ID: 1084375437

View in Genome Browser
Species Human (GRCh38)
Location 11:68773643-68773665
Sequence TGACATGAGCAGGCCAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1118
Summary {0: 1, 1: 4, 2: 91, 3: 287, 4: 735}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084375427_1084375437 24 Left 1084375427 11:68773596-68773618 CCCTGACCCCGGAGGAGCAGCTG 0: 1
1: 0
2: 0
3: 21
4: 262
Right 1084375437 11:68773643-68773665 TGACATGAGCAGGCCAGGAGAGG 0: 1
1: 4
2: 91
3: 287
4: 735
1084375429_1084375437 18 Left 1084375429 11:68773602-68773624 CCCCGGAGGAGCAGCTGCAATGT 0: 1
1: 0
2: 1
3: 14
4: 153
Right 1084375437 11:68773643-68773665 TGACATGAGCAGGCCAGGAGAGG 0: 1
1: 4
2: 91
3: 287
4: 735
1084375428_1084375437 23 Left 1084375428 11:68773597-68773619 CCTGACCCCGGAGGAGCAGCTGC 0: 1
1: 1
2: 1
3: 27
4: 291
Right 1084375437 11:68773643-68773665 TGACATGAGCAGGCCAGGAGAGG 0: 1
1: 4
2: 91
3: 287
4: 735
1084375430_1084375437 17 Left 1084375430 11:68773603-68773625 CCCGGAGGAGCAGCTGCAATGTT 0: 1
1: 0
2: 4
3: 15
4: 261
Right 1084375437 11:68773643-68773665 TGACATGAGCAGGCCAGGAGAGG 0: 1
1: 4
2: 91
3: 287
4: 735
1084375431_1084375437 16 Left 1084375431 11:68773604-68773626 CCGGAGGAGCAGCTGCAATGTTA 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1084375437 11:68773643-68773665 TGACATGAGCAGGCCAGGAGAGG 0: 1
1: 4
2: 91
3: 287
4: 735

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084375437 Original CRISPR TGACATGAGCAGGCCAGGAG AGG Intronic
900134848 1:1112058-1112080 AGACGTGAGCAGGGCAGGATCGG + Intronic
900135220 1:1114269-1114291 AGACATGAGCAGGGCAGAAGAGG - Intronic
900173292 1:1281037-1281059 GGGCATGGGCAGGCCAGGGGTGG - Intronic
900868648 1:5286356-5286378 GGACATGTGCAGGCTTGGAGTGG + Intergenic
901047230 1:6404415-6404437 TGACATGACCTGGCCGGGCGCGG + Intergenic
901729284 1:11267188-11267210 AGGCATGAGCAGAGCAGGAGAGG - Intergenic
902096568 1:13950654-13950676 AGGCCTGAGCAGACCAGGAGAGG + Intergenic
902120786 1:14163737-14163759 AGACACGTGCAGGGCAGGAGAGG - Intergenic
902561378 1:17279728-17279750 TACCATGAGCAGGCCCCGAGGGG - Intronic
902800469 1:18826457-18826479 GGTGAAGAGCAGGCCAGGAGTGG + Intergenic
903309576 1:22444026-22444048 AGACATAAGCGGGGCAGGAGAGG + Intergenic
903456705 1:23492442-23492464 TGACTGGAGCAGGGGAGGAGAGG - Intergenic
903543599 1:24110253-24110275 TGACAGGAGCAGGCCAAGGCAGG - Intronic
904125421 1:28235120-28235142 AGAAAAGAGCAGGCCAGGCGCGG - Intergenic
904302280 1:29561968-29561990 TGACATCAGCAGGGCAGGAAGGG - Intergenic
904817902 1:33219582-33219604 TGAGATGTGCTGGCCAGGAGAGG + Intergenic
905542646 1:38772560-38772582 GGACATGAGCAGGTCAGGTGAGG - Intergenic
905610342 1:39344996-39345018 AGATATGAGCAGGGCATGAGAGG - Intronic
905687353 1:39918076-39918098 TTTCAAGAACAGGCCAGGAGTGG + Intergenic
905690936 1:39942206-39942228 ACACATGAGCAGGGTAGGAGAGG - Intergenic
905897563 1:41558571-41558593 CCCCAAGAGCAGGCCAGGAGGGG - Intronic
907253008 1:53155692-53155714 AAGCATGAGCAGGGCAGGAGAGG + Intergenic
907417324 1:54323503-54323525 TCTGATGAGCAGGCCAGGACAGG - Intronic
908478074 1:64508327-64508349 TTACATGAGAATGCCTGGAGAGG + Intronic
909084300 1:71153685-71153707 AGACATGAGCAGAGCAGAAGAGG + Intergenic
909100568 1:71343183-71343205 AGGCAAGAGCAGGGCAGGAGAGG - Intergenic
909436825 1:75651808-75651830 AGACCTGAGCAGGGCAGGAGAGG + Intergenic
909684374 1:78329834-78329856 AGGCATGAGCAGGGAAGGAGAGG - Intronic
909713128 1:78674469-78674491 AGACATGAGCAGGAAAAGAGAGG - Intergenic
909875740 1:80800018-80800040 AGACATGAGTAGGGCAGGAGAGG - Intergenic
910024132 1:82628619-82628641 AGGCATGAGCGGGGCAGGAGAGG - Intergenic
910195873 1:84638980-84639002 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
910461674 1:87454151-87454173 AGGCATAAGCAGGGCAGGAGAGG - Intergenic
910802612 1:91160907-91160929 AGACATGAACAGGGCAAGAGAGG - Intergenic
910892492 1:92031898-92031920 TGACATGAGCAGGCAGCAAGGGG + Intronic
911063325 1:93765953-93765975 TAAAATTTGCAGGCCAGGAGCGG - Intronic
911089743 1:94009083-94009105 ACACATGAGGAGGCCAGGACTGG - Intronic
911317091 1:96368996-96369018 AAACATGAGCCGGGCAGGAGAGG + Intergenic
911485645 1:98501571-98501593 TGGCATAAGCAGGGCAGGAGAGG + Intergenic
911947737 1:104134513-104134535 AGACATGAGCAGGGCAGGAGAGG + Intergenic
911950331 1:104165751-104165773 TGAAATTAGCTGACCAGGAGGGG - Intergenic
912187177 1:107292391-107292413 AGACATGAGCACAACAGGAGAGG + Intronic
912536984 1:110381609-110381631 TGACCATAGAAGGCCAGGAGTGG - Intronic
912627049 1:111214017-111214039 AGACATGAGCAGGGCAGGAGTGG - Intronic
912767402 1:112426894-112426916 TGCCATGGGGAGGCCAGGTGCGG - Intronic
913097860 1:115536556-115536578 AGGCATGAGCTGGGCAGGAGAGG + Intergenic
913173476 1:116253264-116253286 TGACATGAGCTGGTCAGGACTGG - Intergenic
913279734 1:117174474-117174496 AGAAATGAACAGGCCAGGCGCGG + Intronic
913550311 1:119910921-119910943 GACCATGAGCATGCCAGGAGAGG - Intergenic
914318895 1:146540444-146540466 AGGCATAAGCAGGGCAGGAGTGG - Intergenic
914450909 1:147790679-147790701 AGAGATGAGCAGGTGAGGAGAGG + Intergenic
914495463 1:148192913-148192935 AGGCATAAGCAGGGCAGGAGTGG + Intergenic
914706635 1:150175519-150175541 TAACATCAGCAGGCCGGGCGCGG - Intergenic
914887235 1:151595468-151595490 AAACATGAGCAGGCCGGGCGCGG - Intergenic
915465858 1:156097561-156097583 TGCCATGGGCAGGACATGAGTGG + Intronic
915496953 1:156288626-156288648 TAACAAGAGCAGGCCAGGTGTGG - Intronic
915641730 1:157232783-157232805 AGACAGAAGCAGGGCAGGAGAGG - Intergenic
915666950 1:157453754-157453776 AGACAGGAGCAGGGCAGGAGAGG + Intergenic
915801243 1:158795357-158795379 TGTTATGAGCAAACCAGGAGGGG - Intergenic
916013230 1:160725532-160725554 AGACATGAGCAGGGCAGGAGAGG + Intergenic
916036291 1:160925482-160925504 AGGTATGAGCAGGGCAGGAGAGG + Intergenic
916641936 1:166739141-166739163 TGAGATCAGCAGCTCAGGAGTGG + Intergenic
917098725 1:171425254-171425276 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
917297223 1:173533055-173533077 TGACATAGGCTGGTCAGGAGAGG + Intronic
917411933 1:174768224-174768246 AGACATGAACAGGACAGGAGAGG + Intronic
917767023 1:178231247-178231269 AGACATGAACAGGACAGGAGAGG - Intronic
918001892 1:180505273-180505295 AGGAATGAGCAGGGCAGGAGAGG + Intergenic
918077485 1:181181613-181181635 AGACATGAGCAGGACAGGAGAGG + Intergenic
918110174 1:181448833-181448855 TGAGATGAGCAGGACAGAGGAGG - Intronic
918324469 1:183396238-183396260 AGGCATGAGCAGGGCAGGAGAGG + Intronic
918354852 1:183697992-183698014 TGACAGCAGCAGACAAGGAGGGG - Intronic
918967599 1:191372158-191372180 AGGCACGAGCAGGACAGGAGAGG - Intergenic
919298438 1:195732207-195732229 AGACATAAGAAGGACAGGAGAGG + Intergenic
919299104 1:195738452-195738474 AGACATAAGCAGGGCAGAAGAGG + Intergenic
919365743 1:196658713-196658735 TTACCTGAGCAGGCCGGGCGCGG - Intronic
919828130 1:201518535-201518557 TGAAATGTTCAGGCCAGGCGCGG - Intergenic
920325630 1:205161062-205161084 TAACATGACCAGGCCAGGTGTGG - Intronic
920832004 1:209473942-209473964 AGACATGAGCAGGGCAGGAGAGG + Intergenic
920879193 1:209864416-209864438 AGACATGAGCAAGGCAGGATAGG - Intergenic
921183484 1:212650664-212650686 AGGTATGAGCAGGGCAGGAGAGG - Intergenic
921344710 1:214170559-214170581 AGGTATGAGCAGGACAGGAGAGG + Intergenic
921974896 1:221191610-221191632 AGGCATGAGCAGGGCAGGGGAGG - Intergenic
922334690 1:224609123-224609145 AGAGATGAGCAGGGCAGGAGAGG - Intronic
922510413 1:226161446-226161468 AGAAATGAGCGGGCCAGGTGTGG - Intronic
922591566 1:226781239-226781261 TGACAAGTGCAGGCCAGTACAGG + Intergenic
922760175 1:228124106-228124128 AGACATGAGCAGGGCAGGAGAGG + Intergenic
922873919 1:228925139-228925161 AGATATGAGCAGAGCAGGAGAGG + Intergenic
922875319 1:228935843-228935865 AGGCATGAGCAGGGCAGGAGGGG + Intergenic
922883462 1:229000316-229000338 AGGCATGAGCAGGACAGGAGGGG + Intergenic
923131361 1:231077408-231077430 TGAGATGGGCAGGAGAGGAGTGG + Intergenic
923192594 1:231634172-231634194 TGACAGGTACAGGCCAGGCGCGG - Intronic
923572555 1:235129370-235129392 ACACATGATCAGGCCAGGCGCGG + Intergenic
923661168 1:235958584-235958606 AGACACAAGCAGGGCAGGAGAGG - Intergenic
923888027 1:238179881-238179903 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
923965481 1:239134214-239134236 AGACATGAGCAGGGCAGGATAGG + Intergenic
924154460 1:241162049-241162071 AGACGTGAGCAGGTCAGGAGAGG + Intronic
1062947538 10:1472812-1472834 AGGCATGAACAGGGCAGGAGAGG + Intronic
1062949001 10:1482411-1482433 TGAGATGAGCCGGCCATGAAAGG + Intronic
1062986396 10:1773090-1773112 AGACATGAGCAGGGAAGCAGAGG + Intergenic
1062986727 10:1776123-1776145 TGACATGAGCAGGGCAGGAGAGG + Intergenic
1063082972 10:2785955-2785977 TGGCATAAGCAGGCCAGGCGCGG + Intergenic
1064240278 10:13621303-13621325 TGACTGGAGCAGGCGATGAGAGG + Intronic
1064775892 10:18777103-18777125 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1065209742 10:23391066-23391088 AGATGTGAGCAGGGCAGGAGAGG - Intergenic
1065287347 10:24198926-24198948 TTACATGAACAAGCCAGGTGTGG + Intronic
1065309341 10:24399028-24399050 AGGCATGAGCGGGGCAGGAGAGG - Intronic
1065403412 10:25332974-25332996 TGACATGAACTGGCCTGTAGAGG + Intronic
1065506428 10:26434509-26434531 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1065506717 10:26437057-26437079 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1065513028 10:26498216-26498238 TTACAAAAGCAGGCCAGGCGTGG + Intronic
1065534927 10:26707456-26707478 AGGCATGAGCAGGGCAGGAGAGG - Intronic
1065828925 10:29596969-29596991 AGACATGGGCAGGGCAGGAGAGG + Intronic
1066084491 10:31963071-31963093 AGGCATGAGCAGAGCAGGAGAGG - Intergenic
1066118196 10:32258640-32258662 TTACAAGAGGAGGCCAGGCGCGG - Intergenic
1066364776 10:34766283-34766305 TGACACTAGCAGGTCAGAAGTGG + Intronic
1067370639 10:45678688-45678710 TGAGGTGGGCAGGCGAGGAGCGG + Intergenic
1067389136 10:45847455-45847477 TGAGGTGGGCAGGCGAGGAGCGG - Exonic
1067399053 10:45954322-45954344 AGACATGAGCAGGGCAGGACAGG + Intergenic
1067445122 10:46337094-46337116 TGAGGTGGGCAGGCGAGGAGCGG + Intergenic
1067502338 10:46816386-46816408 TGAGGTGGGCAGGCGAGGAGCGG + Intergenic
1067592249 10:47523634-47523656 TGAGGTGGGCAGGCGAGGAGCGG - Exonic
1067639366 10:48031707-48031729 TGAGGTGGGCAGGCGAGGAGCGG - Intergenic
1067867374 10:49923538-49923560 AGACATGAGCAGGGCAGGACAGG + Intronic
1067874121 10:49988586-49988608 TGAGGTGGGCAGGCGAGGAGCGG + Intronic
1068243988 10:54341147-54341169 AGATATGAGCAGGGCAGGAGAGG - Intronic
1068518896 10:58057505-58057527 AGACATGAGCAGGGCAGGAGAGG - Intergenic
1068600790 10:58954353-58954375 AGGCATAAGCAGGGCAGGAGAGG + Intergenic
1068758191 10:60679267-60679289 GGACATAAGCAGGGCAGGAGAGG + Intronic
1068953036 10:62796351-62796373 AGACATGAGCAGGGCAGGAAAGG - Intergenic
1069070334 10:63985495-63985517 AGACATGAGCATGGCAGGAGAGG + Intergenic
1069107260 10:64397951-64397973 AGGCATGAACAGGACAGGAGAGG - Intergenic
1069174395 10:65271933-65271955 AAACATGAGCAGAGCAGGAGAGG - Intergenic
1069446983 10:68481892-68481914 AGACATTAGAAGGCCAGGTGTGG - Exonic
1069736150 10:70655809-70655831 AGACATGAACAGGGCAGAAGAGG - Intergenic
1070136358 10:73697863-73697885 TGAGGTGGGCAGGCGAGGAGCGG - Exonic
1070565872 10:77603507-77603529 TGTCATAAGCAGGGAAGGAGAGG + Intronic
1070596914 10:77838816-77838838 CGGCAAGAGCAGACCAGGAGGGG - Intronic
1070847376 10:79534319-79534341 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1070926421 10:80225973-80225995 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1071217853 10:83428818-83428840 AGATATGAGCAGGGCAGGATAGG + Intergenic
1071781937 10:88855679-88855701 AGACATGAGCAGAGTAGGAGAGG - Intergenic
1071828945 10:89353067-89353089 AGACATGAACAGGGCAGGAGAGG + Intronic
1071864258 10:89708499-89708521 GAAAATGATCAGGCCAGGAGCGG - Intronic
1071960313 10:90803697-90803719 AGACATGACCAGGGCAGGATAGG - Intronic
1072172456 10:92878726-92878748 AGGCATGGGCAGGGCAGGAGAGG - Intronic
1072277221 10:93834995-93835017 TTACATGACCAGAGCAGGAGGGG + Intergenic
1072519997 10:96222865-96222887 AGGCATGAGCAGGGCAGGAGAGG + Intronic
1072531281 10:96321790-96321812 AGGCATGAGCAGGGCAGGAGAGG - Intronic
1073114828 10:101085894-101085916 TGGCCTGAGCAGGCAAAGAGTGG + Intergenic
1073360093 10:102891311-102891333 AGGCGTGAGCAGGGCAGGAGAGG - Intronic
1073849528 10:107598856-107598878 AGACATGAGCAGGGAAGGAGAGG + Intergenic
1073888837 10:108072963-108072985 AGGCATGAGCAGGGCAAGAGAGG - Intergenic
1073909560 10:108325706-108325728 AGGCATGAGCAGGGTAGGAGAGG + Intergenic
1074002564 10:109387495-109387517 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1074345785 10:112684727-112684749 AGAGATGAGCAGGCCGGGTGTGG - Intronic
1074407231 10:113189978-113190000 TGGGAAGAGCATGCCAGGAGAGG - Intergenic
1074447468 10:113532535-113532557 AGACATGATGAGGCCAGGCGTGG - Intergenic
1075834725 10:125443911-125443933 GGACAAGACCAGGGCAGGAGCGG - Intergenic
1076059408 10:127401789-127401811 AGGCATGAGCGGGGCAGGAGAGG - Intronic
1076176245 10:128370040-128370062 TGGCTTGAGATGGCCAGGAGGGG + Intergenic
1076429794 10:130393738-130393760 AGACATGAGCAGGGAAGGAGAGG + Intergenic
1076596676 10:131626544-131626566 TGAAAAGGGCTGGCCAGGAGAGG + Intergenic
1076738044 10:132467495-132467517 TGAGCTGAGCAGGGGAGGAGGGG + Intergenic
1076829101 10:132985420-132985442 TGACCAGAGCAGGTCAGGCGTGG + Intergenic
1077218909 11:1406651-1406673 TGGCATGAGGAGGCCTGCAGAGG + Intronic
1077457563 11:2690048-2690070 AGACAGAAGCAGGCTAGGAGAGG - Intronic
1078290380 11:10004973-10004995 AGACATGAGCAGGGAAGGAGAGG + Intronic
1078311176 11:10244843-10244865 TAAAATGGGCAGGCCAGGGGCGG + Intronic
1078443021 11:11383165-11383187 TGCCCTGAGCAGGCCCGGAGAGG - Intronic
1078819389 11:14862256-14862278 AGACATGGGCAGAGCAGGAGAGG - Intronic
1079234565 11:18678881-18678903 AGGCATAAGCAGGGCAGGAGGGG + Intergenic
1079332743 11:19547111-19547133 TGCCATGTGCAGGGCAGGAGAGG - Intronic
1079405975 11:20146050-20146072 AGACATGAGCAGGGCAGGAGAGG - Intergenic
1079557848 11:21782969-21782991 TGGCATGAGTGGGGCAGGAGAGG - Intergenic
1079681748 11:23305345-23305367 AGACACGAACAGGGCAGGAGAGG - Intergenic
1080236918 11:30080507-30080529 TGACATGAACATGACAGGATAGG - Intergenic
1080952308 11:37049294-37049316 AGCCATGAGCAGGGCAGGAGAGG + Intergenic
1080962832 11:37180467-37180489 AGACATGAGTGGGGCAGGAGAGG + Intergenic
1080967905 11:37234897-37234919 AGATGTGAGCAGGGCAGGAGAGG - Intergenic
1081029098 11:38055497-38055519 AGGCATGAGCAGGGCTGGAGAGG + Intergenic
1081159088 11:39731781-39731803 AGGCATAAGCAGGGCAGGAGAGG - Intergenic
1081888975 11:46524327-46524349 TGACAGGTGAAGGCCAGGAATGG + Intronic
1082002002 11:47398382-47398404 TGAGATCTCCAGGCCAGGAGAGG - Intergenic
1082187603 11:49203799-49203821 AGACAGGAGCAAGTCAGGAGGGG + Intronic
1082259902 11:50070879-50070901 TGCCAGGAGCTGGACAGGAGCGG + Intergenic
1082867326 11:57911798-57911820 TGACCTGCTCAGGCCAGGACAGG + Intergenic
1083041233 11:59689253-59689275 AGACATGAACAGGGCAGGAAAGG - Intergenic
1083329213 11:61889703-61889725 AGACTAGAGCAGGCCGGGAGTGG + Intronic
1083673613 11:64313799-64313821 GGCCATGAGCAGGCAGGGAGGGG - Intronic
1083845715 11:65332083-65332105 TTACATCAGCTGGCCAGGCGTGG + Intergenic
1084375437 11:68773643-68773665 TGACATGAGCAGGCCAGGAGAGG + Intronic
1084381082 11:68813238-68813260 TGACCAAAGCAGGCCAGGTGCGG + Intronic
1085389753 11:76176369-76176391 AGAGAGGAGCAGGCTAGGAGGGG + Intergenic
1085446696 11:76605488-76605510 GGACATGAGCAGGGCAGGAGAGG + Intergenic
1085622773 11:78049981-78050003 AGACATGAGCAGGGCAGGAGAGG - Intronic
1085649776 11:78257210-78257232 TAACATGAGCAGGAAAGGGGTGG + Intronic
1085682991 11:78595595-78595617 AGACGTGAGCAGGTCAGGAGAGG + Intergenic
1085788081 11:79472700-79472722 TGACTTGTTCAGGACAGGAGGGG - Intergenic
1085831473 11:79905872-79905894 AGACATGAGCAGGGCAGAAGAGG + Intergenic
1085963907 11:81497875-81497897 AGACATGAGCAGAACAGCAGAGG + Intergenic
1085963968 11:81498332-81498354 AGAAATGAGCAGGGCAGGAGAGG + Intergenic
1086390136 11:86355411-86355433 AGGCATGAGCAGGTCAGGAGAGG + Intergenic
1086673407 11:89574192-89574214 AGGCATGAGCATGGCAGGAGAGG - Intergenic
1086678715 11:89641586-89641608 AGACAGGAGCAAGGCAGGAGGGG - Intergenic
1086737040 11:90319834-90319856 AGACGTGAGCAGGGCAGGAGAGG + Intergenic
1086878168 11:92122773-92122795 TGAGATGAGTAACCCAGGAGTGG - Intergenic
1087066511 11:94032622-94032644 AGGCATGAGCAGGGCAGGAGAGG + Intronic
1087797443 11:102469540-102469562 AGACATGAACAGGGCCGGAGAGG + Intronic
1087797968 11:102474080-102474102 AGACATGAGCAGGGCAGCAGAGG - Intronic
1087978694 11:104583861-104583883 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1088253551 11:107882161-107882183 AGGTATGAGCAGGGCAGGAGAGG + Intronic
1089461912 11:118658661-118658683 TCAGGTGAGCAGGCCAGGGGTGG - Exonic
1089466529 11:118689710-118689732 TCAGGTGAGCAGGCCAGGGGTGG - Intergenic
1089752262 11:120660274-120660296 TGTCATGCCCAGGCCAGCAGGGG + Exonic
1089774103 11:120824289-120824311 TGTGATGAGCAGCCCAGGTGTGG + Intronic
1090292397 11:125556577-125556599 AGGCATGAGCAGGGCAGGAAAGG - Intergenic
1090819196 11:130325858-130325880 TTACATGAAAAGGCCAGAAGAGG - Intergenic
1091099388 11:132856397-132856419 AGGCATGAGGAGGACAGGAGAGG + Intronic
1091572584 12:1701410-1701432 AAAAATGATCAGGCCAGGAGTGG - Intronic
1091843731 12:3638565-3638587 GGACAAGAGCAGTCCGGGAGAGG + Intronic
1092234681 12:6799045-6799067 TGCTATGCTCAGGCCAGGAGGGG - Intronic
1092400161 12:8168330-8168352 GAGCATGAGCAGGGCAGGAGAGG - Intronic
1092746362 12:11676075-11676097 TGACATGAACAAGCAAGAAGTGG - Intronic
1092886294 12:12927187-12927209 AGGTATGAGCAGGGCAGGAGAGG + Intergenic
1093007566 12:14067260-14067282 ATTCATGAGCAGGACAGGAGAGG + Intergenic
1093872434 12:24307880-24307902 AGGCATGAACAGGGCAGGAGAGG + Intergenic
1093920638 12:24855916-24855938 TGGGATCAGCAGGCCAGGTGTGG - Intronic
1094401894 12:30070567-30070589 AGACATGAACAGGGCAGGAAAGG - Intergenic
1094475162 12:30835116-30835138 AGGCATGAGCAGGGCAGAAGAGG + Intergenic
1094530052 12:31265887-31265909 GGACAAGAGCTGGCCAGTAGAGG + Intergenic
1094692072 12:32779416-32779438 GGGCAGGAGCAGGGCAGGAGAGG + Intergenic
1095211615 12:39501192-39501214 AGATAGGAGCAGGACAGGAGAGG - Intergenic
1095595064 12:43949724-43949746 AGACATGAGCAGGGCAGGAGAGG - Intronic
1096131221 12:49160431-49160453 AGGCAAGAGCAGGGCAGGAGAGG - Intergenic
1096155813 12:49341009-49341031 TGAGAGAGGCAGGCCAGGAGTGG + Intergenic
1096261823 12:50097599-50097621 AGACATTATCAGGCCAGGTGCGG + Intronic
1096548944 12:52359712-52359734 TGACTTGAGCCAGGCAGGAGAGG + Intergenic
1096615570 12:52831382-52831404 TGAGGAGAGCAGGCCAGGCGGGG - Intronic
1097133433 12:56831340-56831362 AGACATGAGCAGGGCAACAGAGG - Intergenic
1097134220 12:56837923-56837945 AGAGGTGAGCAGGGCAGGAGAGG - Intergenic
1097224999 12:57471782-57471804 TGAGGTGGGCAGGCTAGGAGGGG + Exonic
1097681455 12:62653816-62653838 AGACATGATCAGGGCAGGGGAGG + Intronic
1097937131 12:65265355-65265377 AGGTATGAGCAGGACAGGAGAGG + Intergenic
1098055679 12:66502952-66502974 AGGCATGAGCAGGGCAGGAGAGG + Intronic
1098431650 12:70426002-70426024 TGACCTGAACAGGCCAGGCGGGG + Intronic
1098437743 12:70485980-70486002 ATACATGAGCAGGGCAGGAGAGG + Intergenic
1098554909 12:71807680-71807702 AGACATGAGCAGGGCAGGAGAGG + Intergenic
1098846114 12:75538038-75538060 AGACATGAGCAGGGCAGAAGAGG + Intergenic
1098848781 12:75569684-75569706 AGAGATGAGGAGGCCAGGCGCGG + Intergenic
1099215373 12:79846717-79846739 TGACTTGGGTAGGCCAGGCGTGG - Intronic
1099437503 12:82661183-82661205 AGGCAAGAGCAGGGCAGGAGAGG - Intergenic
1099687722 12:85910745-85910767 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1099718628 12:86331705-86331727 AGACATGAGCAAGGCAGGAGAGG - Intronic
1100135886 12:91552977-91552999 AGACATGAGCAGGGCAAGAGGGG + Intergenic
1100264388 12:92961635-92961657 AAAGATGAACAGGCCAGGAGTGG + Intergenic
1100291970 12:93224258-93224280 AGGTATGAGCAGGGCAGGAGAGG - Intergenic
1100364038 12:93902886-93902908 AGACATGAGCATGGCAGGAGAGG - Intergenic
1100462880 12:94818471-94818493 AGACCTGAGCAGGGCAGAAGAGG + Intergenic
1100836727 12:98573412-98573434 TGCCATGGGCAGGCCAAGGGAGG + Intergenic
1100857412 12:98770055-98770077 TGACGTCAGCAGGCAGGGAGAGG + Intronic
1100968591 12:100041723-100041745 TGACAATAGCAGGCCGGGCGCGG - Intronic
1101296810 12:103432422-103432444 AGATATGCGCAGGGCAGGAGAGG - Intronic
1101333468 12:103776263-103776285 TGAAAAAAGCAGGCCAGGTGCGG + Exonic
1101406987 12:104437293-104437315 AGACATGAACAGGGCAGGAAAGG - Intergenic
1101407172 12:104438878-104438900 AGACATGAGCAGGGCAGGAGAGG + Intergenic
1101467326 12:104961309-104961331 AAACCTGAGCAGGCCAGGTGTGG + Intergenic
1101662322 12:106776654-106776676 TGACAGCACCTGGCCAGGAGTGG - Intronic
1101961157 12:109251312-109251334 AGACATGAGCAGGGCAGGAGAGG - Intronic
1102002725 12:109567547-109567569 TGACATCAGCGGGGTAGGAGGGG - Intronic
1102038228 12:109784098-109784120 TGACATAAGCTGGCCTGGGGAGG - Intronic
1102844552 12:116165618-116165640 GGACATAGGCAGGCCAGGTGCGG - Intronic
1102905350 12:116670385-116670407 AGACATGAGCAGGGCAGGAAAGG - Intergenic
1103055513 12:117817060-117817082 TGCAATGACCAGGCCAGGGGAGG + Intronic
1103161431 12:118732525-118732547 TGGCATGAGCAGGGCAGGAGAGG + Intergenic
1103273413 12:119691676-119691698 TGAAATATCCAGGCCAGGAGTGG - Intronic
1104119201 12:125782715-125782737 TGTCAACAGCAGGCCAGGCGCGG - Intergenic
1104206947 12:126648260-126648282 GGGCGTGAGCAGGGCAGGAGAGG - Intergenic
1104432517 12:128728056-128728078 AGACATGAGCGGGGCAGGAGAGG - Intergenic
1106235809 13:27859257-27859279 TGACAGGGGCAGGCAGGGAGGGG + Intergenic
1106627576 13:31436292-31436314 TGGCATGAGCAAGACAGGAGAGG + Intergenic
1107684815 13:42886216-42886238 AGACAGGAGCAGGCCAAGAGAGG - Intergenic
1107790374 13:43995890-43995912 AGACATGAGCAGATCAGGAGAGG - Intergenic
1108702230 13:52953428-52953450 AGACATGAGCAGAGCAGGACAGG - Intergenic
1108747031 13:53406340-53406362 TGATTTGAGCAGGGCAGGAGTGG + Intergenic
1109267486 13:60217786-60217808 AAGCATGAGCAGGGCAGGAGAGG - Intergenic
1109360018 13:61283163-61283185 AGACATGAGCAGGGCAGGGAAGG - Intergenic
1109515441 13:63437795-63437817 AGACATGAGCAGAGCAGAAGAGG - Intergenic
1109661144 13:65462214-65462236 AGACATAAGCAGGACAAGAGAGG - Intergenic
1110505839 13:76285131-76285153 AAACATGAGCAGAACAGGAGAGG + Intergenic
1110609977 13:77476627-77476649 AGGCATGAGCAGAGCAGGAGAGG - Intergenic
1110979061 13:81872794-81872816 AGATATGAGCAGAGCAGGAGAGG + Intergenic
1110982619 13:81920048-81920070 AGACATGAACAGAGCAGGAGAGG - Intergenic
1111150769 13:84251539-84251561 AGACAGGAACAGGGCAGGAGAGG + Intergenic
1112207401 13:97338241-97338263 AGACATGGACAGGCCAGCAGAGG - Intronic
1112247519 13:97748024-97748046 AGGCATGAGCAGGGCAGGGGAGG + Intergenic
1112492384 13:99879091-99879113 TGGCAGGAGCAGGGCAGGAAAGG - Intronic
1112784501 13:102937389-102937411 TAACATAAGTAGGCCAGGTGTGG - Intergenic
1112871246 13:103973337-103973359 AGACATGAGCAGGGCAGGGCAGG - Intergenic
1113310332 13:109125591-109125613 TGACACAAGCATGGCAGGAGAGG - Intronic
1113535811 13:111065563-111065585 AGACATGAGCAGGGCAGGAGAGG + Intergenic
1113711756 13:112469771-112469793 TAACATGAACAGAGCAGGAGGGG + Intergenic
1114565299 14:23627394-23627416 AGACATGAACAGGATAGGAGAGG + Intergenic
1114837202 14:26216769-26216791 AGACATGAGCAGGACAATAGAGG + Intergenic
1114881832 14:26795958-26795980 AGGTATGAGCAGGGCAGGAGAGG + Intergenic
1115272362 14:31567940-31567962 TGACATTAGCAGGTTAGAAGTGG - Intronic
1115284671 14:31703995-31704017 CGGCATGAGCAAGGCAGGAGAGG - Intronic
1115336843 14:32250605-32250627 ACACATGAGCAGGGCAGGAGAGG - Intergenic
1115527654 14:34297762-34297784 AGATATGAGCAGGGCAGGATAGG + Intronic
1115537086 14:34383481-34383503 TGATGTGAGCAGCCCAGGGGAGG - Intronic
1115678867 14:35713803-35713825 TGATGTGAGCGGGCCAGGTGCGG + Intronic
1116064874 14:39970189-39970211 AGACATTAGCAGGTCAGGGGAGG + Intergenic
1116173238 14:41430013-41430035 TGACATGAGCAGAGCAGTAGAGG + Intergenic
1116229744 14:42201601-42201623 AGGCATGAGCAGGGCAGGAAAGG + Intergenic
1116461544 14:45180723-45180745 TGACCATACCAGGCCAGGAGTGG - Intronic
1116566097 14:46446326-46446348 AGGCATGATCAGGGCAGGAGAGG + Intergenic
1116708500 14:48334958-48334980 AGGCATGAGCAGGGGAGGAGAGG + Intergenic
1117282677 14:54256073-54256095 AGGCATGAGCAAGGCAGGAGAGG + Intergenic
1117528115 14:56631972-56631994 AGGCATGAGCAGGGCAGGAGAGG - Intronic
1117727772 14:58691402-58691424 AGACATGAGTGGGGCAGGAGAGG - Intergenic
1117990694 14:61430582-61430604 AGATATGAGCGGGGCAGGAGAGG + Intronic
1118200219 14:63664168-63664190 TGCCATGAACAGGGCAGGACAGG + Intergenic
1118281580 14:64433738-64433760 AGAGATGAGGAGGCCAGGCGTGG + Intronic
1118787729 14:69060097-69060119 TGACGTCAACAGGCCCGGAGAGG + Intronic
1118868114 14:69719092-69719114 TGAGGTGAAGAGGCCAGGAGTGG - Intergenic
1118947949 14:70406146-70406168 AGGCATAAGCAGGGCAGGAGGGG + Intronic
1119227881 14:72958011-72958033 TGAAAAGATCAGGCCAGGTGTGG + Intronic
1119298331 14:73551294-73551316 AGACATGAGCAGGGAAGGAGAGG + Intronic
1119573794 14:75700173-75700195 AGACATGAGCCGGGCATGAGAGG + Intronic
1119597051 14:75944617-75944639 AGACATGAGCAGGGCAAGAGAGG + Intronic
1119703042 14:76768201-76768223 TGACATGGGGAGGCCAGGCCAGG + Intronic
1119823234 14:77636603-77636625 AGACATGAGTGGGGCAGGAGAGG - Intergenic
1120208580 14:81612270-81612292 AGACATGAGCAGGGCAGGAGAGG + Intergenic
1120267939 14:82275140-82275162 GGGCATAAGCAGGGCAGGAGAGG - Intergenic
1120296392 14:82647255-82647277 AGACATGAGCAGGGTAGGGGAGG + Intergenic
1120376046 14:83708644-83708666 ACACATGAGCAGGGCAGGAGAGG + Intergenic
1121044210 14:90776108-90776130 AGGCATGAGCAGGGCAGGAGAGG + Intronic
1121233197 14:92373332-92373354 TGACAGCAGCTGGCCAGGCGTGG - Intronic
1121652999 14:95573811-95573833 AGACATAAGCAGGGCAGGAGAGG - Intergenic
1121722345 14:96118420-96118442 AGACATGAGCAGGGCAGGAGAGG - Intergenic
1121814729 14:96920502-96920524 AGACAAGAGCAGCCAAGGAGAGG - Intronic
1121823895 14:96994823-96994845 TGGCATGTGCAGTCAAGGAGAGG + Intergenic
1121933574 14:97995823-97995845 TGACATCAGCAGGCCAAGGCTGG - Intergenic
1122144512 14:99681577-99681599 AGACATGAGCAGGGCAGGAGAGG + Intergenic
1122521656 14:102348390-102348412 GGGCATGAGCACGCCTGGAGAGG + Exonic
1122536275 14:102465739-102465761 TGGCAGGAGCTGGCCAGCAGTGG - Intronic
1122671058 14:103372743-103372765 AGACATGAGCTGGCCAGGGCTGG - Intergenic
1122774392 14:104110798-104110820 GGCCAGGAGCAGGCCAGGTGGGG - Intronic
1122844766 14:104486879-104486901 TGTCAGGAGCAGGCGAGGGGAGG - Intronic
1122971787 14:105155178-105155200 TGACACCAGCAGGCGAGGGGCGG - Intronic
1124078551 15:26469871-26469893 AGACATGAGCAGAGCAGGAGAGG + Intergenic
1124821557 15:33051414-33051436 AGACATGAGCAGGGCAGGAGAGG + Intronic
1124832970 15:33167179-33167201 TGTCATGGGCAGGCCAGGTGGGG + Intronic
1125041072 15:35188032-35188054 AGACATGAGCAGGGCAGGAGAGG + Intergenic
1125755366 15:42060616-42060638 GGTCATGAGCAGTCAAGGAGGGG - Intergenic
1126260418 15:46683087-46683109 AGACATGAACAGGGCAGGAGAGG + Intergenic
1126301519 15:47202144-47202166 AGGAATGAGCAGGTCAGGAGAGG + Intronic
1126597339 15:50395730-50395752 AGGCATGAGCAGGGCAGAAGAGG - Intergenic
1126639902 15:50813474-50813496 AGACATGAACAGGGCAGGAGAGG - Intergenic
1126641719 15:50834223-50834245 TGACATTAACAGGCCAGGCGTGG + Intergenic
1127269021 15:57384155-57384177 TGCCATGAGCAAGCCAGGCCTGG - Intronic
1127585810 15:60376795-60376817 GCACAGGAGCAGGCCTGGAGTGG - Intronic
1127722764 15:61719154-61719176 AGACATGAACAGGCTGGGAGCGG + Intergenic
1128101663 15:65005896-65005918 TTACAAGAACAGGCCAGGCGCGG - Intronic
1128455663 15:67829993-67830015 GGAGATGAGCAGACCAGGCGCGG + Intronic
1128460505 15:67863413-67863435 TGACATGGGGAAGCCAGGACTGG - Intergenic
1129043605 15:72712155-72712177 GGACATGGACAGGCCAGGTGCGG - Intronic
1129055805 15:72819388-72819410 AGACAGGAGCAGGGCAGGAGAGG + Intergenic
1129190311 15:73933720-73933742 TGACATGGGCAGGAGAGGAAAGG + Intronic
1129521220 15:76187434-76187456 TCAGATCAGCAGGGCAGGAGGGG + Intronic
1129570742 15:76681677-76681699 TGAGTTGAGGAGGCAAGGAGTGG + Intronic
1130660249 15:85825803-85825825 AGCCATGAGCAGGGCAGGAGAGG - Intergenic
1131119933 15:89815643-89815665 TGAGAGGCGCAGGCCAGGTGTGG - Intergenic
1131238849 15:90720872-90720894 TGAAAAAAGCAGGCCAGGTGCGG - Intronic
1131241009 15:90743267-90743289 ATAAATAAGCAGGCCAGGAGCGG - Intronic
1132121117 15:99176319-99176341 TGCCATGAGTAGGCCAGGCATGG + Intronic
1133018958 16:2957926-2957948 TCACATGTGGAGGCCAGGCGTGG + Intergenic
1133096084 16:3446899-3446921 TGCAGTGAGCAGGCCAGGTGCGG - Intronic
1133368905 16:5233227-5233249 GGGCATGGGCAGGCCAGGCGTGG - Intergenic
1134077656 16:11303322-11303344 AGACATAAGCAGGGCAGGAGAGG + Intronic
1134851605 16:17483380-17483402 AGACATGAACAGGGCAGGAGAGG + Intergenic
1135045527 16:19151993-19152015 TAGAATGATCAGGCCAGGAGAGG + Intronic
1135329240 16:21547364-21547386 TGAAATCAGCAGGCCGGGCGCGG - Intergenic
1135528643 16:23233496-23233518 AGACATGAGCAGGGCAGGAGAGG - Intergenic
1135789057 16:25376669-25376691 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1136184028 16:28574575-28574597 AGGCAGGAGCAGGGCAGGAGAGG - Intronic
1136339580 16:29633306-29633328 TGAAATCAGCAGGCCGGGCGCGG - Intergenic
1136420895 16:30132216-30132238 AGGCATGAGCAGGGCTGGAGAGG + Intergenic
1137290831 16:47050888-47050910 TCCCAGGAGAAGGCCAGGAGCGG + Intergenic
1138206107 16:55126410-55126432 AGACATAAGCAGGGGAGGAGGGG - Intergenic
1138727123 16:59152238-59152260 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1138743267 16:59334682-59334704 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1138748375 16:59389777-59389799 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1138815694 16:60200558-60200580 AGACATAAACAGGGCAGGAGAGG - Intergenic
1138988674 16:62363036-62363058 AGACATGAGCAGGGCAGGAGAGG - Intergenic
1139072884 16:63404294-63404316 AGACATGAGCAGGGCAGGAGAGG - Intergenic
1139728633 16:68923246-68923268 TGACCTAAGCAGGCCAGGCGCGG - Intronic
1140203438 16:72913389-72913411 TGACAGGGGCAGGTCAGTAGAGG + Intronic
1141365299 16:83437126-83437148 TGACATCAGCCTCCCAGGAGAGG + Intronic
1141575811 16:84962932-84962954 AGACATGAGCAGGTTAGGAAAGG - Intergenic
1142042247 16:87901875-87901897 TGAAATCAGCAGGCCGGGCGCGG - Intronic
1142230091 16:88896036-88896058 TGACTTGGGCAGCGCAGGAGAGG - Intronic
1142298699 16:89243731-89243753 GGGTATGAGCAGGGCAGGAGAGG - Intergenic
1142376006 16:89707467-89707489 GGCCATGAGCCGGCCAGCAGTGG - Exonic
1142702321 17:1670775-1670797 TGATGAGAGCAGGCCAGGCGCGG - Intronic
1142752592 17:1997889-1997911 TGACAAGGGCAGGCCGGCAGGGG + Intronic
1143141473 17:4743978-4744000 TGCCATGAGCCTGGCAGGAGAGG - Exonic
1143582030 17:7833306-7833328 GGGCAGGAGCAGGGCAGGAGCGG - Intronic
1143744233 17:8978990-8979012 TGAAATGTTCAGGCCAGGCGCGG + Intergenic
1144300446 17:13918897-13918919 AGACATGAGCAGGGCACGAGAGG + Intergenic
1144396091 17:14844525-14844547 TGACATTAAGAGGCCAGGCGCGG - Intergenic
1144408027 17:14971809-14971831 AGACATGAGCAGGGTAGGAGAGG - Intergenic
1146272322 17:31492479-31492501 TAACATGTGCTGGCCAGGAGAGG - Intronic
1146444993 17:32926677-32926699 TGACAAGAACAGGCCGGGTGCGG + Intergenic
1146736807 17:35244976-35244998 TTTCATAATCAGGCCAGGAGTGG - Intronic
1147774221 17:42889158-42889180 TGATATAAGTAGGCCAGGTGTGG - Intergenic
1148071002 17:44908432-44908454 TGAAATCAGGAGACCAGGAGGGG + Intronic
1148449482 17:47766409-47766431 TGTCATCAGAAGTCCAGGAGAGG - Intergenic
1149304273 17:55333250-55333272 AGACATGAGCAGGGCAGAAGAGG - Intergenic
1149379822 17:56082107-56082129 AGACATGAACAGGGCAGGAGAGG - Intergenic
1149942084 17:60881262-60881284 TGAAAAGACCAGGCCAGGTGCGG - Intronic
1150334377 17:64319967-64319989 AAACATGAGCAGGACAGGTGAGG - Exonic
1150616597 17:66777158-66777180 GGACATGGGCAGGGCAGGAGAGG - Intronic
1150639650 17:66940786-66940808 TGACATTTGCAGGGAAGGAGTGG + Intergenic
1150907005 17:69348519-69348541 TGATATGAGCAGAGGAGGAGAGG + Intergenic
1151864258 17:76789682-76789704 AGAACTGAGCAGGGCAGGAGAGG - Intergenic
1152157629 17:78645240-78645262 TGACCTGGGCGGCCCAGGAGTGG - Intergenic
1152234995 17:79134044-79134066 GGACATGAGGTGGGCAGGAGGGG + Intronic
1152587317 17:81194834-81194856 TCCCATGAGCCGGCCAGGTGTGG - Intronic
1152866852 17:82729255-82729277 TGTCATGAGCTGGGCCGGAGGGG + Intronic
1152928248 17:83097712-83097734 TGACCTGGGCAGGCCAGGGTGGG + Intergenic
1153348850 18:4057081-4057103 AGACATGAGCAGGGCAGGAGAGG + Intronic
1153538841 18:6133625-6133647 AGACATGAGCAGGGCGGGAAAGG + Intronic
1153788180 18:8553561-8553583 AGACATGAACAGGGCAGGAAAGG - Intergenic
1154112900 18:11585602-11585624 AGACATAAGCAGGGCAGGAGAGG + Intergenic
1154276058 18:12961451-12961473 AGACATGAGCAGGGCAGCAGAGG - Intronic
1155113154 18:22736792-22736814 TGAGTTGAACAGGCAAGGAGGGG + Intergenic
1155252581 18:23966319-23966341 AGAGATGACCAGGCCAGGCGCGG + Intergenic
1155749083 18:29397991-29398013 AGACATGAGCAAGGCAAGAGAGG + Intergenic
1155797527 18:30059190-30059212 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1156018277 18:32570656-32570678 AGGCATGAGCGGGGCAGGAGAGG + Intergenic
1156644222 18:39140557-39140579 CAGCATGAGCAGGGCAGGAGAGG + Intergenic
1156679953 18:39576382-39576404 AGACATGAGCAGGGCAGGACAGG + Intergenic
1156684067 18:39623092-39623114 AGACATGAGCATGGCAGGAGAGG + Intergenic
1156792762 18:40997280-40997302 TGATATAACCAGGCCAGGTGCGG + Intergenic
1157973064 18:52293041-52293063 AGACATGAGCAGAGCAGAAGAGG - Intergenic
1158812982 18:61059037-61059059 AGGCATGAGCAGGTCAGGAGAGG - Intergenic
1158945524 18:62444048-62444070 AGGCATGAGCGGGGCAGGAGAGG + Intergenic
1159602440 18:70441588-70441610 ACATATGAGCAGGGCAGGAGAGG + Intergenic
1159892812 18:73968537-73968559 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1160108944 18:76006811-76006833 TCACCTGGGCAGGCCAGGTGCGG + Intergenic
1160120191 18:76123086-76123108 TGAGATGAGCAGGGCATGTGCGG - Intergenic
1160671204 19:364625-364647 TGACATGAGCAGGTGGAGAGGGG - Intronic
1161217189 19:3100416-3100438 TGACATGGGCAGGGAAGCAGGGG - Intronic
1161509290 19:4661773-4661795 TGAGATGAGGAGGCCTGGGGTGG + Intronic
1161599651 19:5173802-5173824 AGACAAAAACAGGCCAGGAGCGG + Intronic
1161971863 19:7586374-7586396 AGAAATGAGCAGGCCAGGCATGG - Intergenic
1162929527 19:13950458-13950480 ATACATGACCAGGCCAGGTGCGG - Intronic
1163141294 19:15350637-15350659 TCACCTGGACAGGCCAGGAGCGG - Intergenic
1163763509 19:19149787-19149809 GAAAATGAGCAGGCCAGGTGCGG + Intronic
1163962273 19:20707950-20707972 TCACATGAGCTAGCCAGGTGCGG - Intronic
1164827957 19:31298137-31298159 TCACATGAGCAGCCCTAGAGTGG - Intronic
1166290015 19:41856931-41856953 AGAAATGAGCTGGCCGGGAGCGG - Intergenic
1166812977 19:45525271-45525293 TTACCTGAGAAGGCCAGGTGCGG + Intronic
1167039062 19:47011568-47011590 TTAGCTGAGCAGGCCAGGCGAGG + Intergenic
1167077684 19:47259231-47259253 TGACCTGGGCAGGTCAGCAGGGG + Intronic
1167222833 19:48214229-48214251 AGATATGAGCAGGGCAGGAGAGG + Intronic
1167278619 19:48553601-48553623 TGAAATGAGGCGGCCAGGCGTGG - Intronic
1167452550 19:49580657-49580679 GGACTTGAGCAAGCCAGGCGAGG - Intronic
1168115370 19:54219248-54219270 TGACATGAGGACGTCAGGAGTGG + Intronic
925082074 2:1078415-1078437 GGACATGAGGATGCCAGGAGAGG + Intronic
925375151 2:3378871-3378893 TCAAATGAGCAGGCCGGGCGCGG + Intergenic
925502249 2:4518578-4518600 AGGTATGAGCAGGGCAGGAGAGG + Intergenic
925553049 2:5096753-5096775 AGACATGAGCAAGGCAGGAGGGG - Intergenic
925751541 2:7094262-7094284 AGGCATGAGCAGGGCAGGGGAGG + Intergenic
926062304 2:9812180-9812202 TGACAGGAGGAGGCCAACAGCGG - Intergenic
926170725 2:10551007-10551029 AGACATGAGCAGGGCAGGAGAGG + Intergenic
926359293 2:12070392-12070414 GGACATGAGCAAGCCATGAAAGG - Intergenic
926502786 2:13676158-13676180 ACACATGAGCAGGGCAGGAGAGG - Intergenic
926637275 2:15195540-15195562 AGACATGAGCAGGGTAGGAGAGG + Intronic
926651651 2:15352972-15352994 AGACATGAGCAAGACGGGAGAGG - Intronic
926686458 2:15702120-15702142 AGAGATGAGCAGGGCAGGAGAGG - Intronic
926828281 2:16931682-16931704 AGGCATGCGCAGGGCAGGAGAGG - Intergenic
926967329 2:18429482-18429504 AGACATGAGCAGAGCAGGAGAGG + Intergenic
926983918 2:18600244-18600266 TTACCTGAGCAGGACTGGAGAGG + Intergenic
927218009 2:20680678-20680700 TGACAGGACCAGGGAAGGAGTGG - Intergenic
927351456 2:22122408-22122430 AGGCATGAGCAGGGCAGGGGAGG + Intergenic
927351982 2:22126359-22126381 AAGCATGAGCAGGGCAGGAGAGG + Intergenic
927950130 2:27162104-27162126 TGTCATTTGTAGGCCAGGAGTGG - Intergenic
928331377 2:30360381-30360403 GGCCATGAGCTGGCCAGGGGAGG + Intergenic
929710713 2:44263692-44263714 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
929889478 2:45907154-45907176 TGACATGATCAGGCCAGTGATGG + Intronic
930024608 2:47022495-47022517 TGGCAAGAGAAGGCCAGGTGTGG - Intronic
930771643 2:55135973-55135995 AGATATGAGCAAGGCAGGAGAGG + Intergenic
930887373 2:56341417-56341439 AAACATGAGCAAGGCAGGAGAGG - Intronic
931555103 2:63494628-63494650 TGGCATGACCCGGCCAGGCGCGG + Intronic
931884958 2:66607301-66607323 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
932964310 2:76453907-76453929 AGGCATGTGCAGGGCAGGAGAGG + Intergenic
933045153 2:77526130-77526152 AGACATGAACAGGGCAGGAGAGG - Intronic
933068544 2:77830876-77830898 AGACATGTGCAAGGCAGGAGAGG + Intergenic
933369430 2:81396570-81396592 AGCCATGAGCAGGACAGGAAAGG + Intergenic
933563072 2:83913372-83913394 AAACATGAGCAGGGCAGAAGAGG + Intergenic
934039700 2:88117553-88117575 AGACATGAGCAGGGCAGGAGAGG - Intergenic
934758915 2:96842746-96842768 TGACAGGAGCAGGGTAGGCGGGG - Intronic
934887666 2:98039106-98039128 AGACATGAGCAGGGCAGGAGAGG + Intergenic
934927593 2:98392262-98392284 TGAGATAAGCAGGCCAGGCCAGG + Intronic
935261520 2:101359648-101359670 AGACATGAGCAGGCCAGGAGAGG - Intronic
935286502 2:101568263-101568285 AGACATGAGCAGGGCAGGAGAGG - Intergenic
935292110 2:101619726-101619748 AGACATGAGCAGGGCAGGAGAGG - Intergenic
935889778 2:107663728-107663750 AGATATAAGCAGGGCAGGAGAGG + Intergenic
935965362 2:108467585-108467607 AGACAGGAGGTGGCCAGGAGTGG - Intronic
936035117 2:109104991-109105013 AGACATGAGCAGGGCAGGAGAGG + Intergenic
936165044 2:110114047-110114069 TGGCAGGAGCAGGGCAGGTGCGG + Intronic
936710356 2:115123745-115123767 AGACATGAGCACAGCAGGAGAGG - Intronic
936837717 2:116727964-116727986 AGACATGAGCAGGGCCAGAGAGG + Intergenic
936956603 2:118028852-118028874 AGATATGAGCAGGGCAGAAGAGG + Intergenic
937001015 2:118467660-118467682 TGTCATGAGCAGGCAGGGAAGGG + Intergenic
937341003 2:121090503-121090525 AGGCATGAGCGGGGCAGGAGAGG - Intergenic
937523167 2:122736074-122736096 AGACATGAGCAGGGCAGGAGAGG + Intergenic
937721232 2:125099493-125099515 AGACATGAGCAGGGCAGGAGAGG + Intergenic
938210075 2:129459766-129459788 TGTGAGGAGCAGGCCAGGTGAGG + Intergenic
938265751 2:129926996-129927018 TGACATGAGAAGGGAAGGTGAGG + Intergenic
938298375 2:130192803-130192825 TGACAACATCAGGCCAGGTGTGG + Intronic
938458387 2:131481854-131481876 TGACAACATCAGGCCAGGTGTGG - Intronic
939663364 2:144918594-144918616 AGACATGGGTAGGCCAGGTGTGG - Intergenic
939858428 2:147389184-147389206 AGATATGAGCAGGGCAGGAGAGG + Intergenic
939936762 2:148302035-148302057 AGACACGAGCAAGGCAGGAGAGG - Intronic
940782901 2:157952330-157952352 AGACACGAGCAGGGCAGGAGAGG + Intronic
940788295 2:158005441-158005463 TGAAAAGAGAAAGCCAGGAGAGG + Intronic
941717840 2:168782441-168782463 AGTCATGAGCAGGGCAGAAGAGG + Intergenic
941718219 2:168786190-168786212 AGACATCAGCAGGCCAGGAGAGG + Intergenic
941743763 2:169064501-169064523 TAACATGACCGGGCCAGGCGCGG - Intergenic
942110092 2:172673587-172673609 AGTCATGAGCAGGACAGGAGAGG - Intergenic
942297602 2:174532900-174532922 TAACTTAAGCAGGCCAGGCGCGG - Intergenic
942384372 2:175425827-175425849 TTAAAAGAGCAGGCCAGGTGTGG + Intergenic
942486690 2:176447051-176447073 TGGAGTGAGCAGGCCAGGACAGG - Intergenic
943249300 2:185496305-185496327 GGGCATGAGCGGGCCAGGAGAGG - Intergenic
943345434 2:186733056-186733078 AGATATGAGCAAGGCAGGAGAGG - Intronic
943750251 2:191503109-191503131 GGGCATCAGCAGGGCAGGAGAGG + Intergenic
943905086 2:193489503-193489525 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
943952445 2:194147513-194147535 TGAGATAAATAGGCCAGGAGTGG - Intergenic
944091412 2:195916405-195916427 AGACATAAGTAGGGCAGGAGAGG + Intronic
944476592 2:200112750-200112772 AGACATGAGTAGGGCAGGAGAGG + Intergenic
944701761 2:202252222-202252244 AGGCATGAGCAGGGTAGGAGAGG + Intergenic
945838207 2:214857490-214857512 AGATATGTGCAGGGCAGGAGAGG + Intergenic
946388926 2:219404048-219404070 AAGCATGAGCAGGCCAGGCGCGG + Intergenic
946780352 2:223188330-223188352 AGACTTGAGCAGGGCAAGAGAGG - Intronic
946919235 2:224560709-224560731 TGATGATAGCAGGCCAGGAGTGG - Intronic
947002027 2:225467457-225467479 AGACGTGAACAGGGCAGGAGAGG - Intronic
947156970 2:227172320-227172342 AGGCATGAGCAGGGCAGGAGAGG - Intronic
947219769 2:227781123-227781145 AGACATGAACAGGGCAGGGGAGG + Intergenic
947359242 2:229331102-229331124 AGAAATGAGGAAGCCAGGAGGGG - Intergenic
947363025 2:229365319-229365341 TGACCTGGGCAGGCCCGTAGAGG - Intronic
947790884 2:232868385-232868407 TGAAATGACCTGGCCAGGTGCGG - Intronic
947830947 2:233141274-233141296 TCACATAAACAGGCCAGGCGTGG + Intronic
948577463 2:238964012-238964034 GGACAAGGGCAGGCCAGCAGGGG - Intergenic
1168746975 20:252047-252069 AGGCCTGAGCAGGGCAGGAGAGG + Intergenic
1169429287 20:5522127-5522149 AGACATGAGCAGGGAAGGAGAGG + Intergenic
1169751570 20:8999968-8999990 AGACATGAGCAGAGCAGGAGAGG + Intergenic
1170667841 20:18402160-18402182 AGACATGAGCAGGGCAGGAAAGG + Intronic
1172067733 20:32233588-32233610 TGTGGTGAGCAGACCAGGAGAGG + Intronic
1172797780 20:37554584-37554606 AGACACGAGCAGGGCAGGAGAGG + Intergenic
1173751827 20:45482413-45482435 AGACATGAGCAGGACAGGAGAGG + Intergenic
1173924918 20:46773572-46773594 AGGTATGAGCAGGGCAGGAGAGG + Intergenic
1174628359 20:51934941-51934963 TGAAATGAGCTGCCCTGGAGTGG + Intergenic
1174667931 20:52277647-52277669 TTACATTTGCAGGCCAGGCGTGG - Intergenic
1174818199 20:53704574-53704596 AGAAATGAACAGGCCAGGCGGGG - Intergenic
1174896110 20:54451802-54451824 AGACATGAGCAGGGCAGGAGAGG + Intergenic
1175262981 20:57686341-57686363 TGCCATGAGCAGGGCAGGCATGG - Intronic
1175264267 20:57693068-57693090 TGTTGTGAGCAGGCCGGGAGTGG + Intronic
1175586983 20:60148941-60148963 AGACATGAGCAGGGCAGAAGAGG + Intergenic
1175631153 20:60537405-60537427 TGGTCTGAGCAGGGCAGGAGAGG - Intergenic
1175810770 20:61856317-61856339 GGACATGAGCATGCCAGTACAGG + Intronic
1176108543 20:63400808-63400830 AGACACGCGCAGGGCAGGAGGGG - Intergenic
1176291320 21:5046456-5046478 AGACATGAGCAGGGCAGGAGAGG - Intergenic
1176363434 21:6017592-6017614 TGACATGACCAAGCCAGAATGGG + Intergenic
1177013973 21:15761294-15761316 AGACATGAGCAGGGCAGAAGGGG + Intronic
1177171048 21:17656359-17656381 AGACATGAGCAGGGCAGAAGAGG - Intergenic
1178123015 21:29488668-29488690 AGGCATGAGCAAGGCAGGAGAGG + Intronic
1178479481 21:32967254-32967276 AGACATGAGCAGGCCAGGAGGGG + Intergenic
1178548554 21:33515208-33515230 TGAGATGATCAGGCCTGGGGTGG - Intronic
1179010033 21:37549361-37549383 AGACATGAGCGGGGCAGGAGAGG - Intergenic
1179054662 21:37920042-37920064 AGACATGAGCAGGGCAGAAGAGG + Intergenic
1179235101 21:39538846-39538868 AGACATGAGCAGGGCAGAAGAGG - Intergenic
1179254895 21:39707101-39707123 ACACATGAGCAGGGCAGGAGAGG - Intergenic
1179760084 21:43520953-43520975 TGACATGACCAAGCCAGAATGGG - Intergenic
1179865935 21:44217185-44217207 AGACATGAGCAGGGCAGGAGAGG + Intergenic
1180172256 21:46065715-46065737 TGGCCTGAGCGGGACAGGAGGGG - Intergenic
1180635292 22:17258728-17258750 TGAGCAGAGGAGGCCAGGAGGGG + Intergenic
1180944769 22:19686174-19686196 TCACATTAGCTGGCCAGGCGCGG - Intergenic
1181114090 22:20620547-20620569 TGGCATGTGCAAGCCAGGACAGG - Intergenic
1181139042 22:20790368-20790390 TAAAATAAGTAGGCCAGGAGTGG + Intronic
1182055396 22:27349545-27349567 AGGAATGAGCAGGGCAGGAGAGG - Intergenic
1182318534 22:29463660-29463682 AGAAAAGAACAGGCCAGGAGTGG + Intergenic
1183861756 22:40675324-40675346 TAAAATGAGTAGGCCAGGTGTGG + Intergenic
1183980199 22:41534977-41534999 AGATATGAGCAGGGCAGGAGAGG - Intronic
1184176502 22:42792306-42792328 TGTCAGGACCAGGACAGGAGTGG + Intergenic
1185128017 22:49022525-49022547 TGACATGACCCAGCCTGGAGTGG + Intergenic
1185186391 22:49403231-49403253 AGGTATGAGCAGGGCAGGAGGGG - Intergenic
949500437 3:4675293-4675315 TGACATGAGCATAACAGGAAAGG - Intronic
949542954 3:5048416-5048438 AGACATGAGCAGGGCAGGAGAGG + Intergenic
949602032 3:5610563-5610585 TAACATGGGCAGGCCAGGTGTGG - Intergenic
949902365 3:8827528-8827550 TCAGTTGAGCAGGCCAGGCGTGG + Intronic
950301231 3:11881095-11881117 AGAAATGAGCAGGCCAGGCTCGG + Intergenic
950628148 3:14263572-14263594 AGACATGAGCAGGGCAGGAGAGG - Intergenic
950780456 3:15387234-15387256 AGACATGAGCAGGGCAGGGGAGG - Intronic
950869579 3:16217042-16217064 AGACATAAGCAGGGCAGGAGAGG - Intronic
950907833 3:16555091-16555113 AGACACGAGCAGGGCAGGAGAGG + Intergenic
951155030 3:19341438-19341460 AGACATGAACAGTGCAGGAGAGG - Intronic
951263484 3:20539897-20539919 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
951757017 3:26102063-26102085 AGACAGGAGGAGGGCAGGAGAGG - Intergenic
951933868 3:28000582-28000604 AGACATAAGCAGGGCAGGAGAGG + Intergenic
952709096 3:36411412-36411434 TGACTGGAGCAGACTAGGAGAGG - Intronic
953017654 3:39093624-39093646 TGACATATACAGGCCAGGTGTGG - Intronic
953194466 3:40719630-40719652 AGACATGAGCAGGGCAGGAGAGG + Intergenic
953293624 3:41690899-41690921 AGACATGAGCAGGGCAGGAGAGG + Intronic
953745678 3:45572211-45572233 AGATACGAGCAGGACAGGAGAGG + Intronic
953790007 3:45940169-45940191 AGACATGAGCAGGGCAGGAGAGG + Intronic
953798863 3:46006045-46006067 AGACATGAGCAGGGCACAAGGGG + Intergenic
954380041 3:50214480-50214502 TGACGTGAGCAGGGCAGCAACGG + Exonic
954624048 3:52012802-52012824 TGACATGAGCCGGGCTGGGGAGG - Intergenic
954889701 3:53913786-53913808 AGGCATGAGCGGGGCAGGAGAGG - Intergenic
955011489 3:55020557-55020579 TGTCATAAACAGGCCAGGCGCGG + Intronic
955319136 3:57961766-57961788 AGACATGAGCACAGCAGGAGAGG - Intergenic
955696946 3:61646400-61646422 TTAGATGATCTGGCCAGGAGCGG - Intronic
955698795 3:61662991-61663013 TGAAAAGAGCAGGCCAGGTATGG + Intronic
955822713 3:62913199-62913221 TGACATGGGCAGGCTAAGAATGG + Intergenic
956341134 3:68225196-68225218 TGCCATGAGCCAGCCAGGTGTGG - Intronic
956368433 3:68531828-68531850 TGACATGAGCAGGGCAGGAGAGG - Intronic
957189603 3:76990552-76990574 AGACATGAGCAGAGCAGGAGAGG + Intronic
957287464 3:78235030-78235052 AGACATGAGCAGGGCAGGAGAGG - Intergenic
957738219 3:84228659-84228681 AGACATGAGCAGGGCAGGAGAGG - Intergenic
957847299 3:85754374-85754396 AGACATGATCAGAGCAGGAGAGG - Intronic
957865040 3:86012508-86012530 TGCCCTGAGGAGGCCGGGAGCGG + Intronic
958462568 3:94418178-94418200 TAAGTTGAACAGGCCAGGAGTGG + Intergenic
958492738 3:94797971-94797993 AGACATGAACAGGGCAGAAGAGG - Intergenic
958532380 3:95349983-95350005 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
958603690 3:96331515-96331537 AGGCATAAGTAGGCCAGGAGAGG + Intergenic
958673374 3:97233195-97233217 AGACATGAACAGGGCAGGAGAGG - Intronic
958929888 3:100197693-100197715 AGGCAAGAGCAGGGCAGGAGAGG - Intergenic
959194799 3:103166612-103166634 GGACATGAGCAGGGCAGGAGAGG + Intergenic
959281234 3:104343511-104343533 AGGCATGAGCAGGGCAGGGGAGG - Intergenic
959585645 3:108022712-108022734 AGACATGAGCAGGGCAGGAGAGG - Intergenic
960275182 3:115720969-115720991 AGACGTGAGCAGGACAGGAAGGG - Exonic
960708607 3:120505467-120505489 AGACATGAGCAGAGCAGGAGAGG + Intergenic
960709294 3:120511349-120511371 AGACATGAGCAGAGCGGGAGAGG + Intergenic
960979591 3:123210431-123210453 TGAAATGAGCAAGAAAGGAGAGG + Intronic
961353294 3:126317265-126317287 AGACATGAGCAGGGCAGGAGAGG + Intergenic
961394079 3:126573988-126574010 AGACATGAGCATGGCAGGAAAGG - Intronic
961480925 3:127180223-127180245 AGACATGAGCAGGGAAGGAGAGG + Intergenic
961698712 3:128725309-128725331 AGACCTGAGCAGGGCAGGAGAGG - Intergenic
961987067 3:131146091-131146113 CGATATGCCCAGGCCAGGAGAGG + Intronic
962209333 3:133463848-133463870 AGACATGAACAGGGCGGGAGAGG - Intronic
962604844 3:137024549-137024571 TGCCATGAGCTGGCCAGAAGAGG - Intergenic
962878344 3:139553215-139553237 TGCCATCAGCAGGCCAGAAGTGG - Intergenic
963023675 3:140897700-140897722 GCAGACGAGCAGGCCAGGAGAGG - Intergenic
963126083 3:141818189-141818211 TGAGTTGAACAGGCCAGGTGCGG + Exonic
963443246 3:145367967-145367989 AAGCATGAGCAGGGCAGGAGAGG - Intergenic
963458122 3:145573267-145573289 TGGCATAAGCAGGGCAGGAGAGG - Intergenic
963458855 3:145579814-145579836 TACCATGAGCAGGGCAGGAGAGG - Intergenic
964249715 3:154699130-154699152 AGACATAAGCAGAACAGGAGAGG + Intergenic
964307232 3:155354965-155354987 GGGCTTGAGCAGGACAGGAGAGG + Intergenic
964409853 3:156386627-156386649 AGGCATGAGCAGGGCAGGAAAGG - Intronic
964776251 3:160281442-160281464 AGACATGAGCAAGTCAGGAGAGG + Intronic
964951686 3:162302960-162302982 AGACATGAACAGGGCAGGAGAGG + Intergenic
965299069 3:166987730-166987752 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
965767546 3:172147015-172147037 TGAGATGAGAAGGCCAGGCGTGG + Intronic
965945453 3:174234722-174234744 AGACATGAACAGAGCAGGAGAGG - Intronic
966923468 3:184629547-184629569 TTAGCTGAGCAGGGCAGGAGAGG - Intronic
967461896 3:189757702-189757724 AGACATGAGCAGGACAGGAGAGG + Intronic
967548692 3:190763731-190763753 TGACAGCACCAGGCCATGAGGGG - Intergenic
967863720 3:194173094-194173116 AGACATGAGCAGGGCAGGACAGG - Intergenic
967961474 3:194928694-194928716 AGACATGAGCAGGGCAGGAAAGG + Intergenic
967974789 3:195027664-195027686 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
967994143 3:195154097-195154119 AGACATGAGCAGGGCAGGAGAGG + Intronic
968036133 3:195549623-195549645 TGAAAAGAGGAGGCCAGGCGTGG - Intergenic
968151104 3:196337314-196337336 AGACATGAGCAGGGCGGGAGAGG + Intronic
968199152 3:196737587-196737609 TGAAATAAGTAGGCCAGGCGCGG - Intergenic
968502114 4:955640-955662 TGGAATGTGCAGGCCAGGAGAGG - Intronic
968813469 4:2810281-2810303 GGAGAGGAGCAGGCCAGGTGAGG - Intronic
968899137 4:3422659-3422681 TGAAATGAGGAGCGCAGGAGGGG - Intronic
969293819 4:6257421-6257443 AGTCATGTGCAGGCCAGGAACGG + Intergenic
969572542 4:8018170-8018192 TAACATGTGCAGGACAGGAGGGG - Intronic
969901556 4:10354958-10354980 AGGCATGAGCAGAGCAGGAGAGG + Intergenic
970395826 4:15664847-15664869 AAAGATGAGCAGGACAGGAGTGG - Intronic
970470818 4:16378040-16378062 AGACGTGAGCAGGGCAGGAGAGG + Intergenic
970471147 4:16380484-16380506 AGACATGAGCAAGGCAGGCGAGG - Intergenic
971477976 4:27090029-27090051 TGACATGAGCAGGGCAGAAGAGG - Intergenic
971764757 4:30815901-30815923 AGACATTAGCAGGGCAGGACAGG - Intronic
971851277 4:31989065-31989087 AGACATGAACAGGGCAAGAGAGG + Intergenic
971878092 4:32330149-32330171 AGGCATGAGCAGGACAGGAGAGG + Intergenic
971967416 4:33578192-33578214 TGATATGAACAAGGCAGGAGAGG - Intergenic
971990401 4:33885762-33885784 AGGCATGAGCAGGGCATGAGAGG + Intergenic
972016382 4:34251090-34251112 AGACATAAGCAGGGCAGGAGAGG - Intergenic
972329898 4:38055243-38055265 AGACATGAGGACGGCAGGAGAGG - Intronic
972411707 4:38801824-38801846 AGACATGAGCAGGACAGGAGAGG + Intronic
972584068 4:40420473-40420495 TGAGATGAGTTGGCCAGGCGTGG - Intergenic
972865103 4:43222113-43222135 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
972912146 4:43830781-43830803 AGACATAAGCAGGGCAGGAGAGG + Intergenic
972987075 4:44777776-44777798 AGACATGAGCAGGGAAGGAGAGG + Intergenic
972997773 4:44903766-44903788 TTAAATGAGCAGGCCGGGCGTGG - Intergenic
973003829 4:44986161-44986183 AGACAAGAACAGGGCAGGAGAGG + Intergenic
974156979 4:58086075-58086097 AGTCATGAGCAGGGCAGGAAAGG - Intergenic
974167001 4:58216068-58216090 ACACATGAGCAGGGCAGGAGAGG - Intergenic
974250924 4:59381977-59381999 AGACATGAGTGGGGCAGGAGAGG + Intergenic
974332594 4:60499378-60499400 AGGCATGAGCAGGACAGGAGAGG - Intergenic
974627832 4:64446574-64446596 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
975222901 4:71833733-71833755 AGACGTGAGCAGGGCAGGAGAGG - Intergenic
975856712 4:78632547-78632569 AGGCATGAGCGGGGCAGGAGAGG + Intergenic
975908580 4:79244259-79244281 AGGCATGAGCAGGGCAGGAGAGG - Intronic
976005033 4:80419673-80419695 AGGCATGAACAGGGCAGGAGAGG - Intronic
976231398 4:82847003-82847025 TGAAGTAAGCAGGCCAGGCGCGG - Intronic
976818172 4:89174587-89174609 AGGCATGAGCAGGGCAGAAGAGG + Intergenic
977582993 4:98745372-98745394 AGACATGAGCAGGGTAGGAGAGG - Intergenic
977720808 4:100238369-100238391 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
977867695 4:102049606-102049628 AGACACGAGCAGGGCAGGAGAGG + Intronic
978000224 4:103548201-103548223 AGGCATGAGTAGGGCAGGAGAGG - Intergenic
978054775 4:104249638-104249660 TGACTTGAACAGGGAAGGAGTGG - Intergenic
978153804 4:105467154-105467176 AGGCATGAGCAGGGCAGAAGAGG - Intronic
978256503 4:106698704-106698726 TGCCAGGAGGAGGGCAGGAGGGG - Intergenic
978371269 4:108031573-108031595 TGAGATGAGCAGACCAGGAAGGG - Intronic
978648404 4:110970611-110970633 TGAGAGGAGCAGCCCAGCAGAGG + Intergenic
978931904 4:114324539-114324561 AGGCATGAGCAGGGAAGGAGAGG + Intergenic
979183200 4:117756099-117756121 AGATATAAGCAGGGCAGGAGAGG - Intergenic
979526445 4:121722500-121722522 TGAAATGAACAGGCCGGGCGTGG + Intergenic
979694977 4:123602942-123602964 AGACATGAGCAGGTCAGGAGAGG + Intergenic
979793458 4:124815127-124815149 AGACAAGAGCAGGGCAGGAGAGG + Intergenic
979940216 4:126752806-126752828 AGACATGAGCAGGACAGGAGAGG - Intergenic
980072116 4:128254441-128254463 AGACATGAGCAGGGCAGGAAAGG + Intergenic
980259663 4:130432389-130432411 AGGCATGAGCAGGGCAGGAAAGG + Intergenic
980271020 4:130583665-130583687 AGACATAAGCAGGGCAGGAGAGG - Intergenic
980316413 4:131207476-131207498 AGACATCAGCAGGGAAGGAGAGG + Intergenic
980416638 4:132496799-132496821 AGCCATGAGCAGGGCAGGAAAGG - Intergenic
981085896 4:140683166-140683188 TTCAATGAGCAGGCCAGGTGCGG - Intronic
981191960 4:141874133-141874155 GGACATGAGCAGAGCAGGAGAGG - Intergenic
981337851 4:143587110-143587132 TGGCATAACCAGGACAGGAGAGG - Intronic
981450008 4:144885993-144886015 AGGCATGAGCAGGACAGGAGTGG + Intergenic
981526449 4:145710820-145710842 AGACATGAGCAGAACAGGAGAGG - Intronic
981756349 4:148144960-148144982 AGACATGATCAGGGCAGGAGAGG + Intronic
982103825 4:151994194-151994216 AGACATGAGCAGGGCAGGAGAGG - Intergenic
982439921 4:155423249-155423271 GGACATGAGCAGGGGAAGAGAGG - Intergenic
982889209 4:160825737-160825759 AGACATGAGCAGAGCAGGAGAGG + Intergenic
983038759 4:162899223-162899245 AAACATGAGTAGGGCAGGAGAGG - Intergenic
983262336 4:165470680-165470702 AGACATGAGCAGGACAAGAGAGG - Intronic
983263005 4:165476704-165476726 AGACATGAGCAGGGCAGGAGAGG - Intronic
983406372 4:167336018-167336040 AGGTATGAGCAGGGCAGGAGAGG - Intergenic
983615725 4:169702240-169702262 AGGCATGAGCAGGGCAGGACAGG - Intronic
983658432 4:170107063-170107085 AAACATGAGCAGGGCAGGACAGG + Intergenic
983830560 4:172321760-172321782 AGACAAAAGCAGGGCAGGAGAGG + Intronic
983904994 4:173172608-173172630 AGACATGAGCAGGGCAGGAAAGG - Intronic
984329632 4:178298101-178298123 AGACATGAGCAGAGCAGGAGGGG - Intergenic
984918530 4:184744106-184744128 AGACGTGAGCAGGGCAGGAGAGG + Intergenic
984974483 4:185218373-185218395 CTACAGAAGCAGGCCAGGAGTGG - Intronic
985490907 5:178330-178352 AGGCATGAGCAGGGCAGGAGAGG - Intronic
985915791 5:2918143-2918165 AGACATGAGCAGGGCAGGACAGG - Intergenic
985963571 5:3322213-3322235 AGCTGTGAGCAGGCCAGGAGTGG + Intergenic
986178664 5:5373461-5373483 GGAGATGAGCAAGGCAGGAGAGG - Intergenic
986219152 5:5751940-5751962 AAGCATGAGCAGGCCAGGAAAGG + Intergenic
986408773 5:7454117-7454139 AGACATGAACAGGGCAGGAGAGG - Intronic
986479680 5:8174175-8174197 AAACATGAGCAGGGCAGAAGAGG + Intergenic
986650532 5:9959195-9959217 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
986685699 5:10273739-10273761 AGACATAAGCAGGGCAGGAGAGG - Intergenic
986748468 5:10763895-10763917 CGGCCTGAGCAGGGCAGGAGAGG + Intergenic
986977750 5:13412170-13412192 AGGTATGAGCAGGGCAGGAGAGG + Intergenic
987114682 5:14716885-14716907 TGAAATGAGCAGATCAGGTGTGG + Intronic
987487990 5:18544188-18544210 AGACATGAGCAGGACAGGAGAGG + Intergenic
987572026 5:19676396-19676418 AGGCAGGAGCAGGGCAGGAGAGG + Intronic
987620172 5:20330323-20330345 AGACATGAGCAGGACAAGAGAGG + Intronic
987664758 5:20922949-20922971 TGGCATGAGCATGGCAGGAAAGG + Intergenic
987701448 5:21405107-21405129 AGACATGACCAGGGCAGAAGCGG + Intergenic
987839003 5:23198502-23198524 AGACATGAGCAGGGTAAGAGAGG - Intergenic
987899821 5:23997330-23997352 AGACATGAGCAGGGCAGAAGAGG + Intronic
988179082 5:27766521-27766543 AGGCATGAGCCGGGCAGGAGAGG + Intergenic
988242530 5:28632517-28632539 AGACAGGAGCCGGGCAGGAGGGG + Intergenic
988629596 5:32914713-32914735 AGAGATGAGCAGGGCAGGAGAGG + Intergenic
988737649 5:34038827-34038849 AGACATGAGCAGGGTAGGGGAGG + Intronic
988776064 5:34479013-34479035 AGACACGAGCAGGATAGGAGAGG - Intergenic
988882137 5:35515328-35515350 AGACATGAGCAAGGCAAGAGAGG + Intergenic
989306948 5:39969196-39969218 AGGCATGAGCAGGGCAGAAGAGG + Intergenic
989634093 5:43516125-43516147 AGGCATGAGCAAGGCAGGAGAGG + Intergenic
989820889 5:45794880-45794902 AGAAATGAGCAGGGTAGGAGAGG - Intergenic
989999767 5:50879448-50879470 ACACATGAGCAGGGCAGAAGAGG + Intergenic
990051440 5:51506499-51506521 TGAGATAAGAAGGCCAGCAGGGG + Intergenic
990213204 5:53502669-53502691 AGACATGAGCAGGGCAGGAGAGG - Intergenic
990318106 5:54602963-54602985 AGGTATGAGCAGGGCAGGAGAGG - Intergenic
990433502 5:55762670-55762692 CGAGATGGGGAGGCCAGGAGGGG + Intronic
990444601 5:55882191-55882213 AGGCATGAGAAGGACAGGAGAGG - Intronic
990489157 5:56287268-56287290 AGATATGAGCAGGGCAGGAAAGG + Intergenic
990521337 5:56584266-56584288 AGGCATGAGCAGGGCAGGACAGG - Intronic
990777186 5:59315497-59315519 GGATATGAGCAGGGCAGGATAGG + Intronic
990896163 5:60701874-60701896 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
991103299 5:62817216-62817238 TGACATGATTGGACCAGGAGAGG + Intergenic
991164859 5:63553920-63553942 AGACATGAGCTGAGCAGGAGAGG + Intergenic
991657961 5:68921988-68922010 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
991929906 5:71744113-71744135 AGACATGAGCAGGGCAGGGCAGG + Intergenic
992433733 5:76735181-76735203 TTAAAAGAGCAGGCCAGGCGCGG + Exonic
993177325 5:84503326-84503348 AGACATGAGCAGAGTAGGAGAGG - Intergenic
993272414 5:85812607-85812629 AGACATGAGCAGGGCAAGAGAGG + Intergenic
993364798 5:87022235-87022257 AGGCATGAGCATGGCAGGAGAGG + Intergenic
993749478 5:91649366-91649388 AGACATGAGCAGTGCAGGAGAGG + Intergenic
994074150 5:95632353-95632375 AGACAAGAACAGGGCAGGAGAGG + Intergenic
995285459 5:110383670-110383692 AGAGATGAGGAGGCCAGGCGCGG + Intronic
995330982 5:110945715-110945737 AGACATGAGCAGGGCAGGAGAGG + Intergenic
995477178 5:112560115-112560137 AGACATGAGCAGGACAGGAGAGG - Intergenic
995482805 5:112609701-112609723 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
995514975 5:112944961-112944983 TGAAATGATTAGGCCAGGTGCGG - Intergenic
995558674 5:113357429-113357451 AGGCATGAGCAGGGCAGAAGAGG + Intronic
995926692 5:117383345-117383367 AGACATGAGTAGGGCAGGAGAGG - Intergenic
995966289 5:117911394-117911416 AGACATGAGCAGGTCAGGAGAGG + Intergenic
996280902 5:121728117-121728139 AGAAGTGAGCAGGACAGGAGAGG + Intergenic
996289417 5:121834552-121834574 AGGCATGAGCAGGACAGGAGAGG + Intergenic
996906841 5:128610489-128610511 AGACATGAGCAGGGCAGGAGAGG - Intronic
996998276 5:129725713-129725735 AGACATGACCAGGGCAGAAGTGG - Intronic
997065704 5:130556250-130556272 AGACATGAGAAGGGCAGGAGAGG + Intergenic
997498716 5:134353846-134353868 TGACATGATCAGGCTAGGCACGG - Intronic
998074738 5:139226360-139226382 AGGCATAAGCAGGGCAGGAGAGG - Intronic
998952794 5:147408727-147408749 TGTACTGAGCAGGCCAGAAGAGG - Exonic
999629328 5:153553909-153553931 AGACACGAGCAGGACAGGAGAGG - Intronic
1000199276 5:158991866-158991888 TGAAATGGGCAGGCAGGGAGGGG - Intronic
1000233260 5:159335004-159335026 AGACATGAGCAGGGCAGAAGAGG + Intergenic
1000616948 5:163437747-163437769 TGAGGTGAGCAGGCCCGGGGAGG + Exonic
1000737255 5:164919979-164920001 AGATATGATCAGGCCAGGCGCGG - Intergenic
1000766647 5:165299740-165299762 AGACATGAGCAGGGCAGGAGAGG - Intergenic
1001618681 5:173063657-173063679 AGAAATCAGCAGGCCAGGTGTGG - Intronic
1001882100 5:175253278-175253300 AGAAATGAGCAGCCCAGGTGAGG - Intergenic
1001914366 5:175547247-175547269 AGACATGAGCAGGAGAGGAGAGG - Intergenic
1001916070 5:175561202-175561224 AGGCATGAGCAGGGCTGGAGAGG + Intergenic
1002255665 5:177956844-177956866 TGTCAGGAGGAGGCCAGGTGCGG + Intergenic
1002319858 5:178368619-178368641 TGACTTGAGCAGGGGAAGAGTGG + Intronic
1002953955 6:1843475-1843497 TGTAAGGAGCAGGCCAGGAATGG + Intronic
1003168484 6:3701712-3701734 AGGCATGAGCAAGGCAGGAGAGG + Intergenic
1003204326 6:3993220-3993242 AGACGTGAGCAGGGCAGAAGAGG - Intergenic
1003877748 6:10453263-10453285 AGAGATGGGCAGGCCAGGCGTGG + Intergenic
1003949297 6:11103406-11103428 AGACATGAGCAGGGCAGGGGAGG - Exonic
1003950622 6:11112174-11112196 AGACATGAGCAGGGCAGGAGAGG - Intronic
1004200641 6:13544576-13544598 AGACATCAGCAGGGCAGGAGAGG + Intergenic
1004271035 6:14195758-14195780 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1004362980 6:14987330-14987352 AGACATGAGCAGGGCAGGAGAGG - Intergenic
1004467734 6:15901563-15901585 AGATATGAGCAGGGCAGGAGAGG - Intergenic
1004474308 6:15956930-15956952 AGACTTGAGCAGGGCAGGAGAGG - Intergenic
1005106490 6:22229563-22229585 AGGCATGAGCGGGGCAGGAGAGG - Intergenic
1005158246 6:22833324-22833346 AGACATGAGCAGGGGAGGAAAGG + Intergenic
1005812241 6:29526511-29526533 AGACATGAATAGGTCAGGAGAGG - Intergenic
1005820346 6:29593386-29593408 AGACACGAGCAGGGCAGGAAAGG + Intronic
1005980067 6:30829851-30829873 AGGGATGAGCAGGGCAGGAGAGG - Intergenic
1006235923 6:32632046-32632068 TAATATGAGGAGGCCAGGCGCGG - Intronic
1006436259 6:34027535-34027557 GGACATGGGCCGGCCAGGACCGG - Intronic
1006847429 6:37072313-37072335 TGCCATCAGCAGGCCAGGTGCGG + Intergenic
1007552566 6:42741417-42741439 AAAAATGAGGAGGCCAGGAGCGG - Intergenic
1007769367 6:44180659-44180681 AGAGGTGAGCAGGCCACGAGCGG + Exonic
1007834426 6:44663840-44663862 TGAAAGGATCAGGACAGGAGGGG + Intergenic
1008804518 6:55411554-55411576 AGGCATGAGCAGGACAGGAGAGG + Intergenic
1009746299 6:67820981-67821003 AGACATGAGCAGAGCAGGAGAGG - Intergenic
1009794282 6:68447270-68447292 AGACAGCAGCAGGGCAGGAGAGG + Intergenic
1010106013 6:72168867-72168889 AGACATGAGCAGGGCAGGAGAGG - Intronic
1010653115 6:78478725-78478747 AGGCATGAGTAGGGCAGGAGAGG - Intergenic
1010913733 6:81590110-81590132 TGACATGAGCAGGGCAGCAGAGG + Intronic
1011478320 6:87769416-87769438 TGAGAAAATCAGGCCAGGAGTGG - Intergenic
1011478697 6:87773073-87773095 AGACAGGAGCAGGGCAGGAGTGG + Intergenic
1011594939 6:89007340-89007362 AAACATGAGCAGAGCAGGAGAGG + Intergenic
1011891994 6:92175214-92175236 AGACATGATCAGTGCAGGAGAGG - Intergenic
1012192709 6:96300156-96300178 AGACATGAGCAGAGCTGGAGAGG - Intergenic
1012232926 6:96781905-96781927 AGGCATGAGCAGGAAAGGAGAGG + Intergenic
1012252142 6:96991536-96991558 TGACATGTTCAGGCCAGGGCAGG + Intronic
1012493727 6:99811440-99811462 AGACATGAGCAAGGCAGGAGAGG - Intergenic
1013922082 6:115417631-115417653 AAACATGAGCTGGGCAGGAGAGG - Intergenic
1014738441 6:125121763-125121785 AGGCATGAGCAGGGCAGGAGAGG - Intronic
1014768464 6:125434306-125434328 AGGCATGAGCAGGGCAGGAGGGG - Intergenic
1015139934 6:129919578-129919600 TAAAATGAACAGGCCAGGTGTGG + Intergenic
1015334883 6:132025633-132025655 TTTCATGAGCAGGGCAGGCGGGG + Intergenic
1015786237 6:136923143-136923165 TGACAGGGGAAGACCAGGAGAGG - Intronic
1016126585 6:140411486-140411508 AGTCATGAGCAAGGCAGGAGAGG + Intergenic
1016712898 6:147193849-147193871 AGACATGAGCAGAGCGGGAGAGG + Intergenic
1017145919 6:151234684-151234706 AGACAGGAGAAGGCCAGGCGCGG - Intergenic
1017201124 6:151755996-151756018 TGACATCAGAAGGTCAGGAGGGG - Intronic
1017408209 6:154142160-154142182 AGGCATGAGCAGGGCAGGACAGG + Intronic
1017426846 6:154330923-154330945 AGACATGAGCAGGGCAGGAGAGG + Intronic
1017779916 6:157707862-157707884 AGGCCTGAGCAGGGCAGGAGAGG - Intronic
1017793100 6:157818923-157818945 GGACCTGAGCAGTCCAGGAAGGG - Intronic
1018414726 6:163591110-163591132 GGAGATGCGCAGGGCAGGAGTGG - Intergenic
1018455941 6:163952188-163952210 AGACATGAGCAGGGCAGGAGAGG - Intergenic
1018845916 6:167555368-167555390 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1018863545 6:167730767-167730789 AGACATGAGCAGGGCAGGAGAGG + Intergenic
1019437580 7:1029925-1029947 GGACACGAGGAGGCCAGGAAGGG + Intronic
1019764042 7:2836631-2836653 TAACAAGAGAAGGCCAGGTGCGG + Intronic
1019917125 7:4140676-4140698 TCACATTTGCAGGCAAGGAGGGG - Intronic
1020224370 7:6268458-6268480 TTACAAGAGCAGGCCGGGCGCGG - Intronic
1020538473 7:9430424-9430446 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1020587360 7:10085684-10085706 TGATATGATCAGAGCAGGAGAGG - Intergenic
1020764394 7:12302455-12302477 AGACATGTGCAGGGCAAGAGAGG + Intergenic
1021449043 7:20764582-20764604 TTACATGTGTAGGCCAGGTGTGG - Intronic
1021506271 7:21389159-21389181 AGACATAAACAGGGCAGGAGAGG + Intergenic
1021598140 7:22338827-22338849 AGACATGAGCAGGGCAGAAGAGG + Intronic
1021627831 7:22611980-22612002 TGAGATGAGAAGGCTGGGAGTGG - Intronic
1021991098 7:26142406-26142428 AGACATGAACAGGGCAGGAGAGG - Intergenic
1022704002 7:32786382-32786404 TGACATGGGCAGGACTGGGGTGG - Intergenic
1022736373 7:33079953-33079975 AGACAAGAGCAGGGCAGGAGAGG - Intergenic
1022908239 7:34876510-34876532 TGACATGGGCAGGACTGGGGCGG - Intronic
1023089773 7:36607097-36607119 TGGCAAGAGCAGGAGAGGAGAGG + Intronic
1023238059 7:38112020-38112042 GGAGATGAGGAGTCCAGGAGGGG - Intergenic
1023330317 7:39108415-39108437 TGCCATGAGCAGTCCAGCTGAGG - Intronic
1023392112 7:39720638-39720660 AGACATGAGAAGGGCAGGAGAGG - Intergenic
1024193953 7:47040605-47040627 AGGCATGAGAAGGGCAGGAGAGG + Intergenic
1024239093 7:47420227-47420249 AGGCATGAGCAGGGCAGCAGAGG + Intronic
1024987498 7:55208252-55208274 TGTGATGGGCAGGTCAGGAGAGG + Exonic
1025084276 7:56009837-56009859 TGGCAGGAGCAGGCCATGGGTGG - Intergenic
1025708325 7:63886855-63886877 GGACCTGTACAGGCCAGGAGTGG + Intergenic
1026155987 7:67826234-67826256 AGACATGAGCAGGGCAGAAGAGG + Intergenic
1026221333 7:68400103-68400125 TGGCATGAGCGGAGCAGGAGAGG - Intergenic
1026221845 7:68405235-68405257 AGGCATGAGCAGGGCAGAAGAGG - Intergenic
1026258227 7:68731500-68731522 AGGCATAAGCAGGGCAGGAGAGG + Intergenic
1026287474 7:68975925-68975947 TGACAGGAGCAGGAAAGCAGTGG - Intergenic
1026322540 7:69280126-69280148 AGACATGAGCACAGCAGGAGAGG - Intergenic
1026626796 7:72000865-72000887 AGACATCAGCAGGGCCGGAGAGG + Intronic
1027254496 7:76422386-76422408 TGACATGAGGTGGCCAGGCGCGG + Intronic
1027596861 7:80184759-80184781 AGGCATGAGCAGGGCAGGAGAGG - Intronic
1027616478 7:80430717-80430739 AGACATGAGCACCGCAGGAGAGG + Intronic
1027991498 7:85368940-85368962 TGAGTTGAGCAGGCAAGGATTGG - Intergenic
1028035012 7:85971682-85971704 TGACAAGGGCAAGCCAGGTGTGG + Intergenic
1028342995 7:89746015-89746037 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1028694548 7:93693522-93693544 AGACATGAGCAGGGCAGGAGAGG - Intronic
1028807550 7:95045745-95045767 AGGCATGAGCAGGGCAGAAGAGG - Intronic
1028807562 7:95045816-95045838 AGGCATGAGCAGGGCAGAAGAGG - Intronic
1029354953 7:100044914-100044936 TGCCATCAGCTGGCCAGCAGAGG - Intergenic
1029499229 7:100917606-100917628 AGACATGAGGAGGGTAGGAGAGG + Intergenic
1030429526 7:109425832-109425854 AGACATGAGCAGGGCAGGAGAGG + Intergenic
1030816755 7:114048678-114048700 AGGCATGAGCAGGGCAGAAGAGG + Intronic
1031210949 7:118825430-118825452 AGACATGAGCAGGGCGGGAGAGG - Intergenic
1031347504 7:120687044-120687066 AGACATGAGCAGGGTAGGAGAGG - Intronic
1031539514 7:122976756-122976778 AGACATGAGCAAGGCAGGAGAGG + Intergenic
1031637322 7:124117453-124117475 AGACATGAGCAGGGCAGGAGAGG - Intergenic
1031765357 7:125770862-125770884 AGGCATGAGCGGGGCAGGAGAGG - Intergenic
1031779860 7:125947479-125947501 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1031926418 7:127642863-127642885 AGTCAAGAGCAGGCCAGGTGCGG - Intergenic
1032276729 7:130463418-130463440 TGACATTATGAGGCCAGGCGTGG - Intergenic
1033278341 7:139989091-139989113 TGCTATGGGCAGGGCAGGAGCGG - Intronic
1033446543 7:141428014-141428036 AGACATGACCAGAACAGGAGAGG + Intronic
1034535169 7:151721569-151721591 TGTCACGGGCAGGCCTGGAGGGG - Intronic
1034732052 7:153396426-153396448 AGACATGAGCAGGGCAGGAGAGG + Intergenic
1035548324 8:500914-500936 GAACATGAGCAGGCCGGGCGCGG + Intronic
1035581926 8:745975-745997 TGGCCTGAGCAGGCCGTGAGGGG - Intergenic
1036044476 8:5123850-5123872 GGACATGAGTAAGGCAGGAGAGG - Intergenic
1036111382 8:5906706-5906728 TAACATGAGCATGTCAGAAGTGG - Intergenic
1036277368 8:7367225-7367247 GAGCATGAGCAGGGCAGGAGAGG + Intronic
1036343962 8:7943110-7943132 GAGCATGAGCAGGGCAGGAGAGG - Intronic
1036839304 8:12103877-12103899 GAGCATGAGCAGGGCAGGAGAGG - Intergenic
1036861093 8:12350120-12350142 GAGCATGAGCAGGGCAGGAGAGG - Intergenic
1037020235 8:13960723-13960745 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1037132829 8:15427285-15427307 AGGTATGAGCAGGGCAGGAGAGG + Intronic
1037152498 8:15655066-15655088 AGACATGAGCAGGGCAGGAGAGG + Intronic
1037499372 8:19470603-19470625 GGGCATGAGCGGGGCAGGAGAGG + Intronic
1037591762 8:20318308-20318330 TGACAGGAAGAGGCCAGGTGTGG - Intergenic
1037941374 8:22953446-22953468 AGATATGAGCAGGGCAGGAGAGG - Intronic
1037962510 8:23108491-23108513 AGGTATGAGCAGGACAGGAGAGG - Intronic
1038404866 8:27314019-27314041 AGGCATGAGCAGGGCAGGAGAGG - Intronic
1038859962 8:31376068-31376090 TGAGTTGAACAGGCAAGGAGTGG - Intergenic
1038869878 8:31482177-31482199 ACACATGAGCAGGGCAGGAGAGG - Intergenic
1038959594 8:32504299-32504321 AGACATGAGCAGGGCAGGAGAGG - Intronic
1039055549 8:33533480-33533502 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1039177323 8:34824679-34824701 TGACAAGATCAGGCCAAAAGTGG + Intergenic
1039729183 8:40256015-40256037 AGATATGAGCAGGGCAGGAGAGG - Intergenic
1040664881 8:49620362-49620384 AGACATGAGCAGGGAAGAAGAGG + Intergenic
1040673058 8:49715771-49715793 AGTCATGAGCAGGTCAAGAGAGG + Intergenic
1041028058 8:53707234-53707256 TTCCATGAACTGGCCAGGAGGGG - Intergenic
1041351017 8:56947627-56947649 AGGCATCAGCAGGGCAGGAGAGG + Intergenic
1041376464 8:57212278-57212300 AGACAGGAGCAGCGCAGGAGAGG - Intergenic
1041377410 8:57217668-57217690 AGACAGGAGCAGCGCAGGAGAGG - Intergenic
1041377930 8:57221324-57221346 TGACATAAGCAGGGTATGAGGGG - Intergenic
1041482891 8:58343006-58343028 GGGCATGAACAGGGCAGGAGAGG - Intergenic
1041537254 8:58940693-58940715 TGAAATGAGCAGGCAAGGGTGGG + Intronic
1041720839 8:60973894-60973916 AGACATGAACAGGACAGGAGAGG - Intergenic
1041918726 8:63160869-63160891 TGGCATGAGTAGGGCAGGAGAGG - Intergenic
1042230412 8:66548676-66548698 AGACACGAGCAGGGCAGGAAAGG - Intergenic
1042311129 8:67380355-67380377 AGACATGAGTAGGGCAGGAGAGG + Intergenic
1042343213 8:67702395-67702417 AGACATGAGCAGTGCAGGAGAGG + Intronic
1042396382 8:68295989-68296011 AGACATGAGCAGGGCAGGAGAGG + Intergenic
1042397377 8:68307835-68307857 AGACATGAGCAGGACAGGAGAGG - Intronic
1042747850 8:72126985-72127007 AGGCATGAGCAGGGCAGGGGAGG + Intergenic
1042863053 8:73333045-73333067 AGGCATGAGCAGAACAGGAGAGG + Intergenic
1043005097 8:74809181-74809203 GGGCATGAGGAGGGCAGGAGAGG + Intronic
1043091140 8:75906212-75906234 AGACATGAGCGGGACAGGAGAGG + Intergenic
1043840589 8:85099034-85099056 GGACAGGATCAGGCCAGGTGTGG + Intergenic
1044070818 8:87757319-87757341 GGAAAAAAGCAGGCCAGGAGGGG + Intergenic
1044085449 8:87937198-87937220 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1044119216 8:88374207-88374229 AGACATGAGCAGGGCAGGAGAGG + Intergenic
1044139885 8:88637336-88637358 AGACCTGAGCAGGGCAGAAGAGG + Intergenic
1044199394 8:89415220-89415242 AGACATGAGCAGGGCAGGAGAGG - Intergenic
1044362984 8:91310187-91310209 AGACATGAGCAGGGCAGTAGAGG - Intronic
1044634649 8:94310346-94310368 AGGTATGAGCAGGGCAGGAGAGG - Intergenic
1045477449 8:102565298-102565320 TGTAATGATCAGGCCAGGTGTGG - Intergenic
1045977794 8:108149174-108149196 AGGCATGAGCAGAGCAGGAGAGG - Intergenic
1046337701 8:112812028-112812050 AGACATGAGCAGGGCAGGAAAGG + Intronic
1046400671 8:113699596-113699618 ATACATGAGCAGGGCAAGAGAGG - Intergenic
1047004975 8:120610911-120610933 AGGTATGAGCAGGGCAGGAGCGG - Intronic
1047214266 8:122863982-122864004 TGTCATGAGCAGGGCAGAGGTGG + Intronic
1047544789 8:125805035-125805057 ATACATGAGCAGGGCAGGAGAGG - Intergenic
1047871826 8:129091483-129091505 CGACATGAGCAGGGCAGGACAGG - Intergenic
1048128343 8:131662935-131662957 AGGCATGAGCAGGGCAGGAGTGG + Intergenic
1048161437 8:132025196-132025218 AGATATGAGCAGGGCAGGATAGG + Intronic
1048257683 8:132917570-132917592 AGACAGGGACAGGCCAGGAGAGG + Intronic
1048378688 8:133845226-133845248 TTACATGAGCTGGACAGGAAAGG - Intergenic
1048431868 8:134378114-134378136 AGACATGAGCAGGGCAGGAGAGG + Intergenic
1048474034 8:134727031-134727053 AGACATGAGCAGGGCAGGAAAGG - Intergenic
1048639139 8:136333514-136333536 AGACATGAGTGGGGCAGGAGAGG + Intergenic
1048970488 8:139642727-139642749 TGACCTGAGCAGGCCCTGTGGGG - Intronic
1049378615 8:142301225-142301247 TGGCATGGGCAGGGCAGGTGGGG - Intronic
1049378637 8:142301287-142301309 TGGCATGGGCAGGGCAGGTGGGG - Intronic
1049378659 8:142301349-142301371 TGGCATGGGCAGGGCAGGTGGGG - Intronic
1049378683 8:142301416-142301438 TGGCATGGGCAGGGCAGGTGGGG - Intronic
1049378705 8:142301478-142301500 TGGCATGGGCAGGGCAGGTGGGG - Intronic
1049378730 8:142301545-142301567 TGGCATGGGCAGGGCAGGTGGGG - Intronic
1049583794 8:143423908-143423930 TGACATTTGCAGGACAGGAAAGG - Intronic
1049592527 8:143469064-143469086 GGACATGAGGAAGCCAGCAGGGG - Intronic
1049730004 8:144171814-144171836 AGACATGAACAGGGCAGGAGAGG - Intronic
1049933094 9:474939-474961 AGACATGTGCAGTGCAGGAGAGG + Intronic
1050042978 9:1514870-1514892 AGACATAAGCAGGGGAGGAGAGG - Intergenic
1050085839 9:1964963-1964985 TGACAGGAGGCGGCTAGGAGTGG - Intergenic
1050204830 9:3185710-3185732 AGGCATGAACAGGGCAGGAGAGG + Intergenic
1051080482 9:13288224-13288246 AGGCATGAGCGGGGCAGGAGAGG + Intergenic
1051278829 9:15421793-15421815 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1051997241 9:23232909-23232931 AGGCATGAGCAGAGCAGGAGAGG + Intergenic
1052263047 9:26539697-26539719 AGACATGAGCAGGGCAGGAGAGG + Intergenic
1052517680 9:29503862-29503884 AGACATGAGCAGGGCAGGAGAGG - Intergenic
1052547664 9:29900897-29900919 AGGCATGAGTAGGGCAGGAGAGG - Intergenic
1052664042 9:31471781-31471803 AGATATGAGCAGGGGAGGAGAGG + Intergenic
1053114360 9:35489032-35489054 AGGCATGAGCGGGGCAGGAGAGG - Intergenic
1053176227 9:35926607-35926629 GGACAGGACCAGGCCAGGCGTGG - Intergenic
1053484171 9:38439533-38439555 TGAGATGAGGATGCCAGGGGAGG + Intergenic
1053825771 9:42022820-42022842 AGACATGAGCAGAACAGGAGAGG + Intronic
1054604792 9:67164573-67164595 AGACATGAGCAGAACAGGAGAGG - Intergenic
1055058658 9:72046830-72046852 AGACATGAGCAGAGCAGGAGAGG + Intergenic
1055464157 9:76547224-76547246 AGACATGAGCTGGGCAGGAGAGG - Intergenic
1055602385 9:77933373-77933395 TGGCATCATCTGGCCAGGAGCGG + Intronic
1055975765 9:81953910-81953932 TGACATGACAGGGACAGGAGAGG + Intergenic
1056303584 9:85267807-85267829 AGGCATGAGCAGGGCAGGACAGG - Intergenic
1056435260 9:86569670-86569692 AGGCATGAGCAGGGTAGGAGAGG - Intergenic
1056477116 9:86963579-86963601 AGGCATGAGCAGGGCAGCAGAGG - Intergenic
1056739738 9:89244080-89244102 AGACACGAGCAGGGCAGGAGAGG - Intergenic
1057174837 9:92988507-92988529 AGACATGAGCAGGGGAGCAGGGG - Intronic
1057333085 9:94134327-94134349 AGACATGAGCAGGGCAGGAGAGG + Intergenic
1057333595 9:94139268-94139290 AGACATGAGCAGGGCAGGAGAGG - Intergenic
1057599367 9:96443908-96443930 TTAAATGAACAGGCCAGGCGTGG + Intergenic
1057656736 9:96960233-96960255 GGACATGATCAGGCCGGGAGCGG - Intronic
1058247793 9:102652605-102652627 AGACATGAGCTGGGCAGGAGAGG + Intergenic
1059638057 9:116189972-116189994 AGACATGAGCAGCCCATGTGAGG + Intronic
1059901367 9:118930138-118930160 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1060142599 9:121223316-121223338 AGACATGAGCAGGGCAGGAGAGG - Intronic
1060646669 9:125286432-125286454 GGTCAAGAGCTGGCCAGGAGTGG - Intronic
1061022790 9:128027057-128027079 TCACATGAGCAGGACAGGCAAGG + Intergenic
1061036167 9:128115495-128115517 TGACCTGGGCTGGCCAGGAGCGG + Intergenic
1061482066 9:130902288-130902310 TGGCTGGAGCAGGCCAGGTGCGG - Intergenic
1061887506 9:133599234-133599256 TGACCTGACCATGCAAGGAGTGG - Intergenic
1061988936 9:134147316-134147338 TGATTTGACCAGTCCAGGAGGGG - Intronic
1062123712 9:134848327-134848349 AGACATCTGCAGGACAGGAGCGG - Intergenic
1062212069 9:135370555-135370577 TGACGTCAGCAGGCCAGCGGCGG + Intergenic
1185956726 X:4498844-4498866 AGGCATGAGCAGAGCAGGAGAGG - Intergenic
1186072813 X:5841225-5841247 AGACAGGAGCAGGGCAGGAGAGG + Intronic
1186570678 X:10712129-10712151 TGACATGAGTAGGGAAGGAGAGG + Intronic
1186877176 X:13828041-13828063 TGACATGAGCACTGTAGGAGGGG - Intronic
1187509981 X:19908960-19908982 TGGTATGAGCAGGGCAGGAGAGG - Intergenic
1187613527 X:20968811-20968833 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1187700429 X:21959917-21959939 TGAAAGGAGCAGGCAAGAAGGGG + Intronic
1188905802 X:35789640-35789662 AGACATAAGCAGGGGAGGAGAGG - Intergenic
1188953612 X:36407596-36407618 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1188989737 X:36803046-36803068 AGAGATGAGCAGGGCAGGAGAGG + Intergenic
1189261196 X:39679928-39679950 TGCCTTGGGCAGGCCAGGAGAGG + Intergenic
1189460616 X:41239853-41239875 TGATATTAGCAGGCCTGGCGCGG + Intergenic
1189995103 X:46630587-46630609 TGACCTGGGCAGGCAAGGTGGGG - Intronic
1190771934 X:53522041-53522063 AGACATGAGCAGGGCAGGAGAGG - Intergenic
1191884628 X:65875704-65875726 AGACATGAGCAGTGCAGGAGAGG - Intergenic
1191891465 X:65947063-65947085 TGAGTTGAACAGGCAAGGAGTGG - Intergenic
1192811970 X:74555008-74555030 AGGCATAAGCAGGGCAGGAGAGG - Intergenic
1193066607 X:77267207-77267229 AGACATGAGCAAGGCAGGAGAGG + Intergenic
1193330793 X:80233411-80233433 AGACATGAGCAGAGCAGGAGAGG - Intergenic
1193812155 X:86064381-86064403 AGCCATGAGCAGGGTAGGAGAGG - Intergenic
1193956918 X:87874669-87874691 AGCCATGAGCAGAGCAGGAGAGG - Intergenic
1194010948 X:88560143-88560165 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1194111431 X:89839208-89839230 AGACATGAACAGGGAAGGAGAGG + Intergenic
1194159468 X:90432949-90432971 AGACATGAACAGGGCAGGAAAGG - Intergenic
1194169767 X:90566579-90566601 AGGCATGAGCAGAGCAGGAGAGG - Intergenic
1194170728 X:90576860-90576882 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1194413521 X:93582097-93582119 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1194627673 X:96244264-96244286 AGACATGAGTAGAGCAGGAGAGG - Intergenic
1194849660 X:98855530-98855552 AGACATGAGCAGAGCAGGAGAGG + Intergenic
1194850686 X:98864950-98864972 AGACATGAGCAGAGCAGAAGAGG + Intergenic
1194980731 X:100437832-100437854 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1195219409 X:102732114-102732136 AGGCATGAGCAGGGCAAGAGAGG - Intronic
1195258397 X:103110388-103110410 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1195325836 X:103757697-103757719 AGACATGAGCAGGGCAGGAGAGG - Intergenic
1195448780 X:104985377-104985399 TGAGATAAACAGGCCAGGCGTGG - Intronic
1195674812 X:107499950-107499972 TGGGAGGAGCAGGCCAAGAGTGG + Intergenic
1195717851 X:107835039-107835061 TGCCAGGAGCAGGGCAGGGGAGG - Intronic
1196051783 X:111313235-111313257 TGGCATGAGCAGGAAAAGAGAGG - Intronic
1196366047 X:114925629-114925651 AGACATGAGCAGGGCAGGAGAGG + Intergenic
1196705424 X:118713157-118713179 AGGTATGAGCAGGGCAGGAGAGG - Intergenic
1196792193 X:119474015-119474037 ATATATGAGCAGTCCAGGAGAGG - Intergenic
1197149802 X:123207824-123207846 TGACAAGAGAAGGCCAAAAGAGG + Intronic
1197470406 X:126861396-126861418 AGACTTGAGCAGGGCAGGAGAGG + Intergenic
1197492879 X:127140269-127140291 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1197932361 X:131709196-131709218 AGATATGAGCAGGGCAGGAGAGG - Intergenic
1198215504 X:134550827-134550849 AGCCCTGGGCAGGCCAGGAGGGG + Intergenic
1198393655 X:136201704-136201726 AGACATGAGCAGGGCAAGAGAGG - Intronic
1198725918 X:139676852-139676874 AGACATGAGCAGGGCAGGAGAGG + Intronic
1198823462 X:140673978-140674000 AGACATGAGCAGGGCAGGAGAGG + Intergenic
1198910668 X:141610031-141610053 AGGCATGAACAGGGCAGGAGAGG - Intronic
1199322958 X:146462815-146462837 AGGCATGAGCGGGGCAGGAGAGG - Intergenic
1199347389 X:146757509-146757531 AGGCATGAGCCGGGCAGGAGAGG - Intergenic
1199530159 X:148837655-148837677 TGAGAGGAGTAGGCCAGGAATGG - Exonic
1200464100 Y:3494025-3494047 AGACATGAACAGGGAAGGAGAGG + Intergenic
1200505767 Y:4009919-4009941 AGACATGAACAGGGCAGGAAAGG - Intergenic
1200516008 Y:4144352-4144374 AGGCATGAGCAGAGCAGGAGAGG - Intergenic
1200516969 Y:4154607-4154629 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1201344357 Y:12966759-12966781 GGGCATGAGCAGGGCAGGAGAGG - Intergenic
1201601270 Y:15730830-15730852 AGGCATGAGCTGGACAGGAGAGG - Intergenic
1201745140 Y:17363707-17363729 AGGCATGAGCAGAGCAGGAGAGG - Intergenic
1202274146 Y:23098346-23098368 AGACATGAGCAGGGAAGGAGAGG + Intergenic
1202291880 Y:23322331-23322353 AGACATGAGCAGGGAAGGAGAGG - Intergenic
1202427142 Y:24732091-24732113 AGACATGAGCAGGGAAGGAGAGG + Intergenic
1202443649 Y:24938003-24938025 AGACATGAGCAGGGAAGGAGAGG - Intergenic