ATTCTGTTATTCATGCATCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084361943_1084361947 -5 Left 1084361943 11:68674364-68674386 CCCCCAGGGATACTATTTATTCT No data
Right 1084361947 11:68674382-68674404 ATTCTGTTATTCATGCATCACGG No data
1084361942_1084361947 -4 Left 1084361942 11:68674363-68674385 CCCCCCAGGGATACTATTTATTC No data
Right 1084361947 11:68674382-68674404 ATTCTGTTATTCATGCATCACGG No data
1084361946_1084361947 -8 Left 1084361946 11:68674367-68674389 CCAGGGATACTATTTATTCTGTT No data
Right 1084361947 11:68674382-68674404 ATTCTGTTATTCATGCATCACGG No data
1084361945_1084361947 -7 Left 1084361945 11:68674366-68674388 CCCAGGGATACTATTTATTCTGT No data
Right 1084361947 11:68674382-68674404 ATTCTGTTATTCATGCATCACGG No data
1084361944_1084361947 -6 Left 1084361944 11:68674365-68674387 CCCCAGGGATACTATTTATTCTG No data
Right 1084361947 11:68674382-68674404 ATTCTGTTATTCATGCATCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084361947 Original CRISPR ATTCTGTTATTCATGCATCA CGG Intergenic
No off target data available for this crispr