ID: 1084363593

View in Genome Browser
Species Human (GRCh38)
Location 11:68684342-68684364
Sequence TTTGGGGGAGTCTCTCCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084363587_1084363593 5 Left 1084363587 11:68684314-68684336 CCACAGGGTTTGGGGTTCTCTCT 0: 1
1: 0
2: 0
3: 29
4: 271
Right 1084363593 11:68684342-68684364 TTTGGGGGAGTCTCTCCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 79
1084363586_1084363593 6 Left 1084363586 11:68684313-68684335 CCCACAGGGTTTGGGGTTCTCTC 0: 1
1: 0
2: 0
3: 28
4: 240
Right 1084363593 11:68684342-68684364 TTTGGGGGAGTCTCTCCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084363593 Original CRISPR TTTGGGGGAGTCTCTCCCGC GGG Intronic
905210434 1:36370264-36370286 TTTGGGGGATTCTCCCGCACAGG - Intronic
911420948 1:97640332-97640354 TTTGACGGAGTCTCTCTCTCAGG + Intronic
914674582 1:149898956-149898978 TTTGAGGGAGTCTTTCCTTCTGG - Intronic
917972482 1:180217565-180217587 TTTAGGGGACCCTCTCTCGCAGG - Intergenic
1067918045 10:50421822-50421844 TTTGGGGCAGCCTCTCCACCAGG - Intronic
1073469160 10:103712241-103712263 TCTGGGGGAAACTCTCCCTCTGG + Intronic
1076051071 10:127333575-127333597 TTTGGGGGATGATCTCCCTCTGG + Intronic
1076319493 10:129567342-129567364 TCTGGGGGGGTCTGTCCTGCTGG - Intronic
1076431365 10:130405173-130405195 TATGGGGAAGTCTCTGCAGCGGG + Intergenic
1076590055 10:131576792-131576814 TTTGTTGGCGTCTCTCCAGCTGG - Intergenic
1077170246 11:1162841-1162863 TTCGGGGGTGTCTCTTCCGTGGG + Intronic
1078364322 11:10693802-10693824 TTTGGGGCAGTCGCTCACCCTGG + Intronic
1083196182 11:61090004-61090026 TAGGGTGGAGTCTCTCCCCCCGG - Intergenic
1084363593 11:68684342-68684364 TTTGGGGGAGTCTCTCCCGCGGG + Intronic
1084555719 11:69874717-69874739 CTTGGGGGGGCCTCTCCCACAGG - Intergenic
1086490927 11:87357108-87357130 TTTGGCTGAGACTCACCCGCTGG - Intergenic
1089349823 11:117816001-117816023 ATTGGGGGAGGGTCTCCCCCAGG - Intronic
1093639101 12:21504455-21504477 TTTTGGGCAATGTCTCCCGCTGG + Intronic
1097262284 12:57726525-57726547 GATGGGGGTGTCTCTCCCGCTGG + Intronic
1097830763 12:64222216-64222238 CATGGGGGAGTCTATCCCGCTGG - Exonic
1100572749 12:95858556-95858578 TTTGGGGGCGCCTCTGCCGCAGG - Intergenic
1103564333 12:121807949-121807971 TTTGGGGGAGTCTCAGCCCCAGG + Intronic
1103847687 12:123911870-123911892 TTGGGGGGGGTCTGTCCCGGGGG + Intronic
1117260016 14:54022690-54022712 TTTGGGTGAGCCTCTGCCCCTGG + Intergenic
1120677653 14:87440213-87440235 TTTGGAGGAGTCACTTCCACTGG - Intergenic
1122833658 14:104420320-104420342 TCTGGGGGATTCTCTCTCTCTGG - Intergenic
1127064412 15:55222120-55222142 TTTGGAGGAGTTTCTCAGGCAGG - Intronic
1128155535 15:65389456-65389478 TTTGGAGGAGTCTGCCCTGCTGG - Intronic
1129735988 15:77963859-77963881 CTTGAGGGAGTCTCTCTGGCTGG + Intergenic
1130904914 15:88233527-88233549 CTTGGGGGAGTCTCTGCAGCTGG - Intronic
1132681866 16:1145764-1145786 TTTGGGGGAATTTCACCCGGGGG - Intergenic
1140856450 16:78981945-78981967 TCTGGGAGGGTCTCTCCAGCAGG - Intronic
1140948566 16:79794347-79794369 TTTTGGGAAGTTTCTCCCTCGGG + Intergenic
1142174338 16:88638357-88638379 TTGGGCGGAGTCTCTCTCGGGGG + Intergenic
1142218700 16:88842340-88842362 CTGGGGAGAGTCTCTCCTGCTGG - Intronic
1144763900 17:17722713-17722735 TTTGGGGGACCCTCCCCAGCTGG - Intronic
1148790095 17:50168061-50168083 TCTTGGGGAATCTCTCCCGGAGG + Intronic
1152613728 17:81328600-81328622 AGTGTGGGCGTCTCTCCCGCAGG + Intronic
1152629812 17:81405860-81405882 GTTGGGGGAGACTCTCCGGTGGG - Intronic
1160809645 19:1007849-1007871 CTTGGGGGGGTCGCTCCTGCTGG - Exonic
1161762874 19:6187443-6187465 TTGGGGGAAGTCTCTGCAGCCGG + Intronic
1165045867 19:33104464-33104486 TTTGGGGGTGTGTCTCCAGAAGG + Intronic
1165827594 19:38714115-38714137 TGCGGAGGAGTCTCTCCCGGTGG - Intronic
1166227527 19:41405945-41405967 GGTGGGGGAGTCTGTCCCGGTGG - Intronic
926040308 2:9667475-9667497 TGTGGAGGAGTCTCTCCCACAGG + Intergenic
933213721 2:79601501-79601523 TTTGGTGGACTCTCTCTCTCAGG - Intronic
941193867 2:162421934-162421956 TTTTGGGGACTCTCTGCTGCTGG - Intronic
946174474 2:217913949-217913971 TTTGGGCAAGTCTCTCTTGCTGG - Intronic
1174109850 20:48191419-48191441 TATGAGGCAGTCTCTCCTGCAGG + Intergenic
1176169526 20:63690653-63690675 TTGGGGGGAGTCTCAGCCTCGGG - Intronic
1179442850 21:41407696-41407718 GCTGGGGGAGTTTCTCCAGCAGG + Intronic
1179633740 21:42694329-42694351 TTTGGAGGAGGCTCTCCTGCTGG + Intronic
1180984547 22:19896797-19896819 TGTGTGGGAGTCTGGCCCGCCGG + Intronic
1181971916 22:26697337-26697359 TTTGTGGGGGGCTCTCCAGCTGG + Intergenic
1183342990 22:37292394-37292416 TTTGGGGGTGTCTATCCAGGGGG + Intronic
1184813190 22:46851413-46851435 CTCTGGGGAGCCTCTCCCGCTGG - Intronic
1185237534 22:49723602-49723624 CCTGGGGGTTTCTCTCCCGCAGG + Intergenic
1185343890 22:50303110-50303132 TGTGGGGGGGTCTCTCCTGGGGG - Intronic
949990003 3:9570781-9570803 TTTGAGTGGGTCTCTCCCTCAGG + Intergenic
954712207 3:52510782-52510804 TTTGGGGAGGTCACTCCCACGGG - Intronic
959392295 3:105791268-105791290 TTTGGCGGAGTCTCAGCCCCTGG + Intronic
962677857 3:137769706-137769728 TTTAGGGAAGTGTGTCCCGCCGG + Intergenic
968206965 3:196811405-196811427 TTTGGCGGAGTCTGTCACTCAGG + Intronic
984756780 4:183331972-183331994 TTTGGGGGAGTTTGACCTGCGGG - Intergenic
985510746 5:312194-312216 CTTGGTGGTGTCTCTCCTGCTGG + Intronic
993436544 5:87902513-87902535 TTTCGGGAGGTCTCTCCTGCTGG - Intergenic
995940822 5:117581778-117581800 TGTAGGGCAGTCTCTCCCTCAGG + Intergenic
1002800494 6:517303-517325 TTTGTGGGAGTCTCTTCAGGTGG - Intronic
1003060956 6:2861877-2861899 TTTGAGGTAGTCTGTCACGCAGG - Intergenic
1016801836 6:148176746-148176768 TTTGTGGGAGTTTCACCCTCAGG - Intergenic
1019280743 7:198772-198794 TTTGGGGGAAGCTCTCCTACTGG + Intronic
1020274468 7:6615922-6615944 GTTGGTGGAGACTCTCCGGCGGG - Exonic
1022207523 7:28179560-28179582 CCTGGGGGTGTCTCTCCAGCGGG + Intronic
1023252548 7:38280925-38280947 TTTGTGGGTGTCTTTCTCGCAGG + Intergenic
1029370622 7:100148571-100148593 TTTGGGGGGGTCACACCAGCGGG + Intergenic
1031977897 7:128105342-128105364 TTTGCGGGTGTCTCTCCCACTGG - Intergenic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1047873933 8:129114514-129114536 TTTTGAGGAGTCTTTCCTGCCGG - Intergenic
1047981593 8:130188704-130188726 TTTGAGAGAGTCTCTCACTCAGG - Intronic
1050936595 9:11404625-11404647 TTTTGGTGAGTCTGTGCCGCTGG + Intergenic
1054767510 9:69054459-69054481 TTTGAGGGATTTTCTCCCACTGG - Intronic
1058793158 9:108471265-108471287 TGTGAGTGAGTCTCTCCCTCAGG - Intergenic
1062164633 9:135101360-135101382 TTTGGGAGAGCCTCTCCTCCAGG - Intronic
1190990912 X:55549365-55549387 TTTAGGGGAGCCTATCCCACAGG + Intergenic
1200181520 X:154153705-154153727 CCTGGTGGAGGCTCTCCCGCGGG + Intronic
1200187166 X:154190819-154190841 CCTGGTGGAGGCTCTCCCGCGGG + Intergenic
1200192815 X:154227957-154227979 CCTGGTGGAGGCTCTCCCGCGGG + Intronic
1200198570 X:154265761-154265783 CCTGGTGGAGGCTCTCCCGCGGG + Intronic