ID: 1084376539

View in Genome Browser
Species Human (GRCh38)
Location 11:68782092-68782114
Sequence TCCAGCAAACAGTCTCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 161}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084376539_1084376545 17 Left 1084376539 11:68782092-68782114 CCCATCTGAGACTGTTTGCTGGA 0: 1
1: 0
2: 0
3: 6
4: 161
Right 1084376545 11:68782132-68782154 CTGGTCTCCAGACCACAGCATGG 0: 1
1: 0
2: 2
3: 100
4: 876
1084376539_1084376549 24 Left 1084376539 11:68782092-68782114 CCCATCTGAGACTGTTTGCTGGA 0: 1
1: 0
2: 0
3: 6
4: 161
Right 1084376549 11:68782139-68782161 CCAGACCACAGCATGGGGAGCGG 0: 1
1: 0
2: 7
3: 46
4: 371
1084376539_1084376547 19 Left 1084376539 11:68782092-68782114 CCCATCTGAGACTGTTTGCTGGA 0: 1
1: 0
2: 0
3: 6
4: 161
Right 1084376547 11:68782134-68782156 GGTCTCCAGACCACAGCATGGGG 0: 1
1: 0
2: 2
3: 20
4: 200
1084376539_1084376551 28 Left 1084376539 11:68782092-68782114 CCCATCTGAGACTGTTTGCTGGA 0: 1
1: 0
2: 0
3: 6
4: 161
Right 1084376551 11:68782143-68782165 ACCACAGCATGGGGAGCGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 161
1084376539_1084376550 27 Left 1084376539 11:68782092-68782114 CCCATCTGAGACTGTTTGCTGGA 0: 1
1: 0
2: 0
3: 6
4: 161
Right 1084376550 11:68782142-68782164 GACCACAGCATGGGGAGCGGTGG 0: 1
1: 0
2: 1
3: 26
4: 247
1084376539_1084376546 18 Left 1084376539 11:68782092-68782114 CCCATCTGAGACTGTTTGCTGGA 0: 1
1: 0
2: 0
3: 6
4: 161
Right 1084376546 11:68782133-68782155 TGGTCTCCAGACCACAGCATGGG 0: 1
1: 0
2: 1
3: 20
4: 172
1084376539_1084376542 -2 Left 1084376539 11:68782092-68782114 CCCATCTGAGACTGTTTGCTGGA 0: 1
1: 0
2: 0
3: 6
4: 161
Right 1084376542 11:68782113-68782135 GAAGGACTCTCACCTGCTCCTGG 0: 1
1: 0
2: 1
3: 24
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084376539 Original CRISPR TCCAGCAAACAGTCTCAGAT GGG (reversed) Intronic
900467907 1:2834818-2834840 TCCACCAAACAGCCTCTGAGGGG + Intergenic
903512495 1:23886722-23886744 TCCAGAAAACAGTCCAAGAATGG + Intronic
906693236 1:47806763-47806785 TCCTGTAAACAGTCCTAGATGGG + Intronic
907679938 1:56553598-56553620 TCCAGCAATGAGTTTCAGAGAGG - Intronic
907904275 1:58770056-58770078 TGCAGCAAAGCCTCTCAGATGGG + Intergenic
908067718 1:60425660-60425682 TCCAGAAAACTCTCTCAGCTGGG + Intergenic
908708252 1:66984845-66984867 TCCAAGAAGCAGTCTCACATGGG + Exonic
911482475 1:98461333-98461355 TTCAACTAACAGTCTCAGCTTGG + Intergenic
913476972 1:119246911-119246933 TCCTGCAAAGGGTCTTAGATTGG + Intergenic
915529057 1:156493011-156493033 GGCAGCAGACAGTCTCAGAAGGG + Intronic
916418812 1:164617226-164617248 CCCAGCTAACAGACTCAAATGGG - Intronic
916511710 1:165477607-165477629 TCCATCCAACAGACTCACATTGG - Intergenic
918828386 1:189357196-189357218 TCAAGCTAACAGTCTCATCTGGG + Intergenic
919809623 1:201400249-201400271 TCCAGGAACCAGCCTCAGGTGGG + Intergenic
920436207 1:205948624-205948646 TCCAGGAAAGAGTCTGAGACTGG + Intergenic
922044476 1:221930041-221930063 TCTAGAAAATAGTCTCAGAAAGG + Intergenic
1063284422 10:4669134-4669156 TCCAGTAAAAAGTCAAAGATTGG - Intergenic
1065916281 10:30357071-30357093 TCCAGCACACAGTCCCAGCAGGG + Intronic
1065968698 10:30788867-30788889 TCCCTGAAACAGTCTCAGAGGGG + Intergenic
1072829501 10:98642694-98642716 TTCAGCAAAGAGTCTCACAAAGG - Intronic
1076016538 10:127032299-127032321 TCCACCAAACTGACTCAGAACGG + Exonic
1076211789 10:128653488-128653510 TCCAACAAGCAGTCTCTGAGGGG - Intergenic
1079183026 11:18210388-18210410 ACTCGCATACAGTCTCAGATTGG + Exonic
1079183707 11:18216791-18216813 TCTAGAAAACAGTCTCAGAAAGG + Intronic
1079454052 11:20622054-20622076 TCAGGCCAACAGGCTCAGATGGG + Intronic
1081689101 11:45064250-45064272 CCCAGCAAACAGTCACACTTTGG + Intergenic
1081762016 11:45583272-45583294 TCCAGCCAACAGCCCCAGCTAGG + Intergenic
1084376539 11:68782092-68782114 TCCAGCAAACAGTCTCAGATGGG - Intronic
1084860375 11:72014160-72014182 TCCTGCCAGCAGCCTCAGATTGG + Exonic
1085748259 11:79134050-79134072 TTCAGCAAACAGTGACAGTTTGG - Intronic
1086277185 11:85145466-85145488 TCTAGAAAACAGTCTCAAAAGGG - Intronic
1086292155 11:85323989-85324011 TCCAGCAAAGATTCTCAGACTGG + Intronic
1088824756 11:113484174-113484196 TCCAGCAAACCTTCCCAGAGGGG + Intergenic
1089184063 11:116602981-116603003 TCCAGGAAACAGCCTCTGAGTGG + Intergenic
1094227932 12:28067368-28067390 TCCAGCAAAGGGTCTCAGAACGG - Intergenic
1099888244 12:88558110-88558132 TCAGGCATTCAGTCTCAGATTGG - Intronic
1101620079 12:106377797-106377819 TCCATAAAACAATATCAGATGGG + Intronic
1102318126 12:111906453-111906475 TCTAGCAAATAGTCTCAAAAGGG + Intergenic
1102481572 12:113227347-113227369 TCCTGCCAACGGTTTCAGATGGG - Intronic
1107369980 13:39735060-39735082 TCCAACAAAAAGTCACAGAGTGG - Intronic
1109158459 13:58941749-58941771 TACAGCAAAAAGTCTTAAATGGG - Intergenic
1109923884 13:69107765-69107787 TCAAGAAAACAGCCTCAGAAGGG + Intergenic
1113351509 13:109533766-109533788 ACCAGCCAACAGTCTGAGTTAGG - Intergenic
1117200640 14:53386426-53386448 TCCAGAAAACACTTTCAGAATGG + Intergenic
1118780943 14:69007176-69007198 TCCAGCAAGCAGTCAAAGTTGGG + Intergenic
1119545280 14:75467505-75467527 CTCAGCAAACACTCACAGATGGG + Intronic
1120740946 14:88108242-88108264 TCCACCAAACAGTCTAAGGCAGG + Intergenic
1121822832 14:96985214-96985236 TCTAGCAAACAGTGTCACACAGG - Intergenic
1124484211 15:30101243-30101265 TCCAGCACACAGTCCCAGCAGGG - Intergenic
1124519371 15:30395981-30396003 TCCAGCACACAGTCCCAGCAGGG + Intergenic
1124539284 15:30570240-30570262 TCCAGCACACAGTCCCAGCAGGG - Intergenic
1124743531 15:32318281-32318303 TGTAGCAAACAGTTTCAAATGGG - Intergenic
1124759366 15:32437332-32437354 TCCAGCACACAGTCCCAGCAGGG + Intergenic
1125133682 15:36314964-36314986 TCTTGCAAACAGACTCAGATGGG - Intergenic
1126718690 15:51552304-51552326 TCCTGCAAACATCCTCTGATTGG - Intronic
1128368787 15:67024095-67024117 TCCAGGAAACAGACCCAGGTAGG + Intergenic
1130275042 15:82472118-82472140 TCCAGCGCACAGTCCCAGAAGGG + Intergenic
1130467391 15:84199487-84199509 TCCAGCGCACAGTCCCAGAAGGG + Intergenic
1130486221 15:84399734-84399756 TCCAGCACACAGTCCCAGTAGGG - Intergenic
1130496869 15:84474048-84474070 TCCAGCGCACAGTCCCAGAAGGG - Intergenic
1130511976 15:84596958-84596980 TCTAGAAAACAGCCTCAGAAGGG + Intergenic
1130589686 15:85204085-85204107 TCCAGCGCACAGTCCCAGAAGGG + Intergenic
1131389639 15:92036235-92036257 TCCAGAACAAATTCTCAGATTGG - Intronic
1132185712 15:99800322-99800344 TCCAGCACACAGTCCCAGCAGGG - Intergenic
1134570858 16:15289915-15289937 CCCAGCCCACAGTCTCAGAGGGG - Intergenic
1134731520 16:16466159-16466181 CCCAGCCCACAGTCTCAGAGGGG + Intergenic
1134935931 16:18245842-18245864 CCCAGCCCACAGTCTCAGAGGGG - Intergenic
1138706808 16:58923438-58923460 TTCACCAAACATTCTCAGCTGGG + Intergenic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1141643170 16:85353398-85353420 TCCATCAAACGGTCTAACATAGG - Intergenic
1145283817 17:21488743-21488765 TCCTAGAAACAGGCTCAGATAGG - Intergenic
1146722098 17:35130750-35130772 TGCTGCAGACAGCCTCAGATGGG + Intronic
1149054471 17:52346572-52346594 TCTAGAAAATAGCCTCAGATGGG - Intergenic
1150180543 17:63115221-63115243 TCCAGGAAACAGAATGAGATAGG + Intronic
1150828142 17:68494708-68494730 CCCGGCAAACGGTCTCAGCTGGG + Intergenic
1158537299 18:58319646-58319668 TCCAGGGAACAGGATCAGATTGG + Intronic
1158940290 18:62401336-62401358 TTCAGCATCCAGTCTTAGATAGG + Intergenic
1161721356 19:5904420-5904442 TCCCTTATACAGTCTCAGATTGG - Intergenic
1166119109 19:40674385-40674407 TACAGAGAACAGTCTCAGAGTGG - Intronic
1168382454 19:55935362-55935384 GCCAGCAAAGAGCCACAGATGGG + Intergenic
926426846 2:12745990-12746012 TCCAGAAAACATTCCCAGAATGG - Intergenic
939241393 2:139564966-139564988 ATCAGCAAACAGTTTGAGATAGG - Intergenic
939728095 2:145748442-145748464 TCCAGCAATCAGTCAGAGAATGG + Intergenic
942071962 2:172324386-172324408 TCCAGGAAACAGACTCAGGGAGG + Intergenic
946974479 2:225132791-225132813 TTAAGCAAAAAGTCTCAGGTAGG + Intergenic
948329511 2:237154054-237154076 TCCAGTAAACAAACTCAGAGAGG - Intergenic
1172980290 20:38936463-38936485 GCCAGCAAACACTATGAGATAGG + Intronic
1173982142 20:47232823-47232845 TTCAGCAAGAAGTCTCAGTTTGG + Intronic
1177371482 21:20209873-20209895 TCCAACATTCAGTCTCACATTGG + Intergenic
1178481028 21:32979292-32979314 TCCAGCAACCAGTCTCTCCTGGG - Intergenic
1180198073 21:46209147-46209169 TGCTGCAAACAGTCTCAGGAGGG + Intronic
1182898218 22:33875959-33875981 TCCAGCAGCCACTCCCAGATAGG + Intronic
1183825363 22:40382452-40382474 TCCGGCCAACAGTCCCAGGTGGG - Intronic
1183988002 22:41579865-41579887 TCCAGGAAATAGGCTCAGAGAGG - Intronic
951305357 3:21053800-21053822 TCCAACAAAATGTCTAAGATGGG + Intergenic
951311997 3:21138453-21138475 TCCATCCAACAGTCTGAGGTGGG + Intergenic
952390124 3:32872912-32872934 TCCAGCAAACATTTACAGAGTGG + Intronic
952700118 3:36318806-36318828 TTTAGCAGACCGTCTCAGATAGG + Intergenic
961553607 3:127682646-127682668 TCCTGAAAACAGCCTGAGATGGG + Intergenic
962135235 3:132724832-132724854 TCCAGGTGACAGTCTCAGCTGGG + Intergenic
963528554 3:146445788-146445810 TCCAGAAAACAGCCTCAAAACGG - Intronic
963889020 3:150612551-150612573 TTGAGCAAATAGACTCAGATAGG - Intronic
965376467 3:167930538-167930560 TTCAGGAAACAGACTCAGAGAGG + Intergenic
967257173 3:187605299-187605321 TTCAGCAAACAGTGACAGTTTGG + Intergenic
967505468 3:190248102-190248124 TCCAGCAAACTGGATGAGATTGG - Intergenic
967688665 3:192447289-192447311 TCCAGGATACAGACTCAGATTGG + Intronic
974128493 4:57724713-57724735 TCCAGCAAACAGATTCCTATGGG - Intergenic
975335636 4:73171918-73171940 TCCAGAAAACAGCCTCAAAATGG + Intronic
979236858 4:118410109-118410131 TCCAGCAATCAGTCTAGGAGAGG - Intergenic
979955397 4:126948017-126948039 TCCAGGAAACACACTCTGATGGG - Intergenic
981154791 4:141422241-141422263 TCTAGAAAACAGTCTCAAAAGGG - Intergenic
981565313 4:146095236-146095258 TTCAGGAAACAGTCTCCAATGGG + Intergenic
981880637 4:149606907-149606929 TCTAGCAAATAGTCTCAAAGGGG + Intergenic
982615465 4:157635112-157635134 TCTAGCAAACAGCCTCAAAAGGG + Intergenic
983116171 4:163819092-163819114 TCCACCCAACAGTCACAGCTTGG + Intronic
983636143 4:169899684-169899706 TCAAGGATACAGGCTCAGATGGG + Intergenic
986553957 5:8991427-8991449 TCCTGCATAGAGTCTCAGAATGG + Intergenic
986702058 5:10420067-10420089 TCCAGTCAACAGCCCCAGATGGG - Intronic
990715550 5:58632605-58632627 GCCAGATAACAGTCTTAGATTGG + Intronic
990759236 5:59110265-59110287 TCAACCAAGCAGTCTCAGAAAGG - Intronic
991611728 5:68456481-68456503 TCCAGGAAACCCCCTCAGATGGG + Intergenic
992715664 5:79509123-79509145 TTCAGCAAAGAGACTCAGTTTGG + Intronic
993180649 5:84547850-84547872 ACCAGCAATCAGTGTCTGATGGG - Intergenic
998278070 5:140777278-140777300 TCCACCATACAGTCCCAGTTTGG - Intergenic
998537059 5:142943245-142943267 TTCAGGAACCAGTCTCAGATAGG - Intronic
999701201 5:154230191-154230213 TCCCTGAAACAGTCTCAGGTAGG + Intronic
1000651156 5:163820788-163820810 TCTAGAAAACAGTCTCAAAAGGG - Intergenic
1001536813 5:172503880-172503902 TCCAGCAAACAATTTAAAATGGG - Intergenic
1003380361 6:5619437-5619459 TCCTGCTCACAGTCGCAGATGGG + Intronic
1006124333 6:31827905-31827927 TCCAGCCCCCAGTCTCAGAGCGG + Exonic
1006678578 6:35780879-35780901 TTCAGCAAACATCCTAAGATCGG + Intergenic
1006699919 6:35963754-35963776 TCTAGAAACCATTCTCAGATGGG + Intronic
1008822396 6:55649722-55649744 TCTAGAAAATAGTCTCAGAAGGG - Intergenic
1009040634 6:58172136-58172158 CCCAACAAACATTCTCATATAGG - Intergenic
1009216491 6:60926668-60926690 CCCAACAAACATTCTCATATAGG - Intergenic
1009600304 6:65789120-65789142 ACTCGCATACAGTCTCAGATTGG + Intergenic
1010007422 6:71010907-71010929 TCCAGGGAACTGTCTCAGCTGGG + Intergenic
1010152699 6:72753398-72753420 TTCTATAAACAGTCTCAGATAGG + Intronic
1011771521 6:90678664-90678686 TCCAGCAAACGTTGTCAGAAAGG + Intergenic
1013291169 6:108719803-108719825 TCCAGCAAACAGTTAGGGATTGG - Intergenic
1014159084 6:118146539-118146561 TCTAGAAAACATTTTCAGATTGG + Intronic
1016605090 6:145911725-145911747 TCCAGCAAAGAATCTCAAGTGGG - Intronic
1017075603 6:150614807-150614829 TCCAGTAAAAACTCTCAGAAGGG - Intronic
1021224472 7:18012169-18012191 TCCAGCAAACTCTATCAGACTGG - Intergenic
1021641155 7:22737217-22737239 TCTAGAAAACAGCCTCAAATGGG + Intergenic
1029581908 7:101441935-101441957 ACCAGGAAACAGGCTCAGAGAGG + Intronic
1029907940 7:104111128-104111150 CCCTGCAACCAGTCTCAGCTGGG - Intergenic
1043068583 8:75609256-75609278 TAGAGCAAAAAGTTTCAGATTGG + Intergenic
1045835804 8:106520169-106520191 TAAAGCAAACAGTCTCATACTGG - Intronic
1046322003 8:112591233-112591255 TTCAGCAAAGAGTTTCATATTGG - Intronic
1048256436 8:132908445-132908467 TCCAGCAAACACTTGAAGATGGG - Intronic
1050883849 9:10739180-10739202 TCATGCAAAAAGTCTCACATTGG + Intergenic
1051194125 9:14544781-14544803 AACAACAAATAGTCTCAGATTGG - Intergenic
1051450073 9:17186927-17186949 TCCATCCAAAAGTCTCATATAGG - Intronic
1053407262 9:37887820-37887842 ACTCGCATACAGTCTCAGATTGG - Exonic
1059213044 9:112532527-112532549 TCCAGGAAACAGTCAAAGAAAGG - Intronic
1187613038 X:20962757-20962779 TCTAGCAAATAGTCTCAAAAGGG + Intergenic
1190448245 X:50552654-50552676 TCCATTAAACAGTCCCATATAGG - Intergenic
1190519013 X:51257780-51257802 TCAAGGAAACAGACCCAGATAGG - Intergenic
1191774972 X:64803690-64803712 TCCAGAAAACAGCCTCAAAAGGG + Intergenic
1194550548 X:95292678-95292700 TCCAGAAAATAGCCTCAAATGGG + Intergenic
1195765888 X:108296520-108296542 TCCAGAAAACAGTTTCCAATGGG - Intronic
1196174652 X:112627590-112627612 TTCAGAAAATAATCTCAGATGGG - Intergenic
1196624066 X:117857768-117857790 GCCAGCAATAAGTCTCAAATAGG - Intergenic
1199801322 X:151253606-151253628 TCCAGCAAACTGCAGCAGATGGG + Intergenic
1202368755 Y:24183574-24183596 TCCAGCACACAGTCCCAGCAGGG - Intergenic
1202502030 Y:25486543-25486565 TCCAGCACACAGTCCCAGCAGGG + Intergenic
1202602641 Y:26610041-26610063 TCCAGAAAAAAGTCACAGCTGGG - Intergenic