ID: 1084377943

View in Genome Browser
Species Human (GRCh38)
Location 11:68791275-68791297
Sequence CAGTGTCCCCAAAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084377943_1084377954 19 Left 1084377943 11:68791275-68791297 CCCACTTCCCTTTGGGGACACTG 0: 1
1: 0
2: 3
3: 19
4: 197
Right 1084377954 11:68791317-68791339 GGGCAACTGCCCCTCCAATCAGG 0: 1
1: 0
2: 0
3: 4
4: 105
1084377943_1084377955 20 Left 1084377943 11:68791275-68791297 CCCACTTCCCTTTGGGGACACTG 0: 1
1: 0
2: 3
3: 19
4: 197
Right 1084377955 11:68791318-68791340 GGCAACTGCCCCTCCAATCAGGG 0: 1
1: 0
2: 1
3: 8
4: 100
1084377943_1084377949 -2 Left 1084377943 11:68791275-68791297 CCCACTTCCCTTTGGGGACACTG 0: 1
1: 0
2: 3
3: 19
4: 197
Right 1084377949 11:68791296-68791318 TGCCTGCCCTGGTCAGTGAAGGG 0: 1
1: 0
2: 4
3: 43
4: 406
1084377943_1084377948 -3 Left 1084377943 11:68791275-68791297 CCCACTTCCCTTTGGGGACACTG 0: 1
1: 0
2: 3
3: 19
4: 197
Right 1084377948 11:68791295-68791317 CTGCCTGCCCTGGTCAGTGAAGG 0: 1
1: 1
2: 27
3: 179
4: 744
1084377943_1084377950 -1 Left 1084377943 11:68791275-68791297 CCCACTTCCCTTTGGGGACACTG 0: 1
1: 0
2: 3
3: 19
4: 197
Right 1084377950 11:68791297-68791319 GCCTGCCCTGGTCAGTGAAGGGG 0: 1
1: 0
2: 2
3: 18
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084377943 Original CRISPR CAGTGTCCCCAAAGGGAAGT GGG (reversed) Intronic
900491298 1:2950430-2950452 CAGTTTCCCCAAATGCAGGTGGG + Intergenic
901905639 1:12407162-12407184 CATTGTCCCAAGAGGGAAATAGG + Intronic
902049298 1:13549273-13549295 CAGTGTCCTCACAGGGTAGAGGG + Intergenic
903008955 1:20317220-20317242 CAGTGTCCCCACATGGAAAGTGG + Intronic
903654979 1:24943489-24943511 CAGTTTCCCCAACTGTAAGTGGG - Intronic
905467162 1:38163886-38163908 CAATGTCCCCAAAGGGCAGATGG + Intergenic
905503685 1:38459520-38459542 CAGTGGCCACCAAAGGAAGTTGG - Intergenic
905514999 1:38556146-38556168 CAGATTCCTCAGAGGGAAGTCGG + Intergenic
905713012 1:40123361-40123383 CAGTGTGCCCAAAGAGGATTAGG + Intergenic
908901001 1:68956400-68956422 CAATGTCCCCTAAGGAAATTAGG + Intergenic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
912379090 1:109237212-109237234 CAGGGTCCCAGAGGGGAAGTCGG - Intronic
913234423 1:116767645-116767667 CAGTGGCTCCAGAGGGAGGTAGG - Intronic
917651125 1:177078286-177078308 CAGTGACCCCACAGGGATGAAGG - Intronic
918108049 1:181430002-181430024 CTGTGTCCCAAAAGGGAGATAGG - Intronic
920183337 1:204146088-204146110 CAGGGTCCCCAAAGGCACATGGG + Intronic
922029143 1:221781291-221781313 CAGTTTCCCCAAAGTGAACTGGG - Intergenic
922384177 1:225065001-225065023 CAGTTTCCTCAAAGGTAAATTGG + Intronic
923219477 1:231880231-231880253 CAGTGTCCCCAACAGCAAGAAGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1064793236 10:18982925-18982947 TTATGTCCCCAAAGGGAACTTGG - Intergenic
1067234277 10:44435276-44435298 CAGTGTCCCCAAAGCATAGATGG + Intergenic
1067297429 10:44982743-44982765 CAGTGTCCCATAAGGGAACAGGG - Intronic
1068037658 10:51781379-51781401 CTGTTTCCCCAAAGGCAAGAGGG + Intronic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069847074 10:71379818-71379840 CAGTGTCCACAAAGTGCACTCGG - Intergenic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1070510555 10:77156956-77156978 CAGTCTCCCCAAAGGCTAGGAGG - Intronic
1071180549 10:82978747-82978769 CAGTGTCTCCAAAGGTAAAATGG + Intronic
1072624280 10:97101063-97101085 CAGTGTCCCCAAGGGGACTGTGG + Intronic
1075912366 10:126135653-126135675 CAGTGACCCTAAAGGGGAGGAGG + Exonic
1076276109 10:129200111-129200133 CAGTGTTCTCCCAGGGAAGTGGG - Intergenic
1076521668 10:131085111-131085133 CTGTGTCCCCACAGGGCAGAGGG - Intergenic
1081941991 11:46951046-46951068 CAGTTTCCTCAAAGAAAAGTGGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084529556 11:69718894-69718916 CAGTGTCCCCGAGGTGAACTTGG + Intergenic
1084589780 11:70084028-70084050 CAGTGTCTGCAAAGGCAAGGAGG + Intronic
1090199896 11:124846449-124846471 CGGGGTCCCTAAAGGGAACTAGG - Intergenic
1090788168 11:130068730-130068752 CAGTTTACCCACAGGGAACTGGG + Intergenic
1091283172 11:134393866-134393888 CAGTGCCCCCAAAGAGAGGGAGG + Intronic
1094032778 12:26032272-26032294 CATTTTCCCCGAAAGGAAGTGGG + Intronic
1096239630 12:49952826-49952848 CAGTGTCCTCAAAGGACACTTGG - Intronic
1096621611 12:52869102-52869124 CAGTGACAGCACAGGGAAGTAGG - Intergenic
1097032946 12:56102670-56102692 CATTTTACACAAAGGGAAGTCGG + Exonic
1097218914 12:57435354-57435376 GAGTGACCCCAGAGGGATGTGGG - Intronic
1098627608 12:72691780-72691802 TGCTGGCCCCAAAGGGAAGTGGG + Intergenic
1101494564 12:105241443-105241465 CACTGTACCCAAAGAGAAGAAGG + Intronic
1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG + Intronic
1102306320 12:111807379-111807401 AAGTGTACCCACTGGGAAGTGGG - Intronic
1102576488 12:113859179-113859201 TAGTTACCCCACAGGGAAGTGGG - Intronic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1103133232 12:118486488-118486510 CCGTGTCCCCAAAGGCAAGTTGG + Intergenic
1103719324 12:122965103-122965125 CAGGGTCCTCCCAGGGAAGTGGG - Intronic
1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG + Intronic
1107239794 13:38218740-38218762 CTGTGTCCTCACAGGGCAGTAGG + Intergenic
1108764362 13:53608584-53608606 CAGGGTTCCTAAAGGGAAATGGG - Intergenic
1109797231 13:67331683-67331705 AAGTGGCTCCAAAGGGAAGGGGG - Intergenic
1112103726 13:96218177-96218199 CTGTGTCCCCAGAGAGAAGTGGG + Intronic
1115264573 14:31487759-31487781 CAGTGTTCCCAAGTGGAGGTGGG - Intronic
1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG + Intergenic
1122133768 14:99620820-99620842 GGGTGTCCCCAGAGGGAAATGGG - Intergenic
1126117911 15:45225739-45225761 CTGTGTCCTCAAAGGGCAGAGGG + Intergenic
1126127460 15:45308764-45308786 CAGTGCCCCTAAAGAGAAATAGG + Intergenic
1127295323 15:57604156-57604178 CAGTGTTCCCCAATGGAAGTAGG + Intronic
1127361450 15:58248104-58248126 AAGTTTTCCCAAAGGGCAGTGGG - Intronic
1130894405 15:88159071-88159093 CAGGGTCCCCAAAGGCTGGTGGG + Intronic
1135087757 16:19488494-19488516 CAGTGGAGCCAAAGGGAAGTGGG - Intronic
1136487941 16:30585330-30585352 CGGTGTCCCCAGAGGCTAGTGGG - Intronic
1138385613 16:56633797-56633819 CTGTGTCTGCAAAGGGACGTTGG + Exonic
1139596395 16:67960782-67960804 CAGTCACCCCAAAGAGAAGAGGG + Intronic
1142887546 17:2922192-2922214 CAGTGTCCTCACAGGGAGGAAGG + Intronic
1143048886 17:4105913-4105935 CAGTGTTCCCACAGAGAAGCTGG + Intronic
1143204107 17:5131141-5131163 CACTGTCCCCATGGGGAAGGGGG + Intronic
1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG + Intronic
1143932861 17:10448828-10448850 CAGTTTCCCCCAAGGGGAGCTGG + Intronic
1144372485 17:14605427-14605449 CTGAGTCCCCAAAGAGAAGTGGG - Intergenic
1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1145156936 17:20550171-20550193 CACTGTCCCCATGGGGAAGGGGG - Intergenic
1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1145799100 17:27672043-27672065 CACTGTCCCCATGGGGAAGGGGG - Intergenic
1145993535 17:29093092-29093114 CAGTGTCCCCATAAGGATGCTGG + Intronic
1146077395 17:29744092-29744114 CAGGGACGCCAAAGGGCAGTGGG + Intronic
1146159914 17:30554232-30554254 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1149531190 17:57396770-57396792 CTGTGTGCACAAAGGGCAGTGGG - Intronic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1152064352 17:78102258-78102280 CAGAGTCACCACGGGGAAGTGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155620429 18:27772094-27772116 CTGTGGCCCCAAAGGGATGGTGG + Intergenic
1157049336 18:44142753-44142775 CAGTCTCCACAAAGGAATGTAGG + Intergenic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1157828878 18:50838344-50838366 CATTGAGCCCAAAGGAAAGTAGG - Intergenic
1158041061 18:53094275-53094297 CAGTGTCCCAACTGGGAAGAAGG + Intronic
1158149787 18:54355530-54355552 CAGTGTCCTCACATGGAAGAAGG - Intronic
1158565289 18:58549856-58549878 CTGTGTCCTGAAAGGGAAGCAGG + Intronic
1160389036 18:78516517-78516539 CAGATTCCCAAAAGAGAAGTGGG + Intergenic
1161374814 19:3933858-3933880 CGGTGTCCCCAGTGGGAAGGGGG + Intronic
1161625114 19:5322016-5322038 CAGTTTACCCAAATGGAAATGGG - Intronic
1162846754 19:13398690-13398712 CAGTTTCCTCATAGGGAGGTTGG + Intronic
1163069353 19:14825528-14825550 GAGTGTCCCTCAAGGGAACTTGG + Intronic
1163721730 19:18901096-18901118 AGGTGGCTCCAAAGGGAAGTGGG + Intronic
1163832712 19:19554657-19554679 GGGTGTCCCCAAAGGCAAGAAGG + Intergenic
1165429450 19:35764185-35764207 CAGTGACTCCAGTGGGAAGTGGG + Intronic
1168456331 19:56511716-56511738 CAGTGGCCCCTGAGAGAAGTGGG - Intronic
925838263 2:7966411-7966433 AATTGTCCCAAAAGGGAAGGAGG + Intergenic
927336763 2:21933525-21933547 CAGGGTCACCACAGGTAAGTAGG + Intergenic
936587090 2:113767684-113767706 CAGTATCCCCACAGGGATTTGGG + Intergenic
937144234 2:119628375-119628397 CATTGTGCCCGAAGGGAAGAAGG - Intronic
939399504 2:141672364-141672386 GAGTGTTCACAAAGGGAAGAAGG + Intronic
939418153 2:141928075-141928097 CATTCTCCCCAAAGTGTAGTGGG + Intronic
939883334 2:147654757-147654779 CAATGATCCCAAAGGGGAGTGGG + Intergenic
941473570 2:165920899-165920921 CAGTTTCACTCAAGGGAAGTTGG - Intronic
943629222 2:190232359-190232381 CAGACTGCCAAAAGGGAAGTAGG - Intronic
944031353 2:195238497-195238519 AAGTGTGCCAAAAGGGAATTGGG + Intergenic
946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG + Intergenic
948640209 2:239370959-239370981 CAGTGGCTCCAAAGGGCAGAGGG - Intronic
948921970 2:241070059-241070081 CTATGTCCCCAACGGGAAGCTGG + Exonic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1172636800 20:36415602-36415624 CAGTGTCCTCAAAGGGTTGTTGG - Intronic
1173575575 20:44111188-44111210 CAGGGACCCCAAAGGGATGGAGG - Intergenic
1174399974 20:50270699-50270721 CGGAATCCCCAAGGGGAAGTTGG - Intergenic
1175591311 20:60194084-60194106 CAATTTCCCCAAAGGGAGATGGG + Intergenic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1180874835 22:19170309-19170331 CAGGGACCCCAAAGGGAAGATGG - Intergenic
1182115003 22:27751324-27751346 CAGTTTCCCCACTGGGAAATAGG + Intronic
949278334 3:2315373-2315395 CAGTTTCCCAAACGAGAAGTGGG + Intronic
950542419 3:13620385-13620407 AAGTGTCCCCGATGGGGAGTGGG + Intronic
954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG + Intergenic
954948572 3:54448480-54448502 CAGTTCCCCCAAACGAAAGTAGG + Intronic
955319402 3:57963686-57963708 AACTGTCCCCAAAGAGAACTAGG + Intergenic
956564742 3:70623828-70623850 TAATTTCCCCAAAAGGAAGTTGG - Intergenic
965458155 3:168929775-168929797 CTGTGGCCCCTACGGGAAGTGGG + Intergenic
968962486 4:3752671-3752693 AAGGGACCCCATAGGGAAGTCGG + Intergenic
970243704 4:14036056-14036078 CAGTGTCCAGAAAGAGAAGGTGG - Intergenic
970551205 4:17182914-17182936 CAGTGTCCCCGAAGGCATGTTGG - Intergenic
971606250 4:28661618-28661640 CTGTATCCCCAGAGGGGAGTAGG - Intergenic
972342646 4:38165850-38165872 CAGTGTGCCCAAAGAGATGCTGG - Intergenic
972876331 4:43365588-43365610 CACTGTCCCCAAGAGGAAGAAGG - Intergenic
977761117 4:100738493-100738515 CACTCTCCCCAAAGGCAGGTTGG - Intronic
978171844 4:105681042-105681064 CTTTGACCCCAAAGGGAAATTGG + Intronic
982359359 4:154502947-154502969 TAGTGGCCCTAAAGGGAAATAGG + Intergenic
982380076 4:154740636-154740658 CAGTGTCCCCGCAGGGTGGTCGG - Intronic
982761543 4:159290146-159290168 CAGTGGCACCACAGTGAAGTGGG + Intronic
983952139 4:173654688-173654710 CACTGTCCACAAAGGAGAGTCGG - Intergenic
984988354 4:185352909-185352931 CAGTCTCCCCAGAAGGCAGTGGG + Intronic
986285853 5:6358536-6358558 CTGTGTCCCCATAGGAAAGCAGG + Intergenic
991093103 5:62711782-62711804 CAGAGTGTCCACAGGGAAGTGGG + Intergenic
992186625 5:74250558-74250580 TAGTGTCCCACTAGGGAAGTTGG - Intergenic
994219229 5:97175515-97175537 CATTTTCCCAAAAGGGTAGTAGG - Intronic
996492086 5:124110031-124110053 AAGTCTCCCCAAAAGGATGTGGG + Intergenic
996769469 5:127071039-127071061 TAGTGTCCCTGAAGGGAGGTTGG - Intronic
996919378 5:128749786-128749808 CAGTGTCCCAAAGGGGGACTCGG + Intronic
997345592 5:133189723-133189745 CAGTGGCCTCACAGGGAAATGGG - Intergenic
999100758 5:149024026-149024048 CAGTGTTCTCAAAGGGCTGTTGG + Intronic
1001447246 5:171794999-171795021 CAGAGTCCCCACAGGTGAGTGGG + Intergenic
1003498915 6:6687811-6687833 CAGGGACCCCAAAAGGAAGGAGG - Intergenic
1005963834 6:30712456-30712478 CACTGTCCCCAAAAGGAGGTTGG + Exonic
1006399204 6:33806586-33806608 CAGTTTCCCCACATGTAAGTTGG - Intergenic
1006604153 6:35244192-35244214 CAGTGTCCCCTCTGGGAAATTGG - Intronic
1006778932 6:36618683-36618705 CAGTCTCCCCAGCTGGAAGTAGG + Intergenic
1007436797 6:41818986-41819008 GAGTCTCCCTAAAGGAAAGTGGG + Intronic
1008405988 6:51119177-51119199 CAATGGAACCAAAGGGAAGTAGG - Intergenic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1010863055 6:80937519-80937541 CTGTGTCACCCCAGGGAAGTGGG + Intergenic
1011757098 6:90510845-90510867 CATTGCCGCCAAAGGGAAGAGGG - Intergenic
1012624740 6:101392508-101392530 CAGTTTCCCCCAGAGGAAGTTGG - Intergenic
1013470034 6:110455841-110455863 CAGTGTCCTCACATGGAAGAAGG - Intronic
1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG + Intergenic
1016074272 6:139777562-139777584 CAGTATCACCAGAGGGAATTGGG + Intergenic
1016510013 6:144831790-144831812 CAGTGTCACCCAAGGGCAGATGG - Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018635925 6:165859439-165859461 AAGTGGCCCCCAAGGGAAGGAGG - Intronic
1021488651 7:21194216-21194238 CAATGTCCCCAAAGCTTAGTTGG - Intergenic
1021708656 7:23393525-23393547 CCGTGCCCCCAAAGGGAAACAGG + Intronic
1023529905 7:41141859-41141881 CAGTGTCCCAAAAGAGAATATGG - Intergenic
1027595384 7:80167364-80167386 CAGTGTCACAAAAGTGAAGATGG + Intronic
1028708842 7:93883721-93883743 TAGTAACCCCAAAGGGAAGCTGG - Intronic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1031228233 7:119069709-119069731 CAGTGTGCCCAGAGAGAATTTGG - Intergenic
1033778589 7:144642822-144642844 CAGTGTCCCCATCTGTAAGTTGG + Intronic
1034501852 7:151455826-151455848 CAGTGTACCCCACGGCAAGTGGG + Intergenic
1035181210 7:157090748-157090770 CCGTGTCCCCAAAACGCAGTTGG - Intergenic
1035696827 8:1604110-1604132 CAGTGTCCACAAAATGAAGAAGG - Intronic
1039635799 8:39163330-39163352 CAGGGCCCACAAAGGGAAGGAGG + Intronic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1045290395 8:100827841-100827863 CAGTGTCCCAAAGAGGAAGCTGG + Intergenic
1046520920 8:115324593-115324615 CAGTGTCACTAAAGGCAAATTGG + Intergenic
1046734268 8:117759693-117759715 CAGTGCCCCCAAATGGTAGTAGG + Intergenic
1048080537 8:131121837-131121859 AAGTTTCCCCAGAGGAAAGTGGG - Intergenic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1049303505 8:141884405-141884427 CAGTGCCTCCCAGGGGAAGTGGG - Intergenic
1049472415 8:142782422-142782444 TAGTTTCCCCATACGGAAGTGGG + Intergenic
1051891024 9:21943139-21943161 CAGTGTTCTCAAAGGAGAGTTGG + Intronic
1052235869 9:26213188-26213210 TAGTGTCTCCAAAAGTAAGTGGG - Intergenic
1053283927 9:36838577-36838599 CAGTTTCCCACAAGGGAAGTTGG + Exonic
1055826041 9:80325982-80326004 CTGTGTTACCAATGGGAAGTGGG - Intergenic
1059535147 9:115073738-115073760 CAGTCTCCCCACAGGCCAGTGGG - Exonic
1060151725 9:121293121-121293143 CATTGTCCCCATCGGGAAGGTGG + Intronic
1060965074 9:127707635-127707657 CAGTTTCCCCAAATATAAGTGGG + Intronic
1061231793 9:129319763-129319785 CAGTGTCCCCATTGGGAAGGTGG - Intergenic
1061586795 9:131574884-131574906 CAGTTTCCCCAGCTGGAAGTGGG - Intergenic
1062269716 9:135702846-135702868 AAGAGTCCCCAGTGGGAAGTGGG + Intronic
1062608916 9:137364098-137364120 CAGTGATGCCTAAGGGAAGTAGG - Intronic
1185848190 X:3459807-3459829 CAGTGACTCCAACGGCAAGTAGG + Intergenic
1186233382 X:7480223-7480245 CTGTGGCAGCAAAGGGAAGTTGG + Intergenic
1188870912 X:35370645-35370667 CAGTGTCCCCACAGGGATTAAGG - Intergenic
1191130520 X:57003563-57003585 CAGAGGCTACAAAGGGAAGTGGG - Intergenic
1194062669 X:89223660-89223682 AAATGTCTCAAAAGGGAAGTAGG + Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1195405986 X:104513912-104513934 CAGTGACCCAAAAGGGAAATAGG - Intergenic
1196733471 X:118963869-118963891 CAGTGACCCCCATGGGATGTGGG - Intergenic
1196818736 X:119686171-119686193 CAGGCTCCCCAGAGGGCAGTTGG - Intronic
1198186647 X:134259778-134259800 TAGTGCCCTGAAAGGGAAGTGGG + Intergenic
1199603967 X:149561754-149561776 CAGGGTCCCCAAAATGAAATGGG - Intergenic
1199646422 X:149917720-149917742 CAGGGTCCCCAAAATGAAATGGG + Intergenic
1199739027 X:150715150-150715172 CAGGGTCACCAAAGGAGAGTGGG - Intronic
1199972645 X:152872295-152872317 CAGTGTCCCCACAGCATAGTGGG + Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1200683145 Y:6236326-6236348 AAGTGTGGCCAAATGGAAGTGGG - Intergenic
1201049487 Y:9918060-9918082 AAGTGTGGCCAAATGGAAGTGGG + Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic