ID: 1084362314

View in Genome Browser
Species Human (GRCh38)
Location 11:68677017-68677039
Sequence AGATTCTAAGAGGCTGTAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084362311_1084362314 7 Left 1084362311 11:68676987-68677009 CCAGCTGGGGATTTGGGGAAAGA No data
Right 1084362314 11:68677017-68677039 AGATTCTAAGAGGCTGTAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084362314 Original CRISPR AGATTCTAAGAGGCTGTAAA CGG Intergenic
No off target data available for this crispr