ID: 1084370818

View in Genome Browser
Species Human (GRCh38)
Location 11:68741543-68741565
Sequence AAATGTAAGCTGCAGGAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 0, 2: 8, 3: 67, 4: 466}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084370813_1084370818 13 Left 1084370813 11:68741507-68741529 CCTATTAGATTTGCTAATTGTCT 0: 1
1: 0
2: 1
3: 18
4: 249
Right 1084370818 11:68741543-68741565 AAATGTAAGCTGCAGGAGGGCGG 0: 1
1: 0
2: 8
3: 67
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084370818 Original CRISPR AAATGTAAGCTGCAGGAGGG CGG Intronic
900479493 1:2891223-2891245 AAGAGGAAGCCGCAGGAGGGAGG + Intergenic
900788316 1:4663559-4663581 AAATGCAGGCTGCAGGTGGGAGG + Intronic
900926204 1:5707769-5707791 GAATGTACGCTCCTGGAGGGTGG - Intergenic
901254661 1:7812328-7812350 AAATTGAAGCTGCAGGTGGCCGG + Intronic
901737015 1:11319168-11319190 GGATGTAAGTTGCAGGAGGGCGG - Intergenic
902129252 1:14244602-14244624 AAATGAAAGCTGGGGGAGGTAGG + Intergenic
902410009 1:16206943-16206965 GACTGCAAGCTGCAGGAGGTGGG - Exonic
903102190 1:21040302-21040324 ACATGGAAGTTGCTGGAGGGTGG + Intronic
903756109 1:25662163-25662185 GAATGTCAGCTCCAGGAGGCAGG + Intronic
904385877 1:30141765-30141787 GCATGGAAGCTGCAGGAGGGTGG - Intergenic
905028761 1:34867835-34867857 AAATGTAGGCTGTATGAAGGAGG - Intronic
905093805 1:35451415-35451437 AGATGTAAGCAGGAGGAGGGAGG + Intronic
905117147 1:35652117-35652139 AAATGGAAGCTTGAGGAGGAAGG - Intergenic
905273476 1:36802037-36802059 GAAGGAACGCTGCAGGAGGGTGG + Exonic
905528095 1:38654765-38654787 GAATGTAAGCTGTCTGAGGGCGG - Intergenic
905726414 1:40255690-40255712 GAATGTAAGCTCCAGGAGAGGGG + Intergenic
905730875 1:40298827-40298849 GAATATAAGCTCCACGAGGGTGG - Intergenic
905935464 1:41820759-41820781 AAATGTTAGCTCCACGAAGGAGG + Intronic
906257770 1:44363615-44363637 GAATGTAAGCTCTATGAGGGCGG - Intergenic
906480371 1:46195554-46195576 GAATATAAGCTCCATGAGGGTGG + Intronic
906949099 1:50319780-50319802 AAGTGAAGGCTTCAGGAGGGTGG - Intergenic
907369787 1:53993220-53993242 TCATGTCAGCTGCAGCAGGGAGG - Intergenic
907735578 1:57108563-57108585 AAATGTAAGCTCCTTGAGGCAGG + Intronic
907831864 1:58071944-58071966 GAATGTAAGCTTCAAGAGGGTGG - Intronic
908224614 1:62043592-62043614 AAATGGAAGATGCTGGAGGCTGG - Intronic
909236912 1:73164451-73164473 AAATGTAAGCTGTTGAAGGTTGG - Intergenic
910042772 1:82873547-82873569 AAATGCGAGCTGGAGAAGGGTGG + Intergenic
910218428 1:84865234-84865256 GAGTGTAAGCTCCAGGTGGGTGG + Intronic
911137819 1:94460547-94460569 GAATGTAAGCTCCATGAGGGTGG - Intronic
911297282 1:96133032-96133054 AAATGTAAGACCCAGGAGGGAGG - Intergenic
911739829 1:101375502-101375524 AAATGTAAACGGCAAGAGAGAGG + Intergenic
912099219 1:106185000-106185022 AAAAGTTAGCTGCAGGGGTGGGG + Intergenic
912347055 1:108973405-108973427 AAATATAAGCTCCATCAGGGAGG + Intronic
912472904 1:109917867-109917889 AAATGTAAGTTCCAGGAATGTGG - Intronic
913376122 1:118154402-118154424 CATTGTGAGCTGCAGCAGGGGGG + Intronic
913459011 1:119063824-119063846 AAAAGTTTGCTGCAGGAGCGAGG + Intronic
914872273 1:151485038-151485060 AAATATAAGCTGGAGTAGAGTGG + Intergenic
915770530 1:158417721-158417743 ATATGTAATTTGCAGGAGAGGGG - Intergenic
916388145 1:164300251-164300273 AAAATTAAGTTGCAAGAGGGAGG + Intergenic
917505202 1:175621093-175621115 GACTGTTAACTGCAGGAGGGTGG + Intronic
917699757 1:177568422-177568444 AGATGTCAGCTTCATGAGGGAGG + Intergenic
918462821 1:184793767-184793789 AAATGTAAGTTCTAGGAGGAAGG + Exonic
919376090 1:196796420-196796442 AAATGTTTGCTGCAGGGGTGGGG + Intergenic
919385794 1:196921309-196921331 AAATGTTTGCTGCAGGGGTGGGG + Intronic
919409684 1:197227813-197227835 AAAAGTTTGCTGCAGGAGCGGGG - Intergenic
919799569 1:201345347-201345369 AAGAGTCAGCTGCAGGAGGGAGG - Intergenic
920044417 1:203124299-203124321 AAATCTGAGCAGAAGGAGGGTGG + Intronic
920296668 1:204961611-204961633 GAAGCTAAGCTGCAGGAGGTTGG - Intronic
920654071 1:207862102-207862124 AACTGTAAGCTCCAGGAGTTGGG + Intergenic
920710275 1:208288156-208288178 AAAGGTAAACCCCAGGAGGGAGG - Intergenic
920899387 1:210091700-210091722 CAATGTAGGATCCAGGAGGGAGG - Intronic
921678387 1:218003308-218003330 AAATGTATGCTCCAGGAAAGTGG - Intergenic
922122989 1:222692383-222692405 GAGTGTAAGCTTCAGGAGGGTGG - Intronic
923640680 1:235756696-235756718 AAATATAAGCTCCATGAGGGTGG - Intronic
924164045 1:241263778-241263800 AAATGTAAGGTTCATGAGGCCGG - Intronic
924863273 1:247949534-247949556 ACATGAAATCTGCAGAAGGGAGG + Exonic
924872271 1:248061358-248061380 ACATGAAATCTGCAGAAGGGAGG + Exonic
1063550645 10:7029633-7029655 ATATTGAAGCTGCAGGAGGGTGG + Intergenic
1063635381 10:7777599-7777621 GAATGTAAGCCACAGGAGGCAGG + Intronic
1064044056 10:11995445-11995467 GACTGTAAACTGCAGGAAGGAGG - Intronic
1064436844 10:15318171-15318193 AAATGTGACCAGCAGGAGAGGGG + Intronic
1064618341 10:17187585-17187607 GAATGTAAGCTCCTTGAGGGTGG - Intronic
1064829538 10:19446251-19446273 GAGTGTAAGCTGAAGCAGGGTGG - Intronic
1065126454 10:22578765-22578787 AAATGTAAGCTCCACGAAGGTGG + Intronic
1067318936 10:45199068-45199090 GGACGTCAGCTGCAGGAGGGCGG - Intergenic
1068050991 10:51949118-51949140 AATTGTAGGCTTCATGAGGGTGG - Intronic
1069158295 10:65054966-65054988 ACATCTTAGCTGCAGAAGGGAGG + Intergenic
1069288316 10:66744044-66744066 GAATGTAAACTGCAGGTGGCAGG + Intronic
1069598249 10:69686648-69686670 AAATGTTAGCTGGAGGGGGATGG + Intronic
1069967716 10:72135237-72135259 GAATGTGAGCTGCACAAGGGTGG - Intronic
1070510889 10:77159666-77159688 ATTTGTTAGCTACAGGAGGGGGG - Intronic
1070546447 10:77456588-77456610 AAATGTTTGCTGAAGGAGGGAGG + Intronic
1070602255 10:77873976-77873998 CAGTGTGAGCTGGAGGAGGGCGG - Intronic
1070699792 10:78593375-78593397 ATCTGCAAGCTGCAGAAGGGTGG + Intergenic
1071252584 10:83836077-83836099 AAATGTTACCTGCTGGAGCGTGG - Intergenic
1071265669 10:83962732-83962754 AAATGTAAGCTCCAAGACAGAGG - Intergenic
1071636061 10:87255382-87255404 AACTGAAAGCTCCAGGAGGCAGG + Intergenic
1071659180 10:87482562-87482584 AACTGAAAGCTCCAGGAGGCAGG - Intergenic
1072422190 10:95298346-95298368 AAATGTAAGCTCTACAAGGGAGG - Intergenic
1072805648 10:98422620-98422642 AAATGGAAGCTGCTGGAAAGAGG - Intronic
1073153265 10:101326552-101326574 AAATGTCAGCTGCAGAAGGATGG - Intergenic
1074131302 10:110579633-110579655 GAATGTAAGCTCCATGAGGGTGG + Intronic
1074426910 10:113359380-113359402 CAACGTAAGCTTCAAGAGGGTGG + Intergenic
1075354247 10:121756523-121756545 AAAAGTTTGCTGCAGGAGTGGGG - Intronic
1076549440 10:131268188-131268210 AGATGCCAGCTGCAGCAGGGAGG - Intronic
1076556095 10:131322340-131322362 AAATGTGAGCTGCATGTGGCAGG + Intergenic
1078925323 11:15869653-15869675 GACTGTAAGCTCCATGAGGGTGG + Intergenic
1078928985 11:15898970-15898992 AAATATAAGCTTCATGAGGGAGG - Intergenic
1079012748 11:16843039-16843061 AAATGTAAGCTACACGAGAGTGG + Intronic
1079559414 11:21803812-21803834 AAAAGTTTGCTGCAGGAGTGGGG - Intergenic
1080131391 11:28799268-28799290 AATTGTAATGTGCAGGAGAGAGG - Intergenic
1081254159 11:40871705-40871727 TAAAGGAAGCTGCAGGAGAGTGG - Intronic
1081603825 11:44514323-44514345 AAATGTAAGCTTCATAAGGCAGG - Intergenic
1082814736 11:57500449-57500471 AAATGTAACCTCCAGCAGGGAGG + Intronic
1083691387 11:64411056-64411078 AAATATAAGCTCCATGAGGGTGG - Intergenic
1083869877 11:65480202-65480224 GAATGTAAGCTCCAGGAAGGTGG + Intergenic
1084370818 11:68741543-68741565 AAATGTAAGCTGCAGGAGGGCGG + Intronic
1085194316 11:74659040-74659062 AAAAGTTTGCTGCAGGAGTGGGG - Intronic
1085562143 11:77481825-77481847 AAATGTAAGCTTCTTGAGTGTGG + Intergenic
1085755049 11:79195196-79195218 AAAAGTCTGCTGCAGGAGTGGGG + Intronic
1086221594 11:84451698-84451720 CAATGTAAGCTCCATGAGGTAGG - Intronic
1088446112 11:109930384-109930406 AAATAGAAGCAGCAGGAAGGTGG - Intergenic
1088765745 11:112974789-112974811 AACTGTAAGCTACAGGAGGGTGG - Intronic
1088833525 11:113558198-113558220 AAATGTTCTCTGCAAGAGGGAGG - Intergenic
1089113399 11:116074563-116074585 GAATGAAAGCTAGAGGAGGGCGG + Intergenic
1090381650 11:126331697-126331719 GGATGTAAGCTGCACGAGGTGGG - Intronic
1090736967 11:129618545-129618567 GAATGTAAGCTCCGGGGGGGAGG + Intergenic
1090961965 11:131565173-131565195 AAGGGTCAGCTGCAGGAAGGGGG - Intronic
1091393537 12:140018-140040 AAATGTCAGGTCCAGGAGGCAGG + Intronic
1091411070 12:239657-239679 CAATGAAAGCCCCAGGAGGGTGG + Intronic
1091689961 12:2589205-2589227 ATATGTCAGTTCCAGGAGGGTGG - Intronic
1093707102 12:22286548-22286570 ACATGTAGGCAGCAAGAGGGGGG - Intronic
1095463759 12:42469079-42469101 AAATGTATCCAGCAGGAGGCTGG - Intronic
1095948430 12:47767063-47767085 AAGGCGAAGCTGCAGGAGGGGGG + Intronic
1096531138 12:52243585-52243607 AAATGCAAGATGCAGGAAGCAGG - Intronic
1096575981 12:52553093-52553115 AAAGCTCAGATGCAGGAGGGAGG + Exonic
1096765832 12:53888506-53888528 AAATATAAGCATCAGGAGGATGG - Intergenic
1096829378 12:54302213-54302235 AAATGTAAGCTGCAGATGTCAGG - Intronic
1097460612 12:59857294-59857316 AGAAGTAGGCTTCAGGAGGGAGG + Intergenic
1097635899 12:62121738-62121760 AAATGTAAGGTTCAGGAGATAGG + Intronic
1098238622 12:68442997-68443019 AAAGGTTTGCTGCAGGAGTGGGG - Intergenic
1099437089 12:82658121-82658143 AAATGGAGGCTGCAGGAGGAAGG + Intergenic
1099476331 12:83111674-83111696 AAATGTAAGCTCCATGAGACTGG + Intronic
1099693905 12:85994075-85994097 AGATGCCAGCTGCAGCAGGGAGG - Intronic
1099893552 12:88617922-88617944 GAATGTAAGCAGTAGGAGGTCGG + Intergenic
1100129938 12:91479759-91479781 AACTGTAAGCTCCATGGGGGCGG - Intergenic
1100361850 12:93886459-93886481 AAATGTAAGAAGCAAGAGGCAGG - Intronic
1100605097 12:96145660-96145682 AAATGTAAATTACACGAGGGTGG - Intergenic
1100666205 12:96756136-96756158 GAATGTAAGATACAGGAGGAGGG + Intronic
1100913999 12:99397421-99397443 GAATGTAAGCTGCAATAGGTTGG - Intronic
1100988348 12:100226493-100226515 AAACGTCCGCTGCAGGGGGGAGG + Intronic
1101542477 12:105677358-105677380 AAAAGCCAGCTGCAGGAGGAAGG + Intergenic
1101987995 12:109462314-109462336 AAGTGGAAGCCGCTGGAGGGTGG - Intronic
1102566172 12:113798826-113798848 AGATGTGAGCTTCAGGGGGGCGG + Intergenic
1106118306 13:26836468-26836490 ACATGTGAGCTGCAGGGGGTGGG + Intergenic
1106700296 13:32221939-32221961 TAATGTAAGCTCCAGGAGAGTGG - Intronic
1106801312 13:33259137-33259159 GAATGGAAGCTCCTGGAGGGTGG + Intronic
1107314212 13:39113645-39113667 AAATATAAGCTCCATGAGGGTGG + Intergenic
1107673950 13:42775924-42775946 AAAAGTAGGCTTCAGAAGGGGGG - Intergenic
1108542312 13:51455724-51455746 GCATGCCAGCTGCAGGAGGGCGG + Intergenic
1109114016 13:58357818-58357840 AAATGTAACCTGGATAAGGGTGG - Intergenic
1109370376 13:61414219-61414241 GAATGTTAGCTGGATGAGGGTGG - Intronic
1110611254 13:77490606-77490628 AAATGTATGCTGCAAGAGAGTGG + Intergenic
1113012020 13:105779074-105779096 GAATGTAACCTTCATGAGGGTGG - Intergenic
1113552064 13:111200207-111200229 AAATGAAGGATGCAGCAGGGAGG - Intronic
1113650607 13:112031768-112031790 CAATGCAAGTTGCAGGAGGATGG - Intergenic
1113992065 14:16035591-16035613 AAAGGCCAGCTGGAGGAGGGTGG - Intergenic
1114526386 14:23369292-23369314 AAACGTAAGCTTCATGAGGCAGG + Intergenic
1115196642 14:30807770-30807792 GAATGTAAGCTCCAGGAGGGTGG - Intergenic
1116105675 14:40501260-40501282 GAGTGTAAGCTCCACGAGGGCGG - Intergenic
1116275251 14:42824467-42824489 AGAAGTTAGCTGCAGGGGGGAGG + Intergenic
1117769502 14:59118772-59118794 GAATGTGAGCTCCAGGAGGCAGG + Intergenic
1118598692 14:67455844-67455866 AAATGTAAGCTCCAGAGGGTAGG - Intronic
1118778178 14:68987490-68987512 AAATGTAAGTTCCATGAGGTAGG - Intergenic
1118931393 14:70244868-70244890 AAATATAATCTCCATGAGGGTGG - Intergenic
1118953771 14:70460274-70460296 AAATATAATCTCCATGAGGGTGG + Intergenic
1119885365 14:78136047-78136069 TAATGTAAGCTCCACAAGGGAGG - Intergenic
1120575338 14:86174649-86174671 AAAAGTTTGCTGCAGGAGTGGGG + Intergenic
1121208992 14:92192398-92192420 AAATGTAAGCTCCATAAGAGCGG + Intergenic
1121427358 14:93861970-93861992 AGATGTCAGCTCCAGGAGGAAGG - Intergenic
1121828687 14:97031417-97031439 GAATGTAAGCTCCATGAGGCAGG - Intergenic
1122051010 14:99059868-99059890 AAATGGAAGCTGTGGGAGGGAGG + Intergenic
1122328406 14:100896677-100896699 AACTGTCAGCTGCAGGAGAACGG - Intergenic
1122501930 14:102206594-102206616 AAATGTAAGGTGCAGGAATTGGG + Intronic
1123457857 15:20442389-20442411 AAATGTGAGCTGAGGGAGTGGGG - Intergenic
1123660212 15:22558020-22558042 AAATGTGAGCTGAGGGAGTGGGG + Intergenic
1123693088 15:22855555-22855577 GAATGTAAGCTTCATGTGGGTGG - Intronic
1124165936 15:27325645-27325667 GAATATAAGCTCTAGGAGGGAGG + Intronic
1124264003 15:28217550-28217572 AAATGTGAGCTGAGGGAGTGGGG - Intronic
1124314071 15:28652515-28652537 AAATGTGAGCTGAGGGAGTGGGG + Intergenic
1124422916 15:29538088-29538110 GAATGCACGCTGTAGGAGGGTGG + Intronic
1124468979 15:29966701-29966723 AAATGTAAGTTGCATGAGGGAGG - Intronic
1124844553 15:33277711-33277733 AAATGTAACTAACAGGAGGGTGG - Intergenic
1125435882 15:39645277-39645299 TCATGTCAGCTGCAGCAGGGAGG + Intronic
1125739540 15:41952485-41952507 AAATAGGAGGTGCAGGAGGGAGG + Intronic
1128458065 15:67844080-67844102 AAAGTTAAGCTGAAGGGGGGTGG + Intergenic
1128509629 15:68305417-68305439 GAATGTCAGCTGTAGGAGAGTGG + Intronic
1130156962 15:81358823-81358845 AAATGTAAGGGGCACGAGTGCGG + Intronic
1130224134 15:82045149-82045171 AAATGTAAGATGCTTGGGGGAGG - Intronic
1130341954 15:83007075-83007097 AAATAGAATCTGCAGGAGGGGGG - Intronic
1131166396 15:90145090-90145112 AAATGAAGGGTGAAGGAGGGAGG - Intergenic
1131907787 15:97163192-97163214 TGATGTAAGCTGTAGGAGTGGGG - Intergenic
1133846867 16:9462943-9462965 AAATGCAAGCTTCATGAAGGTGG - Intergenic
1133864974 16:9633781-9633803 AGATGTGAGCAGCTGGAGGGTGG - Intergenic
1136538269 16:30913290-30913312 AACTGTGAGCTGAAGGAAGGAGG + Intergenic
1136607282 16:31344861-31344883 AAATGTGAGGTTCAAGAGGGAGG - Intergenic
1136702329 16:32155788-32155810 AAATGTGAGCTGAGGGAGTGGGG - Intergenic
1136765337 16:32771700-32771722 AAATGTGAGCTGAGGGAGTGGGG + Intergenic
1136802762 16:33098684-33098706 AAATGTGAGCTGAGGGAGTGGGG - Intergenic
1139136045 16:64206153-64206175 AAATGTCAGCTGCAGGGTTGGGG + Intergenic
1139618790 16:68119778-68119800 GAATGTAAGCTCCATGAGGAGGG + Intronic
1140054189 16:71511147-71511169 GAATGTGAGCTGAAGCAGGGCGG - Intronic
1140122382 16:72094440-72094462 GAATGTCAGCTCCAGGTGGGCGG + Intronic
1141013897 16:80429465-80429487 AGATCTAAGCTGCTGGAGGGAGG - Intergenic
1141121626 16:81362908-81362930 AAAGCTAAGAGGCAGGAGGGAGG - Intronic
1141233840 16:82197160-82197182 AATTGTAAGCCCCAGGAGGGCGG - Intergenic
1141239945 16:82256511-82256533 AAATGCAGACTGAAGGAGGGGGG + Intergenic
1141496618 16:84414773-84414795 AGATGGGAGCTGCAGGAGGCTGG + Intronic
1141962412 16:87417920-87417942 AAATCTTAGCTGCAGAAAGGTGG - Intronic
1203067725 16_KI270728v1_random:1033933-1033955 AAATGTGAGCTGAGGGAGTGGGG + Intergenic
1142964776 17:3573625-3573647 ATCTGGAAGCTGCAGGTGGGTGG - Exonic
1143490412 17:7282460-7282482 AAACCTGAGCTGGAGGAGGGGGG - Intronic
1144458422 17:15437590-15437612 GAATGCAAGCTGTAGGTGGGTGG - Exonic
1145837147 17:27963189-27963211 AAATGTTTGCTGAGGGAGGGAGG - Intergenic
1146083725 17:29807728-29807750 AAAGATAAGCTGCAGGAGACAGG + Intronic
1149437395 17:56644709-56644731 TAATGTAAGCTGCACATGGGGGG + Intergenic
1150200579 17:63352879-63352901 AAATATAAGCTTTAGGAGGATGG - Intronic
1150454806 17:65298672-65298694 AAATGAAAGCTGCAAGTGGCAGG - Intergenic
1150568629 17:66365290-66365312 AAATGTATTCTACGGGAGGGAGG + Intronic
1150875067 17:68961776-68961798 AAATGTATGCTGCACCTGGGAGG + Intergenic
1151663765 17:75533963-75533985 AGATGTCAGCTCCAGGAGGTGGG - Intronic
1152622335 17:81371558-81371580 AGATGAAAGCTGCCGGCGGGCGG - Intergenic
1152760216 17:82103696-82103718 AAAAGTGAGCTGAGGGAGGGGGG + Intronic
1152840773 17:82566719-82566741 AAAAGAAAGCAGCAGGTGGGAGG - Intronic
1153377854 18:4400917-4400939 AAAAGTAAACTTCAGTAGGGAGG - Intronic
1153775528 18:8450220-8450242 AACTTTAAGCTGCTGGAGAGTGG - Intergenic
1155085908 18:22457769-22457791 AATTGCGGGCTGCAGGAGGGAGG + Intergenic
1156131152 18:33976278-33976300 AAATGAAATCTGCAGAATGGTGG - Intronic
1156397077 18:36707963-36707985 ACATGAAGGCTGGAGGAGGGTGG - Intronic
1158547950 18:58411692-58411714 AAATGTAAGGTGGGGGTGGGGGG + Intergenic
1159099306 18:63940528-63940550 GAGTGTAAGCTGAAGCAGGGTGG + Intergenic
1159467917 18:68809646-68809668 AAAGGTAAGCTCCATGAGAGTGG + Intronic
1159644296 18:70899043-70899065 AACTGGAGGCTGCAGGAGGGAGG + Intergenic
1160208538 18:76857502-76857524 TAATGTAACCTGAAGGAGGGTGG - Intronic
1160341743 18:78095164-78095186 AAATGTAAGCTGCATGGGGTGGG + Intergenic
1161309020 19:3583731-3583753 GAATGTCAGCTCCAGGAGGGTGG - Intergenic
1161334952 19:3708109-3708131 AGATGCAAGAAGCAGGAGGGAGG + Intronic
1161427126 19:4209909-4209931 ATAAGTAAGCGGCAGGAGGCAGG + Intronic
1162181059 19:8868990-8869012 TAATGTAATCTCCAGGGGGGCGG - Intronic
1162387417 19:10368194-10368216 AAATAAAACCTGCAGGAAGGAGG + Exonic
1164269102 19:23654550-23654572 GAATGTAAGTTGCACAAGGGAGG - Exonic
1164727255 19:30474462-30474484 AAATGTCTGCTGGAGGAGGTGGG - Intronic
1164863887 19:31587821-31587843 GAATGTAAGCTCCATGAGGATGG + Intergenic
1165175961 19:33930021-33930043 GAATGTAAGCTTCATGAGGACGG - Intergenic
1165393461 19:35551192-35551214 AGATGTCAGCAGCAGCAGGGAGG + Intronic
1165963842 19:39557883-39557905 ACAAGAAAGCTGCAGGAGGAAGG - Intergenic
1166753645 19:45177652-45177674 AAATGTAAGCTTCACAAGGAAGG + Intronic
1167102977 19:47415440-47415462 AAATGTAGCTTGCAGGTGGGTGG - Intronic
1167255892 19:48428480-48428502 TAATCTCAGCTACAGGAGGGAGG - Intronic
1167531975 19:50023578-50023600 GAATGTAAGCTTCATGATGGCGG + Intronic
925208408 2:2026638-2026660 CAAGGTTCGCTGCAGGAGGGCGG + Intronic
925257091 2:2499506-2499528 AAAAGTTTGCTGCAGGAGTGGGG - Intergenic
925599210 2:5590827-5590849 GAGTGTAAGCTCCTGGAGGGTGG - Intergenic
926072687 2:9912224-9912246 AAGTGTGAGCTTCTGGAGGGAGG + Intronic
926188184 2:10707985-10708007 GAATGTAGGCTTCAGGAGGTCGG + Intergenic
927155563 2:20219331-20219353 AAATGAAAGCTTCCTGAGGGCGG + Intronic
927241194 2:20920721-20920743 AAAAGTAAGCTCCAGGTGGGTGG - Intergenic
927571777 2:24166599-24166621 AAATGTAAGCTCCAGGAAATCGG - Intronic
927884812 2:26711888-26711910 CACTGTAAGCTGCAGCTGGGGGG + Intronic
927988962 2:27433778-27433800 AACTACAAGCTGCAGGAGGTAGG + Exonic
928051153 2:27996732-27996754 AAATTTAGGGTACAGGAGGGAGG - Intronic
930264592 2:49185469-49185491 AAAAGTAAGCTTCAGAAGGTGGG - Intergenic
931581365 2:63778952-63778974 AAATCTAGGCAGCAGAAGGGAGG - Intronic
932186783 2:69703925-69703947 ACATTTAAGCTGCGGGGGGGTGG - Intronic
932433504 2:71689401-71689423 AACTGTGAGCTCTAGGAGGGTGG - Intergenic
935605971 2:104972540-104972562 AAATGTAAGCTCCCCAAGGGTGG + Intergenic
936483261 2:112905394-112905416 TAATGCAGGCTGCAGGAGGCAGG + Intergenic
936811490 2:116407974-116407996 GCATGAAAGCAGCAGGAGGGAGG + Intergenic
937381317 2:121380038-121380060 AACTGTGAGCTGCAGGTGAGAGG + Intronic
937692834 2:124775794-124775816 AAATGTAAGCTGCAAGCGTGTGG + Intronic
938328041 2:130427586-130427608 AATTATAAACTGCAGGAAGGAGG + Intergenic
938361907 2:130693892-130693914 AATTATAAACTGCAGGAAGGAGG - Intergenic
939182325 2:138818052-138818074 GTCTGTAAGCTGCATGAGGGTGG + Intergenic
939571593 2:143846571-143846593 TAATGTAAGCTCCATGAGAGAGG + Intergenic
939837547 2:147149824-147149846 AAATGCCAGCTGCAGCGGGGAGG + Intergenic
940362732 2:152813474-152813496 CAGTGGCAGCTGCAGGAGGGAGG + Intergenic
941151277 2:161918753-161918775 AGATGCCAGCTGCAGTAGGGAGG + Intronic
942076157 2:172358957-172358979 AAAAGTGAACTGCATGAGGGAGG - Intergenic
942206812 2:173627304-173627326 AAATGTCAGCTCCATAAGGGCGG + Intergenic
942444495 2:176069051-176069073 AAATGAAAGCAGCAGGATGTTGG - Intergenic
942854831 2:180532560-180532582 GAGTGTAAGCTGAAGCAGGGCGG - Intergenic
943317238 2:186405295-186405317 GAATCTAAGCTGCATGAAGGAGG - Intergenic
943575973 2:189631683-189631705 AAATGTAAGCTGCATGTGTCAGG - Intergenic
946507835 2:220320549-220320571 AAACATAAGCTCCAGGAGGATGG - Intergenic
946579922 2:221117359-221117381 AAGTGTAAACTTCAAGAGGGTGG + Intergenic
948232729 2:236363726-236363748 AAATGTAATTTGAAAGAGGGAGG + Intronic
1168772020 20:421460-421482 GAATGTAAGCTGCAGGAGGCAGG - Intronic
1169416823 20:5424281-5424303 AAATGTAGGCTGCAGGAGCAGGG - Intergenic
1169495908 20:6114941-6114963 AAATGTAAGCTCCAGGTGGCAGG + Intronic
1170102600 20:12718946-12718968 AAATGAAAGATTAAGGAGGGAGG + Intergenic
1170487404 20:16832767-16832789 AGATGCAAGCTGAAGGAGGAGGG - Intergenic
1170978719 20:21190954-21190976 AATTGTAAGATGGAGGAGGAGGG + Intronic
1171384588 20:24761662-24761684 GACTGTCAGCTGCAGGAGGGCGG + Intergenic
1172138133 20:32701870-32701892 AAAAGAAAGGTGCAGGACGGTGG + Intergenic
1172772077 20:37387668-37387690 AACTGGGAGCTGCTGGAGGGTGG + Intronic
1173551573 20:43936553-43936575 AACTGCCAGCTGCACGAGGGAGG - Intronic
1173605909 20:44331313-44331335 AAATCCAAGCAGGAGGAGGGAGG - Intergenic
1173748397 20:45456082-45456104 AAATGTCAGCTCCAGGAGGGTGG - Intergenic
1174970876 20:55274323-55274345 AAATGTAAGCTTCATGAAGCAGG + Intergenic
1175653178 20:60746620-60746642 AGAAGTCAGCTGGAGGAGGGTGG + Intergenic
1176084854 20:63291228-63291250 AAATGTGAGCTCCACAAGGGCGG - Intergenic
1176935357 21:14860750-14860772 AAAAGTTTGCTGCAGGAGTGGGG - Intergenic
1177322788 21:19544252-19544274 ACATGTAAGTGACAGGAGGGTGG + Intergenic
1177337874 21:19756433-19756455 AAATGTCAGATACAGGAGAGTGG - Intergenic
1177756530 21:25355530-25355552 AAATGTTATCTGAAGGAGAGAGG + Intergenic
1178381325 21:32111975-32111997 GAATATAAGCTCCATGAGGGCGG + Intergenic
1178382507 21:32122420-32122442 AAATGAAAGATGGAAGAGGGAGG + Intergenic
1178662375 21:34518665-34518687 AAATAGGAGCTGCATGAGGGAGG - Intronic
1178664330 21:34533618-34533640 GAATGTAAGCTCCAAGAGGGCGG - Intronic
1178780880 21:35602799-35602821 GAATCCAGGCTGCAGGAGGGAGG + Intronic
1178870161 21:36366937-36366959 AAACCTAAGCTGCTGGAGGATGG + Intronic
1178875858 21:36413379-36413401 AAATTTCACCTGCAGCAGGGTGG - Intronic
1179177883 21:39021922-39021944 AAATGAAGACTGCAGGATGGTGG + Intergenic
1179304950 21:40145278-40145300 GAATGTAAGCTCCATGAGGACGG - Intronic
1179924435 21:44526539-44526561 AAATGCAGCCTGCATGAGGGTGG + Intronic
1180015381 21:45079004-45079026 AAAAGCAAGCTGCAGTAAGGAGG - Intronic
1180315206 22:11271936-11271958 AAAGGCCAGCTGGAGGAGGGTGG + Intergenic
1181901398 22:26159272-26159294 GAATGTCAGTTGCATGAGGGCGG - Intergenic
1182008606 22:26981866-26981888 AAGATTAAGCTGCCGGAGGGTGG + Intergenic
1182029493 22:27146749-27146771 AAATGCCAGCTGCAGTGGGGTGG + Intergenic
1184059864 22:42074956-42074978 GAATGTAGGCTCCAGGAGGGCGG + Intronic
1184512078 22:44939741-44939763 AAAGGCCACCTGCAGGAGGGTGG + Intronic
1184566933 22:45297733-45297755 AAATGGAGGCTGCAGGAGGTGGG - Intergenic
1184817591 22:46884090-46884112 AAATGTGAGGTCCACGAGGGCGG - Intronic
1185358047 22:50386827-50386849 AAAGTTAGGCTGAAGGAGGGTGG + Intronic
950043576 3:9935071-9935093 GAATGTGAGCTCCAGGAAGGGGG - Intronic
950457759 3:13102785-13102807 AAATGTAAGCTCCAGGAGGCGGG + Intergenic
951292299 3:20887653-20887675 AGATGTAAGCTGTAAGAGGCAGG + Intergenic
951320086 3:21233936-21233958 AAATGTCAGCTCTTGGAGGGAGG + Intergenic
951446139 3:22782561-22782583 AAAAGTTTGCTGCAGGAGTGGGG - Intergenic
952061386 3:29515152-29515174 AGGTGAAAGCTGCAGGAGGAAGG + Intronic
953144167 3:40258544-40258566 AAAGGAAAACTGCTGGAGGGAGG + Exonic
953813266 3:46132526-46132548 AAAAGGAGGCTTCAGGAGGGAGG + Intergenic
954755689 3:52838353-52838375 AATTGTGAGCTCCAGGAAGGTGG + Exonic
954867965 3:53745682-53745704 AAACATGAACTGCAGGAGGGTGG - Exonic
955278640 3:57572724-57572746 AAAAGAAAGCTGAATGAGGGGGG - Intronic
955811484 3:62795377-62795399 AGATGTAAGCTCCATGAGGTAGG + Intronic
955990705 3:64624050-64624072 AAATGCCAGGGGCAGGAGGGAGG + Intronic
956150951 3:66241785-66241807 AAACCTATGCTGCAGGAGTGAGG + Intronic
956373140 3:68586113-68586135 AAAAGTAAGCTTCAGAAGGTCGG - Intergenic
956479941 3:69663165-69663187 AAATGTAAACTGCTGGAGGTCGG - Intergenic
956592500 3:70929702-70929724 AAATGCAAGGTGGAGGAGAGAGG + Intergenic
957253314 3:77803433-77803455 AAATTTAAGCTCTATGAGGGCGG + Intergenic
957625728 3:82650405-82650427 TGATGTCAGCTGCAGAAGGGAGG + Intergenic
959128852 3:102326036-102326058 TAATGTAAGCTTCAAGAGGGTGG - Intronic
959429304 3:106232919-106232941 TAATGTATGCAGCAGGAGGAAGG + Intergenic
959432266 3:106269874-106269896 GAATGTAAGCTCCATGAGGACGG + Intergenic
959830733 3:110858767-110858789 AAAAGCAAGCTGCAAGAGGAAGG + Intergenic
960166459 3:114407895-114407917 AAATGTAACCTATATGAGGGGGG + Intronic
961093840 3:124138145-124138167 AAGAGAAAGCTGCAGGAGGGTGG - Intronic
961194586 3:124990939-124990961 AAATGAAACCTGCATGAGGTAGG - Exonic
961386728 3:126526991-126527013 AAATGTAAGCTCCTCGAGGCAGG - Intronic
961961985 3:130864837-130864859 AAATGTTTGCTGCAGGGGTGGGG + Intronic
961979498 3:131062084-131062106 AAATGTAAGCTCCTAGAGGAGGG - Intronic
962105424 3:132383759-132383781 TAATGCCAGCTGCAGGAGGAAGG - Intergenic
962233819 3:133691424-133691446 GAATGTAAGCTCCATGAAGGTGG - Intergenic
963810572 3:149772680-149772702 AGATCCAAGCTTCAGGAGGGTGG + Intronic
964605539 3:158556378-158556400 AAAAGTTTGCTGCAGGAGTGGGG + Intergenic
965190384 3:165520304-165520326 AAATGTAAGCTCCATGAGAGTGG - Intergenic
965325548 3:167299439-167299461 AAATATAAGCTTCAGTAGAGTGG - Intronic
965961908 3:174439611-174439633 AACTGTAAGCTCCTGGTGGGTGG + Intronic
966099900 3:176255071-176255093 AAGTGTAAGTTGCATGAGGCCGG + Intergenic
966259579 3:177959773-177959795 AAATTGATGCTGCAGGAGAGAGG - Intergenic
966855163 3:184188857-184188879 AAAGGAAATCTGAAGGAGGGAGG - Intronic
967298600 3:187990019-187990041 AAATGGGAGATGCAGGAGGTGGG - Intergenic
967445301 3:189558922-189558944 ATATGGAAGGGGCAGGAGGGTGG + Intergenic
968328424 3:197842332-197842354 GAATGTAAGCTCCAGGAGTGCGG - Intronic
968397311 4:253697-253719 AAGTGTAAGGTGCAGAAAGGAGG + Intergenic
969222150 4:5767924-5767946 AATTCTAAGCTGCCGGTGGGGGG - Intronic
969360800 4:6662553-6662575 AAATGTAAGCTTCATCAGGGCGG - Intergenic
969360815 4:6662662-6662684 ACATGTAAGATGTAGGAGGAAGG + Intergenic
969477197 4:7428429-7428451 GAATGCGAGCTGCAGGAGGCAGG - Intronic
969964916 4:10984207-10984229 AAATAAAAGTTGCAGGAGGTAGG - Intergenic
970808536 4:20064152-20064174 AAATGTGAGCTCCTGGAGGCTGG + Intergenic
972347228 4:38202715-38202737 GAATGTAAGCTCCATGAGAGGGG + Intergenic
972356213 4:38281329-38281351 GAATGTAAGCCCCAGGAGGCTGG - Intergenic
972649157 4:40999533-40999555 AACTGTAAGCTGCAGAAAGAAGG - Intronic
972965368 4:44502387-44502409 GAATGTGAGCTGAAGCAGGGCGG - Intergenic
973334378 4:48941605-48941627 AGATGTAAGCTTGAGGAAGGCGG - Intergenic
973529349 4:51819275-51819297 AAATGGAAACTGGAGGAGTGGGG + Intergenic
973641795 4:52910549-52910571 AACTGTAAGCTTCTGGAAGGAGG - Intronic
974107793 4:57490515-57490537 ATATGCATTCTGCAGGAGGGAGG - Intergenic
974128070 4:57719815-57719837 AAATGTAAGCTCCATAAGAGCGG - Intergenic
974276314 4:59724714-59724736 GAATGTGAGCTGAAGCAGGGAGG - Intergenic
974460089 4:62176118-62176140 AACTGAAAGCAGCAGGAGTGGGG + Intergenic
975066505 4:70072328-70072350 AAATGTAAGCCCCATGAGGGAGG - Intergenic
975111944 4:70638347-70638369 AGAAGTAAGCTCCAGGGGGGTGG - Intronic
975507000 4:75148722-75148744 AAATGTTTGCTGCAGGGGTGGGG - Intergenic
976111841 4:81683758-81683780 AAATGTGACCTGCAGCTGGGAGG - Intronic
976408412 4:84685252-84685274 AAAGGTAAGGTGGAGGAGGCTGG + Intronic
979127208 4:116989417-116989439 GAACATAAGCTGCAGGAGGGCGG + Intergenic
979199874 4:117964523-117964545 AAATGGAAGCTGAAGGATGAGGG - Intergenic
979630480 4:122896380-122896402 AAAGGCAAGATGCAGGAGAGAGG + Exonic
980427648 4:132647232-132647254 AAGTGTAAGCTGAGGGAGAGGGG - Intergenic
980745109 4:137002067-137002089 GCATGTCAGCTGCAGCAGGGTGG - Intergenic
984312421 4:178079520-178079542 TAATGGAAGCATCAGGAGGGTGG - Intergenic
984583995 4:181542057-181542079 AAATTTAAGCTCTAGGAGGGAGG - Intergenic
984964123 4:185126475-185126497 GAATGTGAGCAGCAGGACGGAGG + Intergenic
987632608 5:20494377-20494399 AAATGTAAACTTCAAGAGGGAGG + Intronic
987912124 5:24161287-24161309 AGATGGAAGGTGCAGGAGGCTGG + Intronic
988885443 5:35552541-35552563 GACTGTATCCTGCAGGAGGGGGG - Intergenic
989460891 5:41697003-41697025 AGCTGTAAGGTGCAAGAGGGAGG - Intergenic
989744543 5:44812425-44812447 AAAAATAAGCTGCATGAGGGAGG - Intronic
989778103 5:45233074-45233096 AAAAGTTTGCTGCAGGGGGGAGG - Intergenic
989987205 5:50714780-50714802 CACAGTCAGCTGCAGGAGGGAGG - Intronic
990353572 5:54942266-54942288 AATTGCAAGCAGCAGGAGGTGGG - Intergenic
990548964 5:56853550-56853572 AACTGTAAGCTCCATGAGTGAGG - Intronic
990857632 5:60287872-60287894 ATGTGTAAGCTCCAAGAGGGAGG + Intronic
991592615 5:68269390-68269412 AAATGTAAACTGTTGGAGGATGG + Intronic
991617372 5:68510969-68510991 AATTGTAAGCTCCTTGAGGGAGG - Intergenic
992532783 5:77668553-77668575 GAATGGAGGCTCCAGGAGGGAGG + Intergenic
992729699 5:79650310-79650332 AAATGTAAGCTTCATGAAGAAGG - Intronic
993742209 5:91555534-91555556 GAGTGTGAGCTGAAGGAGGGCGG + Intergenic
993990257 5:94648140-94648162 AAGTGTAACTTGCAGGTGGGGGG - Intronic
995149821 5:108829800-108829822 AAATGGAAGCTCCATGAAGGCGG - Intronic
996011238 5:118483592-118483614 AAAAGTATGCTGCAGGGGAGGGG - Intergenic
996279312 5:121708955-121708977 AAATGTTACTTGCAGGAGAGAGG + Intergenic
996332355 5:122344150-122344172 AAATGTAAGCTTCATGAAAGCGG + Intronic
996597930 5:125226695-125226717 AAATGTCAACTGCATGAGGATGG - Intergenic
996699841 5:126439214-126439236 AAAAGTAACCTGCAAGAGGTTGG + Intronic
997212624 5:132086429-132086451 CAAAGGAAGCTGCAAGAGGGAGG + Intergenic
997409197 5:133677896-133677918 AAATGTGAGCTCCATGAGAGTGG - Intergenic
997801293 5:136865273-136865295 AGATGTAAGCTGCAGCAGGAGGG - Intergenic
998172462 5:139880726-139880748 ATATGGCAGCAGCAGGAGGGAGG + Intronic
998478362 5:142440565-142440587 GAATGTAAACTCCAGGAGGATGG + Intergenic
998550124 5:143069262-143069284 AAATGTAAGCTCCACGAGGTTGG + Intronic
999015180 5:148095084-148095106 AAATGTAATCTACAAGAGGAGGG - Intronic
999844321 5:155461832-155461854 CATTGTAAGCTGCTGGAGGCTGG + Intergenic
999853725 5:155570575-155570597 AAATCTAAGGTTCAGGAGTGAGG - Intergenic
1000640674 5:163698344-163698366 GACTGTAAGCTCCACGAGGGTGG + Intergenic
1001187353 5:169587190-169587212 GAATGTAAGTTTCATGAGGGAGG + Intronic
1001265331 5:170270089-170270111 GAATGTAAGCCCCAGGAGGCAGG + Intronic
1001376183 5:171260764-171260786 AAATGTAGGCTGATGGAGGAAGG + Intronic
1001570571 5:172727960-172727982 AAATGGAAGCTGCAGAGGGCAGG - Intergenic
1001684613 5:173584141-173584163 AAGTGTTAGCTGGAGTAGGGGGG + Intergenic
1002056759 5:176602389-176602411 AAATGCCAGCTCCAGGAGGTGGG + Intronic
1002981364 6:2141950-2141972 AAATGTATGCTATAGGAGCGGGG - Intronic
1003659317 6:8045351-8045373 AAAAGTTTGCTGCAGGAGTGGGG + Intronic
1003673850 6:8184740-8184762 ACGTGTGAGCTGCATGAGGGTGG - Intergenic
1005290734 6:24376286-24376308 AAATGTAACATGGAAGAGGGAGG + Intergenic
1006646043 6:35514889-35514911 GCATGTAAGCTGCACGAGGGCGG - Intergenic
1006902293 6:37511014-37511036 CCATGTAGGCTTCAGGAGGGAGG - Intergenic
1007543456 6:42671754-42671776 AAATGACAACTGCAGGATGGAGG - Intronic
1007649815 6:43412563-43412585 AGATGCCAGCTGCAGCAGGGAGG + Intergenic
1008033996 6:46727118-46727140 AAATGAAGTCTGCAGGAGAGAGG - Intronic
1008540181 6:52539619-52539641 AAACATAAGCTGTAGGAGCGTGG + Intronic
1008710135 6:54215007-54215029 GAATCTAAGCTACATGAGGGAGG - Intronic
1010795936 6:80116264-80116286 AAAGACAAACTGCAGGAGGGGGG - Intronic
1010980013 6:82361654-82361676 AATTGCCAGCTGCAGGAAGGTGG + Intergenic
1011123269 6:83978225-83978247 AAATGTAGGCTGGAGGGGAGAGG + Intergenic
1011158105 6:84356177-84356199 GAATGTAAGCTCCAGCTGGGCGG + Intergenic
1011856768 6:91702817-91702839 AAATGTAAGCTCCATGAGGGCGG - Intergenic
1014307198 6:119757742-119757764 AAATGAATGCTGCAGTAGAGTGG - Intergenic
1015182655 6:130377630-130377652 AAATGAAAGCAGCAGGATTGAGG - Intronic
1015669461 6:135672330-135672352 TAATGGAAGCCGCAGGAGGCAGG - Intergenic
1016125371 6:140395763-140395785 AACAGTGAGCAGCAGGAGGGAGG - Intergenic
1016291087 6:142528892-142528914 AAATGTGAGCTGAAGGGGGATGG - Intergenic
1016376623 6:143427723-143427745 GAATATAAGCTCCATGAGGGTGG + Exonic
1016422156 6:143896713-143896735 AAATGGAAGCTTAAGGAGGTTGG + Intronic
1016828995 6:148414938-148414960 GAATGTAAGCTCCAAGAGGCTGG - Intronic
1017941352 6:159055890-159055912 AAAGGGAAGGGGCAGGAGGGTGG + Intergenic
1018954264 6:168397547-168397569 AAATGTCAGCTGCAGAACAGAGG + Intergenic
1021403089 7:20232725-20232747 ATATGTTAGCTACAGGAGAGAGG - Intergenic
1022519559 7:30997251-30997273 GAATGTAAGCTGCATAAGGGTGG + Intergenic
1022595775 7:31712426-31712448 AAATGTCAGCCACAGGAAGGTGG + Intergenic
1022839696 7:34151357-34151379 AAATGTAAGCTCCTTGAGGGTGG - Intronic
1023340574 7:39215042-39215064 TAATGTAAGAAGCAGGAAGGAGG + Intronic
1023771955 7:43565793-43565815 AATTGGAAGCTGCAGGAAGTAGG - Exonic
1025925049 7:65951778-65951800 AAATGCAAGCTGCAGAACAGTGG - Intronic
1028889410 7:95970313-95970335 ACGTGGAGGCTGCAGGAGGGTGG - Intronic
1029446831 7:100618084-100618106 AAGTGTAAGCTACTGGAGGCAGG - Intergenic
1031004010 7:116451862-116451884 AAATGGATGCTGCAGGAGAGGGG - Intronic
1031783313 7:125997624-125997646 AAATGTTTGCTGCAGGGGTGAGG + Intergenic
1031945889 7:127840126-127840148 AACTGTAAGCTCCAAGAGTGGGG - Intronic
1033618761 7:143042715-143042737 AATTGTGAGCAGAAGGAGGGAGG - Intergenic
1035042974 7:155944355-155944377 ACACGTAAGCTCCATGAGGGAGG - Intergenic
1036173608 8:6514746-6514768 ACATGGAAGCTGGAGGAGGCGGG - Exonic
1036773617 8:11595102-11595124 GAATATATACTGCAGGAGGGGGG - Intergenic
1037952911 8:23030235-23030257 AACTGTCAGCTGCAAGGGGGTGG - Intronic
1037963150 8:23114971-23114993 AACTGTCAGCTGCAAGAGGGTGG + Intronic
1039228179 8:35413190-35413212 AAATCTAAGATGCAGGAGCATGG - Intronic
1039516685 8:38139756-38139778 AAATGTAAGCAGCACGAGGAAGG + Exonic
1039779078 8:40766069-40766091 AGATGGAGGCCGCAGGAGGGAGG - Intronic
1040679509 8:49791658-49791680 AAATGTAGTCTACAGGAGTGGGG - Intergenic
1040915284 8:52562608-52562630 AGATGTGAGCTGGAGGTGGGGGG - Intronic
1041074993 8:54161225-54161247 AAAAGTTTGCTGCAGGAGTGGGG + Intergenic
1042234775 8:66600657-66600679 AAATGTCAGCTCCATGAGCGTGG - Intronic
1042279071 8:67035783-67035805 GAATGTAAGCTCCATGGGGGTGG - Intronic
1042527019 8:69773956-69773978 TAATGAAAACTGCAGCAGGGTGG - Intronic
1043033162 8:75164522-75164544 AACTGTAAGTTGGTGGAGGGCGG + Intergenic
1043684714 8:83071175-83071197 ACAGGTAACCTGCATGAGGGCGG - Intergenic
1044399147 8:91750161-91750183 TTATGTAAGCTCCAGGAAGGTGG + Intergenic
1045842976 8:106600991-106601013 AAATAGAGGCTGGAGGAGGGAGG + Intronic
1046129285 8:109946796-109946818 AAAAGTTAGCTGCAGGGGTGGGG + Intergenic
1047236382 8:123045729-123045751 GAATGTAAGTTCCAAGAGGGTGG - Intronic
1047810710 8:128405764-128405786 AGATGTAAGCTCCATGAGAGTGG - Intergenic
1048326694 8:133444657-133444679 AAATGTAAGCTTCAAGATGGTGG + Intergenic
1048415474 8:134223633-134223655 ACATGAAAGCTGGAAGAGGGAGG - Intergenic
1049190924 8:141286895-141286917 CAATGTCAGCTGCAGTGGGGAGG + Intronic
1049571255 8:143371290-143371312 AACTGGAAGCCCCAGGAGGGTGG - Intronic
1049572253 8:143374788-143374810 AAATGTAAGCTCCAGCACGCTGG + Intronic
1050211062 9:3256654-3256676 TAATGTATGTTGCAAGAGGGAGG + Intronic
1050217157 9:3339675-3339697 GAATGTAAGCTTCATGTGGGCGG - Intronic
1050269316 9:3925321-3925343 GAATGTAATCTTCAGGAGAGTGG + Intronic
1050596029 9:7205497-7205519 AGATGTAAGCACCAGGAGGCAGG + Intergenic
1051035566 9:12740946-12740968 AAATATAAGCTGCAAGTGGAAGG - Intergenic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1054832132 9:69637198-69637220 GAATGAAAGCTGCAAGAGGCTGG + Intronic
1055297689 9:74851259-74851281 AAATGTCAATTCCAGGAGGGGGG + Intronic
1055647747 9:78376983-78377005 AAATGTAAGCTCCATGAGGGTGG - Intergenic
1055730381 9:79274475-79274497 AGATGTAAGCTGTAGGTGGATGG + Intergenic
1055942020 9:81659523-81659545 AAATGTAAGCAGCAGGATGAAGG + Intronic
1056850769 9:90081857-90081879 AAATATAAGTTCCAGGAGTGGGG + Intergenic
1057534308 9:95883916-95883938 GTATTTAAGCTGCAGGATGGTGG - Intronic
1057984220 9:99693431-99693453 AAATTAAAGCTGCTGGAGGCAGG - Intergenic
1058096497 9:100866372-100866394 AAATCTAAGCTCCAGAAGGGTGG + Intergenic
1058599976 9:106658830-106658852 ACTTGCAAGCTGCATGAGGGTGG + Intergenic
1058661212 9:107271090-107271112 AGCTGTAAGCAGCAGGATGGAGG + Intergenic
1058782246 9:108350082-108350104 AAATGTGAGCTCCTTGAGGGTGG + Intergenic
1059725868 9:117007555-117007577 GCATGTAAGCTTCATGAGGGTGG + Intronic
1060731989 9:126044597-126044619 AAATGGAAGGTCCAGGAGGCTGG - Intergenic
1060880879 9:127117208-127117230 ACTTGTGAGCTGAAGGAGGGAGG - Intronic
1061241984 9:129379854-129379876 AAAGGTAGGCTGCAGGATGCAGG - Intergenic
1061360334 9:130137750-130137772 AAACTCAGGCTGCAGGAGGGTGG - Exonic
1061651132 9:132050843-132050865 GAATGTAAGCTCCATGAGGGAGG + Intronic
1061785203 9:133023643-133023665 AAATGTGAGCTCCGTGAGGGCGG + Intergenic
1203363492 Un_KI270442v1:237845-237867 AAAGGCCAGCTGGAGGAGGGCGG + Intergenic
1186273966 X:7920028-7920050 GAATGTAAGCTCCAAGAGGCAGG - Intronic
1186582598 X:10836758-10836780 GACTGTAAGCTCCATGAGGGTGG - Intergenic
1187355764 X:18569771-18569793 AAATGTAAGGTGATGGAGTGAGG + Intronic
1188021835 X:25167283-25167305 GACTGTAAGCTTCAGAAGGGTGG + Intergenic
1188834439 X:34939201-34939223 AAATTTCACCTGCTGGAGGGAGG + Intergenic
1188960392 X:36484116-36484138 AAATGTGAGCAGCATGAGGAAGG + Intergenic
1189122897 X:38414008-38414030 AAATGTGGTCTGCAGGATGGTGG - Intronic
1189346864 X:40248385-40248407 AAATGAAAGATGGAGGAGGGAGG - Intergenic
1189725623 X:43965640-43965662 AAAAGAAAGGTGCAAGAGGGTGG - Intronic
1189746455 X:44173437-44173459 AAATGTAAGCTGCAGGCTGATGG + Intronic
1190619891 X:52276376-52276398 AAACGTAAGGAGCAGGAAGGTGG + Intergenic
1194075771 X:89391719-89391741 AAATTTAAGCTCCATGAGGCTGG - Intergenic
1194203671 X:90984698-90984720 AAAAGTAGGCTTCAGGAGGTGGG + Intergenic
1194297401 X:92143641-92143663 AAAAGTATGCTGCAGGGGCGGGG + Intronic
1195037646 X:100984661-100984683 AAACGTAAGCTATATGAGGGAGG - Intronic
1197264225 X:124348718-124348740 AAATATAATCTCCATGAGGGCGG + Intronic
1198155266 X:133953831-133953853 GAATGTAAGCTCCATGAGGGCGG - Intronic
1198302720 X:135347094-135347116 AACTGTAAACTGCTGGAAGGGGG + Exonic
1198926724 X:141804982-141805004 AAATATAAGCTGTATGAGGCTGG - Intergenic
1199073013 X:143500376-143500398 CACTGTAAGCTGCAAGACGGGGG + Intergenic
1199268929 X:145860074-145860096 AAATGTAATCTCCATGAGAGTGG + Intergenic
1200374943 X:155769821-155769843 AGATGTATGCGGTAGGAGGGAGG + Intronic
1200549504 Y:4560137-4560159 AAAAGTAGGCTTCAGGAGGTGGG + Intergenic
1200614970 Y:5368542-5368564 AAAAGTATGCTGCAGGGGCGGGG + Intronic
1200731373 Y:6745874-6745896 AAATTTAAGCTCCATGAGGCTGG - Intergenic