ID: 1084369222

View in Genome Browser
Species Human (GRCh38)
Location 11:68727932-68727954
Sequence TCTTACATGGACATGGCTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084369222_1084369225 30 Left 1084369222 11:68727932-68727954 CCACGAGCCATGTCCATGTAAGA 0: 1
1: 0
2: 5
3: 31
4: 204
Right 1084369225 11:68727985-68728007 GTTCTGACTTCTCCACCAACTGG 0: 3
1: 62
2: 132
3: 289
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084369222 Original CRISPR TCTTACATGGACATGGCTCG TGG (reversed) Intronic
901207875 1:7507734-7507756 TCTTATCTGGACGTGGCCCGTGG - Intronic
902564048 1:17298293-17298315 TGTTACATGAACATAGCTCCAGG + Intergenic
904115053 1:28155582-28155604 TCTTCAATGGACTTGGCTCACGG + Intronic
904353358 1:29923087-29923109 TCTTACATGGCCAGAGCTGGAGG - Intergenic
904578698 1:31523731-31523753 ACTTTCATGAACATGGCTAGTGG - Intergenic
904665409 1:32116956-32116978 TCTTATATGACCATGGCTCATGG + Intronic
904680947 1:32228800-32228822 TCTTACATGGTCATAGTTGGGGG - Exonic
905086213 1:35379884-35379906 TCTTACATTGACGTGGTTTGTGG + Intronic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
909844041 1:80367981-80368003 TCTTATGTGGGCATGGCTTGTGG - Intergenic
909916118 1:81321668-81321690 TCTTACATGGATGTGGCTCATGG + Intronic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
914776284 1:150738748-150738770 TCTTATATGCACGTGGCTCATGG - Intronic
915091653 1:153430321-153430343 TCTGACCTGGACATGGCCCAGGG + Intergenic
917353277 1:174100698-174100720 TCTTACATAGTCATGGTTTGTGG + Intergenic
917950879 1:180034689-180034711 TCTTAAACGGACATGGTTGGTGG - Intronic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
922903145 1:229153912-229153934 TCTTATATGGACATGGTTTGCGG + Intergenic
1063788543 10:9412757-9412779 TCTTTTATGGGCATGGTTCGTGG - Intergenic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1068952979 10:62795921-62795943 TCATACATTGGCATGGTTCGGGG + Intergenic
1069071068 10:63991017-63991039 TTATACATTGACATGGCTCTGGG - Intergenic
1070984359 10:80675400-80675422 TCTTATATGGACATGGCTCATGG - Intergenic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1077715247 11:4574087-4574109 TCTGAAATGTACATGGCTAGGGG - Intronic
1078713081 11:13813922-13813944 TCTTACATGGCAATGGCAAGAGG + Intergenic
1084369218 11:68727878-68727900 TCTTATATGGATGTGGCTTGTGG - Intronic
1084369222 11:68727932-68727954 TCTTACATGGACATGGCTCGTGG - Intronic
1086734262 11:90286156-90286178 TCTTTTATGGACATAGTTCGTGG + Intergenic
1087671201 11:101109046-101109068 TCTTACATGGGCAAGGTTTGTGG - Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088389492 11:109298444-109298466 TCTTACATGGGCATGGTTGGTGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1090681619 11:129065304-129065326 TCTTCCATGCACATGGCCTGTGG + Intronic
1091352012 11:134905364-134905386 TCCTGCATGGGCTTGGCTCGAGG - Intergenic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1091821664 12:3480050-3480072 TCTTCCATGGACATGGATAATGG + Intronic
1092623648 12:10302012-10302034 TCTTATATGGGCATGGTTCCTGG + Intergenic
1093662066 12:21768336-21768358 TCTTATATGGGCATGGCTCATGG - Intronic
1099868983 12:88322326-88322348 TCTTACATGGACAGAGCAGGAGG + Intergenic
1099937933 12:89150414-89150436 TCTTACGTGGGCATGGTTTGTGG - Intergenic
1099972450 12:89514241-89514263 TCTTACATGGCCAGAGCTGGAGG - Intronic
1100723488 12:97384156-97384178 TCTTGTATGGACATGGTTCATGG + Intergenic
1101872347 12:108576467-108576489 TCTTACATGGGCACAGTTCGTGG + Intergenic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1107271668 13:38626133-38626155 TATTAAATGGAGATGGCTCAGGG + Intergenic
1109735411 13:66478185-66478207 TCTAATATGGGCATGGCTTGTGG - Intronic
1109815633 13:67579551-67579573 TCTTATATAGACATGGTTTGTGG + Intergenic
1110022023 13:70486875-70486897 TCTTACATTGCCATGGTTTGTGG + Intergenic
1110091216 13:71450387-71450409 TCTTATATGGGCATAGTTCGTGG - Intronic
1111144005 13:84157157-84157179 CCTTTCATGGACATAGCTCATGG - Intergenic
1111324240 13:86670808-86670830 TCTTATATGGGCATGGTTCGTGG + Intergenic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1115803036 14:37017404-37017426 TTTTACATGTACATGGTTCATGG + Intronic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1120832298 14:89008309-89008331 TCTTACATGGACCTGGGTAGAGG + Intergenic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1126885920 15:53149944-53149966 TCTTACATGAACATGATTTGTGG - Intergenic
1127600383 15:60529979-60530001 TCTTAAATGGACAGGGTTCTAGG - Intronic
1128287284 15:66447841-66447863 TGTTACATGGACACAGCTTGAGG - Intronic
1128424502 15:67526430-67526452 TATTATATGGACTTGGCTCCTGG + Exonic
1129948813 15:79567318-79567340 TCTTAGATGGGCATGGCTTGTGG - Intergenic
1130168208 15:81484786-81484808 TCTTATAAGGACATGGCTGCTGG - Intergenic
1130290444 15:82594942-82594964 TCTTACATGGGAATGGTTTGTGG + Intronic
1131626022 15:94121858-94121880 TCTTCTATGGGCATGGCTTGTGG - Intergenic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1132475414 16:133974-133996 TCTTATGTGGACATGGTTCTTGG + Intronic
1133500354 16:6360268-6360290 TCTTTCATGGACAGGTCTCCAGG - Intronic
1134272994 16:12750528-12750550 CCTTAAATGGACATGGTTTGTGG + Intronic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1149972050 17:61228656-61228678 TTTTACATGGGCATAGCTTGAGG - Intronic
1153492887 18:5667801-5667823 TCTGTTATGGGCATGGCTCGTGG + Intergenic
1159695119 18:71547317-71547339 TCTTACATGGGCGTGGTTTGTGG + Intergenic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
1160355752 18:78226991-78227013 TCTTACAAGGACATCGGTCATGG + Intergenic
1163135318 19:15306778-15306800 TCTTAGATGGACATGGTTTGTGG + Intronic
1164751582 19:30659277-30659299 TCTTACATGGCCAGGGCAGGAGG + Intronic
1166392181 19:42414817-42414839 TCTTACGTGGACATGGTTGGTGG - Intronic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
925644385 2:6021002-6021024 TCTTACATGGCCAAGGCAGGAGG - Intergenic
925902216 2:8516711-8516733 TGTTACTTAGACATGGCTCTGGG - Intergenic
926562237 2:14430393-14430415 TTTTCCATGGACATGGCAGGTGG - Intergenic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
929529771 2:42741738-42741760 TCTTATATGGGCATGGCTTGTGG + Intronic
930375220 2:50557088-50557110 TCGTACACAGACATGCCTCGAGG + Intronic
932857398 2:75250688-75250710 TCTTACATTAACATGGTTCATGG + Intergenic
941433877 2:165444329-165444351 TCTTCCATGGGCATGGTTTGTGG - Intergenic
943508820 2:188798996-188799018 TCATACATGGACATTTCTAGAGG + Intergenic
943616568 2:190099451-190099473 TCTTATATGGACACGGTTCAAGG + Intronic
943665880 2:190607755-190607777 TTTTACCTGGAAATGGCTGGAGG - Intergenic
943695112 2:190918933-190918955 TCTTATATGGACATGGCTTGTGG + Intronic
943906758 2:193508855-193508877 TTTTCCATGGACCTGGGTCGGGG - Intergenic
946749773 2:222882448-222882470 TTTTCCATGGACAGGGGTCGAGG + Intronic
947020737 2:225672878-225672900 TCTTATATGGGCATGGTTCGTGG + Intergenic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
1169701987 20:8457040-8457062 TCTTACATGGACTTCTCTAGAGG + Intronic
1171400561 20:24870868-24870890 TCTGACATGGCCAGGGCTCCAGG - Intergenic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1174692545 20:52521973-52521995 CCTTATATGGACATGGTTTGTGG + Intergenic
1176311345 21:5152176-5152198 TCTTACATGGGCACGGATCACGG + Intronic
1178089330 21:29144588-29144610 TCTTACATGGCCACGAATCGTGG + Intronic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1179772038 21:43627970-43627992 TCTTACATGGGTGTGGCTCATGG - Intronic
1179845705 21:44109859-44109881 TCTTACATGGGCACGGATCACGG - Intronic
1183267992 22:36841697-36841719 TCTTACATAGTCATGGCTCATGG - Intergenic
1185084321 22:48730716-48730738 TCTTACACGGGCATGGTTTGTGG - Intronic
949438374 3:4053276-4053298 TCTTTTATGGACATGGTTCGTGG + Intronic
949626410 3:5871737-5871759 TCTTACATGGGCACGGTTTGTGG - Intergenic
949768777 3:7555330-7555352 TTTTACATTGAGATGGCTTGTGG - Intronic
952411929 3:33057196-33057218 TCTTACATGGACAGAGCGGGAGG - Intronic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
954458734 3:50613960-50613982 TCTGACATGGACAGGCCTGGGGG - Exonic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955426560 3:58796929-58796951 TCTTATATGGGCATGGTTCCTGG - Intronic
958698758 3:97561010-97561032 TCTTACATGGGCATTGTTCATGG - Intronic
959031241 3:101301150-101301172 TCTTACATGGATATTGTTCATGG + Intronic
959585593 3:108022339-108022361 TCATACATTGACATGGTTCCAGG + Intergenic
959821219 3:110737541-110737563 TCTCATATGGAGATGGTTCGTGG + Intergenic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
960351196 3:116595197-116595219 ACTTACATGGGAATGGCTGGAGG - Intronic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
963946524 3:151151675-151151697 TCTTATATGGGAATGGTTCGTGG + Intronic
964813563 3:160692476-160692498 TCTTATATGGACAGGGTTCAAGG - Intergenic
964930176 3:162009934-162009956 TCTTATATGGACATGGTTTGTGG + Intergenic
965728002 3:171739936-171739958 TCTTACATGGACTTGCCCCAGGG - Intronic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
967710797 3:192705561-192705583 TCTTATGTGGGCATGGCTTGTGG + Intronic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
972189358 4:36571240-36571262 TCTTACATGGGTGTGGTTCGTGG + Intergenic
972475425 4:39445437-39445459 TCTCACAGGCACATGGGTCGGGG + Intronic
972897921 4:43645727-43645749 TCTTACATGGACAGAGCAGGAGG + Intergenic
973872782 4:55183112-55183134 TCTTGAATGGACATTGCTTGGGG - Intergenic
974381511 4:61146493-61146515 TCTTCCATGGAGAAGGCTTGTGG - Intergenic
974423336 4:61707153-61707175 TCTTATATAGGCATGGTTCGTGG + Intronic
977539320 4:98297583-98297605 TCATACATGGGCATGGTTCACGG - Intronic
977915728 4:102590598-102590620 TCTTACATGGACACTTCTTGTGG - Intronic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978181309 4:105799617-105799639 TCTTAAGTGGGCATGGTTCGTGG + Intronic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
979811560 4:125042608-125042630 TCTTACAAGGGCATGGTTCGTGG - Intergenic
981200635 4:141975389-141975411 TCTTATATGGACATAGTTTGTGG - Intergenic
981764578 4:148233763-148233785 TCTTACGTGGTCATGGTTTGTGG + Intronic
982344650 4:154344122-154344144 TCTTTCATGGCCATGGTTTGTGG + Intronic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
984637143 4:182123601-182123623 TCTTATATAGGCATGGCTCATGG + Intergenic
986682200 5:10244173-10244195 TCTTATTTGGGCATGGCTTGTGG + Intronic
986738636 5:10686129-10686151 TCTTATATGGGCACGGTTCGTGG - Intronic
988174954 5:27710875-27710897 TCTTATATGGTCATGGTTCATGG - Intergenic
988431600 5:31125460-31125482 TCTTATACGGGCATGGTTCGTGG - Intergenic
990697496 5:58436960-58436982 TCTTATATGGACGTGGTTCATGG + Intergenic
990832646 5:59976903-59976925 TCTTACATGGGCATGGTTTGTGG - Intronic
991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG + Intergenic
993666321 5:90701390-90701412 TTTTAAATGGACCTGGCTCCTGG + Intronic
993968515 5:94388061-94388083 TTTTCCATGGACATGGACCGTGG + Intronic
994380719 5:99067841-99067863 TCTTACATGGCCAAGGCGGGAGG + Intergenic
994476082 5:100271927-100271949 TCTTATATGGACACAGCTCGTGG - Intergenic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
1000453800 5:161423564-161423586 TCTTATATGGACATGCTTCGTGG - Intronic
1001091338 5:168743448-168743470 TCTTTGATGGGCATGGTTCGTGG - Intronic
1003598781 6:7499446-7499468 TCTTATATGGGCGTGGCTTGTGG + Intergenic
1003662776 6:8078380-8078402 TCTTATATGGGCATGGCTTGTGG + Intronic
1004658157 6:17684903-17684925 TCTTATATGGGTGTGGCTCGTGG + Intronic
1005510952 6:26511154-26511176 TCTTACATGGCCATGGCAGAAGG + Intergenic
1006742140 6:36316624-36316646 GCCTACATGGACATGGCACTAGG + Exonic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1009963380 6:70551805-70551827 TCTTACATAGGCATGGTTCATGG + Intronic
1012044774 6:94258852-94258874 TATTATATGGAAATGGCTCTTGG + Intergenic
1013729760 6:113151265-113151287 TCTTATATGGGCATGACTTGTGG + Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1014741389 6:125151518-125151540 TCTTATATGGGCATGGATCAGGG - Intronic
1015559677 6:134501318-134501340 TCTTACATGGAAATGGATGAAGG - Intergenic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1017874985 6:158516921-158516943 TGTTACATGGAGTTGGCTCTGGG - Intergenic
1018843753 6:167539535-167539557 TCTTACATGGGTGTGGCTCATGG + Intergenic
1019159495 6:170059606-170059628 TCTTACATGGATGTGGTTTGTGG - Intergenic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020833326 7:13118369-13118391 TCTAACATGGCCATGGTTCATGG - Intergenic
1020944540 7:14585862-14585884 TCTTACATGGGCGTGGTTCATGG - Intronic
1022365748 7:29714312-29714334 TCTTACTTGGGAATGGCTCAGGG - Intergenic
1024133292 7:46379394-46379416 TCTTATGTGGGCATGGCTTGTGG - Intergenic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1026010917 7:66635500-66635522 TCTGAAAAGGACATGGCTAGGGG - Intronic
1026016180 7:66672607-66672629 TCTGAAAAGGACATGGCTAGGGG - Intronic
1026092686 7:67314675-67314697 TCTTATATGGGCATGGTTCGTGG + Intergenic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1031654876 7:124342347-124342369 TCTTATATGGGCATGGTTCCTGG + Intergenic
1031912854 7:127535600-127535622 TCTTGCCTAGACATGGCTTGAGG + Intergenic
1032712988 7:134478436-134478458 TCTTATATGGACACGGTTCATGG + Intergenic
1033795276 7:144838292-144838314 TCTTATAAGGGCATGGCTGGTGG - Intergenic
1034404446 7:150892910-150892932 TCTTACACGGGCATGGCTCACGG - Intergenic
1037447696 8:18983656-18983678 TCTTACATGGACACAGTTCTTGG + Intronic
1038988948 8:32844834-32844856 TCTTACATGGTCAGGGCAGGAGG - Intergenic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1042985025 8:74573955-74573977 TCATACATGGCTATGCCTCGGGG - Intergenic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1048824349 8:138409326-138409348 TCTTACATGGGCATGCTTCATGG + Intronic
1048943271 8:139421315-139421337 TCTTACATGGCCGTGGTTCATGG + Intergenic
1049444208 8:142622546-142622568 TCTGCACTGGACATGGCTCGGGG + Intergenic
1050242061 9:3647069-3647091 TCTTATAAGGACCTGGCACGTGG - Intergenic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051721608 9:20042886-20042908 TCTTACATGGGCATGGCTTGTGG - Intergenic
1051767777 9:20543392-20543414 TCTTACATGGGTATGGCTTATGG + Intronic
1052524344 9:29594720-29594742 TCTTTCATGGACATTGCTTTTGG - Intergenic
1053329030 9:37187261-37187283 TTTTCCATGGACAGGGGTCGGGG + Intronic
1055559901 9:77512027-77512049 TCTAAGAAGGAAATGGCTCGAGG + Intronic
1055873983 9:80920614-80920636 TCTTACATGGGTATGGTTTGCGG + Intergenic
1056227201 9:84507315-84507337 TCTTATATGTGCATGGCTTGTGG - Intergenic
1056274276 9:84977952-84977974 TCTTACATGGATATAGTTTGTGG - Intronic
1057919839 9:99088017-99088039 TCTCACATGGAGATGGCATGAGG + Intergenic
1059034635 9:110740694-110740716 TATTACATGGAGATGCCTCAGGG - Intronic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1186953321 X:14652645-14652667 TCTTATATGGGCATGGTTCCTGG - Intronic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1193396137 X:80985755-80985777 ACTTACATGGACACGGTTCGTGG + Intergenic
1193569038 X:83118807-83118829 TCTTGTATGGGCATGGTTCGTGG + Intergenic
1193833359 X:86314009-86314031 TTTTACATGGGCATGGTTTGTGG - Intronic
1195140816 X:101957760-101957782 TCTTACATGGACAGAGCAGGAGG - Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196564041 X:117183726-117183748 TCTTACATAGGCATGGTTGGTGG - Intergenic
1197317162 X:124981416-124981438 TCTTTCCTGCACATGGCTCTCGG - Intergenic
1199090659 X:143688139-143688161 TCTTATATGGCCATGGTTTGTGG + Intergenic
1199820067 X:151435936-151435958 TTTTACATGTACATTGCTCAGGG + Intergenic
1199857854 X:151774897-151774919 ACTTTCATGGACAAGGCTGGTGG + Intergenic
1200473172 Y:3611686-3611708 TCTTACATGGACAGAGCAGGAGG - Intergenic