ID: 1084365294

View in Genome Browser
Species Human (GRCh38)
Location 11:68693585-68693607
Sequence GGTCAGCAGCACAAAGGTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084365281_1084365294 22 Left 1084365281 11:68693540-68693562 CCTCCGTGCAGGTGTGGGACTTC No data
Right 1084365294 11:68693585-68693607 GGTCAGCAGCACAAAGGTGTCGG No data
1084365282_1084365294 19 Left 1084365282 11:68693543-68693565 CCGTGCAGGTGTGGGACTTCTGT No data
Right 1084365294 11:68693585-68693607 GGTCAGCAGCACAAAGGTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084365294 Original CRISPR GGTCAGCAGCACAAAGGTGT CGG Intergenic
No off target data available for this crispr