ID: 1084370104

View in Genome Browser
Species Human (GRCh38)
Location 11:68735646-68735668
Sequence ACCATGTGCACAGTCCGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084370104_1084370106 3 Left 1084370104 11:68735646-68735668 CCTATACGGACTGTGCACATGGT 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1084370106 11:68735672-68735694 ATATTGACTGTAAATGCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084370104 Original CRISPR ACCATGTGCACAGTCCGTAT AGG (reversed) Intronic
901469215 1:9443955-9443977 ACCATGGGCACAGCCCGTCTTGG + Intergenic
904043874 1:27599132-27599154 ACCATGGGTAAAGTCCATATTGG + Intronic
907703130 1:56809086-56809108 ACCATGTGAACAGCACCTATTGG + Intronic
912141603 1:106736774-106736796 GCTATGTGCACAGTCCTCATGGG + Intergenic
924183420 1:241462201-241462223 GCCATTTGCACAGTCCATAGAGG + Intergenic
1062823326 10:550898-550920 GCCATGTGCACGGTTCGCATCGG - Intronic
1069905282 10:71728621-71728643 ACCACATGCAAAGTCTGTATGGG + Intronic
1079950437 11:26795494-26795516 CCCATGTTCACAGTCTGTATGGG - Intergenic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1084370104 11:68735646-68735668 ACCATGTGCACAGTCCGTATAGG - Intronic
1093155619 12:15681254-15681276 ACCATGTTCTCTGTCCGTCTGGG + Exonic
1094490703 12:30958843-30958865 AGCAGGTGCACAGTGGGTATTGG + Intronic
1098028886 12:66234376-66234398 ACCAGGTGCAAAGTCCTTCTTGG - Intronic
1098598386 12:72299456-72299478 ACCATGTGAACAGCACATATGGG - Intronic
1110513980 13:76386730-76386752 ACCAGGTACACAGTCTGCATGGG + Intergenic
1113426593 13:110213569-110213591 AGCCTGTGCACAGTCCCCATGGG + Intronic
1113793193 13:113041505-113041527 CCCATGACCACAGTCAGTATGGG + Intronic
1113793205 13:113041546-113041568 CCCATGACCACAGTCAGTATGGG + Intronic
1113793217 13:113041587-113041609 CCCATGACCACAGTCAGTATGGG + Intronic
1120330383 14:83085389-83085411 CATATCTGCACAGTCCGTATGGG - Intergenic
1128668491 15:69556460-69556482 ACCAGGTGAACACTCAGTATGGG + Intergenic
1141930586 16:87199894-87199916 ACTAAGTGCACACTACGTATTGG + Intronic
1142632059 17:1231484-1231506 ACCATGGGCACAGGCCGTCCTGG + Intergenic
1143898378 17:10154960-10154982 CCCATGTCCACAGTCTGCATGGG + Intronic
1144452210 17:15390535-15390557 AGCATGAGCTCAGACCGTATAGG - Intergenic
1148447251 17:47745106-47745128 TCCATGGGCAGAGTCCGCATAGG - Exonic
1151335316 17:73436203-73436225 TCCATGTGCAAAGCCGGTATGGG - Intronic
1152130849 17:78475527-78475549 AGCATGTGCAGAGTCCGTGCTGG - Intronic
1156137451 18:34059812-34059834 ACCATGTGCAGAGACCATGTAGG + Intronic
1160405110 18:78639925-78639947 GCCGTGTGCACAGTCCAGATGGG + Intergenic
925076508 2:1020487-1020509 AGCATCTGCACTGTCCGAATGGG + Intronic
925328500 2:3040670-3040692 ACCATCCGCACAATCCGTCTGGG - Intergenic
933629432 2:84639132-84639154 ACCATGCCCACAGTGGGTATGGG - Intronic
936799092 2:116244428-116244450 ACTTTATGCACAGTCCATATAGG - Intergenic
942951508 2:181727678-181727700 TCCATGTCCACAATCTGTATTGG - Intergenic
1175833410 20:61979235-61979257 ACCATGGGCACAGCCCGTGAGGG - Intronic
961424983 3:126838007-126838029 ACCATGTCCACAGTGCAGATGGG + Intronic
977072278 4:92406430-92406452 AACATGTGCACAGTTCTTACTGG + Intronic
978930342 4:114303117-114303139 ACCATATGCAGAGTCCGTAAAGG + Intergenic
988325215 5:29756067-29756089 ACAATGTGCAGACTCCCTATTGG - Intergenic
992988054 5:82253851-82253873 ACCATTTTCACAGACCGAATGGG - Intronic
997114437 5:131111441-131111463 GCCATGAGCACAGTCAGTTTGGG - Intergenic
998161032 5:139813153-139813175 ACCTTGTGCTCAGTTAGTATTGG + Intronic
998498364 5:142610674-142610696 CCAATGTTCACAGTCCATATTGG + Intronic
1006215363 6:32437513-32437535 ACCATGAGCACTGTCCAAATAGG + Intergenic
1011947307 6:92922451-92922473 TCCATGTGGTCACTCCGTATGGG + Intergenic
1018172044 6:161151296-161151318 CCCATGTGCACAGTGCGTACAGG + Intronic
1038745733 8:30253248-30253270 ACCAAGTCCAGAGTCAGTATGGG + Intergenic
1043795557 8:84534208-84534230 AGCATGTGCACAGGCCCTGTTGG - Intronic
1057411071 9:94816883-94816905 ACCATGTGCACAGGCCTTCGTGG - Intronic
1189106081 X:38237022-38237044 ACCATGTGCAAAGTCACTTTGGG + Intronic
1190450129 X:50571187-50571209 ACCATGTGCAAGGTCCTTCTAGG + Intergenic