ID: 1084377948

View in Genome Browser
Species Human (GRCh38)
Location 11:68791295-68791317
Sequence CTGCCTGCCCTGGTCAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 952
Summary {0: 1, 1: 1, 2: 27, 3: 179, 4: 744}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084377945_1084377948 -10 Left 1084377945 11:68791282-68791304 CCCTTTGGGGACACTGCCTGCCC 0: 1
1: 0
2: 2
3: 23
4: 601
Right 1084377948 11:68791295-68791317 CTGCCTGCCCTGGTCAGTGAAGG 0: 1
1: 1
2: 27
3: 179
4: 744
1084377937_1084377948 11 Left 1084377937 11:68791261-68791283 CCAGGACACCCTGACCCACTTCC 0: 1
1: 0
2: 1
3: 35
4: 296
Right 1084377948 11:68791295-68791317 CTGCCTGCCCTGGTCAGTGAAGG 0: 1
1: 1
2: 27
3: 179
4: 744
1084377934_1084377948 16 Left 1084377934 11:68791256-68791278 CCTCCCCAGGACACCCTGACCCA 0: 1
1: 0
2: 3
3: 53
4: 478
Right 1084377948 11:68791295-68791317 CTGCCTGCCCTGGTCAGTGAAGG 0: 1
1: 1
2: 27
3: 179
4: 744
1084377936_1084377948 12 Left 1084377936 11:68791260-68791282 CCCAGGACACCCTGACCCACTTC 0: 1
1: 0
2: 2
3: 28
4: 232
Right 1084377948 11:68791295-68791317 CTGCCTGCCCTGGTCAGTGAAGG 0: 1
1: 1
2: 27
3: 179
4: 744
1084377944_1084377948 -4 Left 1084377944 11:68791276-68791298 CCACTTCCCTTTGGGGACACTGC 0: 1
1: 0
2: 1
3: 19
4: 250
Right 1084377948 11:68791295-68791317 CTGCCTGCCCTGGTCAGTGAAGG 0: 1
1: 1
2: 27
3: 179
4: 744
1084377935_1084377948 13 Left 1084377935 11:68791259-68791281 CCCCAGGACACCCTGACCCACTT 0: 1
1: 0
2: 3
3: 20
4: 223
Right 1084377948 11:68791295-68791317 CTGCCTGCCCTGGTCAGTGAAGG 0: 1
1: 1
2: 27
3: 179
4: 744
1084377943_1084377948 -3 Left 1084377943 11:68791275-68791297 CCCACTTCCCTTTGGGGACACTG 0: 1
1: 0
2: 3
3: 19
4: 197
Right 1084377948 11:68791295-68791317 CTGCCTGCCCTGGTCAGTGAAGG 0: 1
1: 1
2: 27
3: 179
4: 744
1084377940_1084377948 3 Left 1084377940 11:68791269-68791291 CCCTGACCCACTTCCCTTTGGGG 0: 1
1: 0
2: 2
3: 29
4: 195
Right 1084377948 11:68791295-68791317 CTGCCTGCCCTGGTCAGTGAAGG 0: 1
1: 1
2: 27
3: 179
4: 744
1084377942_1084377948 2 Left 1084377942 11:68791270-68791292 CCTGACCCACTTCCCTTTGGGGA 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1084377948 11:68791295-68791317 CTGCCTGCCCTGGTCAGTGAAGG 0: 1
1: 1
2: 27
3: 179
4: 744

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084377948 Original CRISPR CTGCCTGCCCTGGTCAGTGA AGG Intronic
900134083 1:1106881-1106903 CCCCCGGCCCTGGGCAGTGAGGG + Intronic
900189189 1:1346141-1346163 CTGCCTGGCCTGGGCTGTGGGGG - Intronic
900463664 1:2813378-2813400 CTGCCAGCCCCGGGCAGTGAGGG + Intergenic
900476354 1:2878178-2878200 CAGCCTGCCCTGCCCAGAGAAGG - Intergenic
900899212 1:5505444-5505466 CTGCCTGCCCATGTTAGTCAGGG - Intergenic
901045981 1:6395983-6396005 CCGCCGGCCCCGGGCAGTGAGGG - Intergenic
901601482 1:10426612-10426634 CTGCCCGCCCAGGGCAATGAGGG - Intergenic
901783337 1:11608865-11608887 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
901843197 1:11966384-11966406 CTGCTTGCCCTGGGGAGTGGGGG + Intronic
902148158 1:14420755-14420777 CCGCCGGCCCCGGGCAGTGAGGG - Intergenic
902399138 1:16148367-16148389 ATGCCTGCCAGGGTGAGTGACGG - Exonic
902500563 1:16908304-16908326 CTGCCTGCCAGAGACAGTGAGGG - Intronic
902557987 1:17258296-17258318 CTGGCTGCCCTGGACAATGTTGG + Intronic
902737786 1:18412680-18412702 CTTCCTTCCCTGGACAGTGATGG + Intergenic
902963965 1:19984704-19984726 CTGCCGGCCCCAGGCAGTGAGGG - Intergenic
903180321 1:21601952-21601974 CTGGCTAGCCTGGCCAGTGATGG + Intronic
903830592 1:26171817-26171839 CTGCCTGCCCAGGTCTGGCAGGG + Exonic
903976537 1:27154083-27154105 CTTCATGCCATGATCAGTGACGG + Exonic
904850271 1:33454118-33454140 CTGCCTGGCCTAGACAGTGCAGG + Intergenic
904937595 1:34142485-34142507 CTGCCTGCCTTGAACAGAGATGG - Intronic
905305156 1:37012833-37012855 CTGCCTACCCTGCTCACTGTTGG + Intronic
905742886 1:40387960-40387982 CTGCTGGCCCTGGGCAATGAGGG + Intronic
906248220 1:44291999-44292021 CTCCATGCCCTGCTCTGTGAGGG + Intronic
906876133 1:49541441-49541463 CTGCCAGCCCCGGGCAGTGAGGG + Intronic
907123895 1:52032684-52032706 CTACCTCCTCTGGTCAGTGCAGG + Exonic
907889488 1:58623538-58623560 CTGCCGGCCCAGGGCAATGAGGG + Intergenic
908027760 1:59969917-59969939 CTGCCCGCCCCGGGCAGTGAGGG - Intergenic
908299917 1:62753539-62753561 CTGCTGGCCCCGGGCAGTGAAGG + Intergenic
908617606 1:65939769-65939791 CTGTCTGAGCTAGTCAGTGAGGG + Intronic
909318551 1:74253594-74253616 CTGCCGGCTCCGGGCAGTGAGGG - Intronic
909782293 1:79561778-79561800 CTGCTGGCCCTGGGCAGTGAGGG - Intergenic
909904572 1:81178860-81178882 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
910227542 1:84951347-84951369 CTGCCTTCCCTGTTCATTAAGGG - Intronic
911205915 1:95091474-95091496 CTGCCGGCCCCGGGCAATGAAGG + Intergenic
912315922 1:108667583-108667605 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
912475243 1:109930499-109930521 CTTCCTGCCCAGGAAAGTGAGGG + Exonic
912538762 1:110396586-110396608 CTGCCGGCCCCGGGCAGTGAGGG - Intergenic
912819382 1:112854766-112854788 CTGCCGGCCCCGGGCAATGACGG - Intergenic
913266375 1:117049089-117049111 CTGCCTCCCCTGGTGTCTGAAGG - Intergenic
913470191 1:119179175-119179197 CCGCCTGCCCCGGGCAGTGAGGG + Intergenic
915104122 1:153521894-153521916 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
915260046 1:154670858-154670880 CTGCCAGCCCCGGGCAATGAGGG + Intergenic
915261216 1:154678145-154678167 CTGCCAGCCCCGGGCAATGAGGG + Intergenic
915865562 1:159494861-159494883 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
916606048 1:166343286-166343308 CTGCAAGCCCCGGGCAGTGAGGG - Intergenic
916839840 1:168588266-168588288 CTGACTGGGTTGGTCAGTGAAGG + Intergenic
916910117 1:169337330-169337352 CTGCTGGCCCTGGGCAATGAGGG - Intronic
916939032 1:169661324-169661346 CCACCAGCCCTGGGCAGTGAGGG + Intergenic
916940069 1:169668162-169668184 CCACCGGCCCTGGGCAGTGAGGG + Intronic
917348869 1:174056625-174056647 CCGCCGGCCCTGGGCAGTGAGGG - Intergenic
917406227 1:174711090-174711112 CTGCCGGCCCCAGACAGTGAGGG - Intronic
917445414 1:175102553-175102575 CTGCTGGCCCCGGGCAGTGAGGG - Intronic
917446369 1:175108710-175108732 CTGCTGGCCCCGGGCAGTGAGGG - Intronic
917500847 1:175583589-175583611 CTGCATGGACTGGTCAGTGGAGG + Intronic
917578555 1:176349523-176349545 CTGCCGGCCCCAGGCAGTGAGGG - Intergenic
918472210 1:184885970-184885992 GTGCCTGCCCTGTTCTGTGCTGG + Intronic
918512012 1:185321926-185321948 CTGCCGGCCCTGGGCAGTGAGGG - Intergenic
918542709 1:185649180-185649202 CCACCGGCCCTGGGCAGTGAGGG - Intergenic
918659767 1:187074069-187074091 CTGCTGGCCCCGGGCAGTGAGGG - Intergenic
918708934 1:187703727-187703749 CTGCCAGCCCCGGGCAATGAGGG + Intergenic
918853220 1:189718551-189718573 CTGCCGGCCCCGGGCAGTGAGGG - Intergenic
919091895 1:192987018-192987040 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
919237034 1:194859181-194859203 CCGCCGGCCCTGGGCAATGAGGG + Intergenic
919924415 1:202185062-202185084 CTTCTTGCCCTGGGCAGAGAAGG + Intergenic
919971197 1:202580398-202580420 TGGCCTGGCCTGGTCAGGGAGGG + Intronic
919974596 1:202602493-202602515 CTGCCTGCCCTGGACATGGGAGG - Exonic
920347258 1:205314265-205314287 CTCCCTGCCCTGCTCAGGGAGGG - Intronic
920604875 1:207371650-207371672 CTGCCAGCCCCGGGCAGTGAGGG - Intergenic
921396392 1:214673399-214673421 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
921897092 1:220412539-220412561 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
921903846 1:220475922-220475944 CTGCCGGCCCCGGGCAGTGAGGG - Intergenic
921983681 1:221285911-221285933 CTGCCGGCCCGGGGCAATGAGGG - Intergenic
922423202 1:225472814-225472836 CTGCCGGCCCCGGGCAATGAAGG + Intergenic
922470707 1:225875445-225875467 CTGCCTGCTCTGATCAGAAACGG + Intronic
922541920 1:226426545-226426567 CTGCCAGCCCCGGGCAATGAGGG - Intergenic
922731088 1:227949029-227949051 CTGCAGACCCTGGTCAGTGCAGG + Intergenic
923157240 1:231289728-231289750 CTGCCAGCCCCGGGCAATGAGGG - Intergenic
923193453 1:231642158-231642180 CCGCCGGCCCCGGGCAGTGAAGG - Intronic
923218894 1:231875279-231875301 CCCCCAGCCCTGGTGAGTGAAGG + Intronic
923218910 1:231875339-231875361 CCCCCGGCCCTGGTGAGTGAAGG + Intronic
923573808 1:235140401-235140423 CTGCCGGCCCCGGGCAGTGAGGG + Intronic
923810529 1:237309879-237309901 CTGCCGGCCCCGGGCAGTGAGGG - Intronic
924034803 1:239925022-239925044 CTGCTGGCCTTGGACAGTGAGGG - Intergenic
924258472 1:242205766-242205788 CTGCCATCCCTGCTCAGTGCTGG - Intronic
924732487 1:246724536-246724558 CCGCCTGCCCTGGGCCGTGGCGG + Exonic
1062826502 10:572823-572845 CTGGCTGCCCTGGTCTTTGAGGG - Intronic
1063148960 10:3320073-3320095 CTGCCTGCCCAGGGCAGTGAGGG - Intergenic
1063300399 10:4845168-4845190 CTGCTGGCCCTGGGCAATGAGGG - Intronic
1063318739 10:5032771-5032793 CTGCCGGCCCCGGGCAATGAGGG - Intronic
1063321050 10:5053354-5053376 CTGCAAGCCCAGGGCAGTGAGGG - Intronic
1063769687 10:9183457-9183479 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1063848698 10:10161004-10161026 CCACCAGCCCTGGGCAGTGAGGG + Intergenic
1065743286 10:28815926-28815948 CTAACGGCCCTGGGCAGTGAGGG - Intergenic
1065965852 10:30769672-30769694 CTGCCAACCCCGGGCAGTGAGGG - Intergenic
1065983872 10:30930327-30930349 GTGTCGGCCCTGGGCAGTGAGGG - Intronic
1066235473 10:33480721-33480743 CTGCCGACCCTGGGCAATGAGGG - Intergenic
1066613614 10:37275577-37275599 CTGCCGGCCCTGGGCAGTGAGGG - Intronic
1066762521 10:38769179-38769201 TGGGCTGCCATGGTCAGTGACGG + Intergenic
1066959060 10:42203284-42203306 TGGGCTGCCGTGGTCAGTGACGG - Intergenic
1067089938 10:43261400-43261422 CTGCCTGCAATGGACAGTGTGGG + Intronic
1067251048 10:44587453-44587475 CAGCCTGGTCTGGTCAGGGAGGG - Intergenic
1067435394 10:46273084-46273106 CCTCCTGCCCTGGCCAGTGAAGG - Intergenic
1067521955 10:47014277-47014299 CTGCCTGCCCTGACCCGGGACGG - Intergenic
1068216664 10:53990919-53990941 CCACCGGCCCTGGGCAGTGAGGG + Intronic
1068455529 10:57249946-57249968 CTGCCAGCCCCAGGCAGTGAAGG + Intergenic
1068820975 10:61377124-61377146 CTGCCGGCCCTGGGCAGTGAGGG - Intergenic
1068978131 10:63033696-63033718 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1069060668 10:63891455-63891477 CTGTCTGTCCTGGTCATTCATGG + Intergenic
1069193728 10:65522416-65522438 CAGGCTACCCTGGTCTGTGATGG - Intergenic
1069766135 10:70861751-70861773 CTGCCGGCCCCGGGCAATGAGGG + Intronic
1069777457 10:70935260-70935282 TGGCCTGCCCAGGTCAGTGGGGG - Intergenic
1070172716 10:73944710-73944732 CCACCGGCCCTGGGCAGTGAGGG + Intergenic
1070551674 10:77495295-77495317 CCGCCTGCACTGCTCTGTGATGG + Intronic
1070642550 10:78180127-78180149 CTCCCTGCCCTGCTCACAGAGGG + Intergenic
1070746562 10:78937222-78937244 CTCCCTGTCCTGGGCAGGGAGGG + Intergenic
1070769577 10:79074500-79074522 CTGTGTGCCCTGGGCAGTCAAGG - Intronic
1071055695 10:81505933-81505955 CCGCAAGCCCTGGGCAGTGAGGG + Intergenic
1071307813 10:84314470-84314492 CTGTCTGCCCTGCCCAGTGTGGG + Intergenic
1071387998 10:85141507-85141529 CTGCTGGCCCCGGGCAGTGAGGG + Intergenic
1071568419 10:86683475-86683497 CTGCCTGCTCAGGGAAGTGAGGG + Intronic
1071611018 10:87031233-87031255 CGGCCAGCCCAGGGCAGTGAGGG - Intergenic
1072278490 10:93845299-93845321 CTGCCTGCCCCGGGCAGTGAGGG + Intergenic
1074314581 10:112349840-112349862 CCGCCAGCCCCGGGCAGTGAGGG + Intergenic
1074996351 10:118760400-118760422 CCGCCGGCCCCGGGCAGTGAGGG - Intergenic
1075255614 10:120923932-120923954 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1075376031 10:121978642-121978664 CCGGCTGCCCTGGGCAGTGAGGG - Intergenic
1075742399 10:124703904-124703926 CTCCCAGCCCTGGCCAGGGAAGG - Intronic
1076021390 10:127076759-127076781 CTGTCAGCCCTGGGCAGAGATGG - Intronic
1076139406 10:128067880-128067902 CTGCCTGACCTGGGCATAGACGG + Intronic
1076484399 10:130806669-130806691 ATGGCTGCCATGGTCGGTGAGGG + Intergenic
1076785877 10:132749687-132749709 CTGCCTGCCCGGTTCGGTGGGGG + Intronic
1076917214 10:133430285-133430307 CTGACTGCCCTGGTGGGAGAGGG + Intergenic
1076935593 10:133566229-133566251 CGGCCTCCCCTGGCCGGTGAAGG - Intronic
1076937309 10:133575044-133575066 CTGACTGCCCTGGTGGGAGAGGG + Intergenic
1077025505 11:438186-438208 CTGTCAGCCCACGTCAGTGATGG - Intronic
1077046886 11:550666-550688 CTGCGTGCCCTGCTCAGAGCTGG + Intronic
1077101316 11:823834-823856 CTGCCCGCCCGGCTCAATGAGGG + Exonic
1077186913 11:1239551-1239573 CTGCCTGGCCTGGAAGGTGAGGG + Exonic
1077583794 11:3435197-3435219 CCGCCGTCCCTGGGCAGTGAGGG - Intergenic
1077764587 11:5144522-5144544 CCACCGGCCCTGGGCAGTGAGGG + Intergenic
1077853386 11:6097056-6097078 GTGCCTGCCATGGTGAGTGATGG - Intergenic
1078395145 11:10974506-10974528 CTGCATGCCCTGGCCAGGGTTGG + Intergenic
1078795815 11:14591169-14591191 CTGCCGGCCCTGGGCAGTGAGGG + Intronic
1079190981 11:18276346-18276368 CCACCGGCCCTGGGCAGTGAGGG - Intergenic
1079555420 11:21753351-21753373 CTGCCGGCCCCGGGCAGTGAGGG - Intergenic
1079730578 11:23935002-23935024 CTGCCGGCCCTGGGCAATGAGGG - Intergenic
1079731762 11:23942531-23942553 CTGCCGGCCCTGGGCAATGACGG - Intergenic
1079767785 11:24416253-24416275 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1080195203 11:29600399-29600421 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1080223510 11:29934270-29934292 CCGCCGGCCCTGGGCAGTGAGGG + Intergenic
1080503083 11:32888421-32888443 CCGCCAGCCCTGGGCAGTGAGGG - Intergenic
1081136157 11:39442315-39442337 CCGCTGGCCCTGGGCAGTGAGGG - Intergenic
1081315199 11:41622982-41623004 CTGCAAGCCCCGGGCAGTGAGGG + Intergenic
1081329717 11:41788479-41788501 CTGCCGGCCCTGGGCACTGAGGG - Intergenic
1081428379 11:42949993-42950015 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1082106723 11:48229017-48229039 CTGCAGGCCCAGGGCAGTGAGGG + Intergenic
1082272111 11:50183380-50183402 CTGCCGGCCCTGGGCAATGAGGG + Intergenic
1082808150 11:57462778-57462800 CTCCCTCCCCTGGTCAGTTCTGG + Intronic
1082912335 11:58390824-58390846 CTGCCAGCCCCGGGCAATGAGGG - Intergenic
1082997077 11:59263136-59263158 CTGCCAGCCCTGGCCCATGATGG + Intergenic
1083305345 11:61759175-61759197 CTGCCTGCCCTGGTCCCTGTGGG + Intronic
1083656719 11:64233592-64233614 CAGCCTGCCTAGTTCAGTGATGG + Intronic
1083882582 11:65555794-65555816 CCTCCTGCCCTGGGAAGTGAGGG - Intronic
1083896610 11:65623255-65623277 TTGCCTGCTCTGGACATTGAGGG - Intronic
1084007261 11:66329972-66329994 CTCCCTGCCCTCCCCAGTGATGG - Intergenic
1084043216 11:66554682-66554704 GAGCCCTCCCTGGTCAGTGAAGG + Intronic
1084186648 11:67476199-67476221 CCGCCGGCCCTGGGCAGTGAGGG + Intergenic
1084210453 11:67619144-67619166 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1084240696 11:67817869-67817891 CCGCCGGCCCTGGGCAGTGAGGG - Intergenic
1084377948 11:68791295-68791317 CTGCCTGCCCTGGTCAGTGAAGG + Intronic
1084454133 11:69257693-69257715 CTGCATGCCCTGGGAAGTGTGGG + Intergenic
1085255365 11:75169554-75169576 CTGTCTCCCCTGGTCAGGGATGG - Intronic
1086043028 11:82501266-82501288 CTGCGGGCCCCGGGCAGTGAGGG + Intergenic
1086070398 11:82793014-82793036 CTGATTGCCCTGGTCTGTGCAGG - Intergenic
1086501168 11:87455389-87455411 CTGGCTCACCTGGTCAGTGGTGG + Intergenic
1087407324 11:97745871-97745893 CTGCCGGCCCCGGGCAGTGAGGG - Intergenic
1087682354 11:101231588-101231610 CTGCCAGCCCTGGGCAGTGAGGG - Intergenic
1088570870 11:111222086-111222108 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1089622438 11:119729460-119729482 CTGCCTGCCTTTGTCAGCGGAGG - Intergenic
1089666857 11:120026006-120026028 CTGCCGGCCCGGGGCAGTGAGGG + Intergenic
1090229215 11:125089604-125089626 CTTCCGGCCCCGGGCAGTGAGGG + Intronic
1090307690 11:125704955-125704977 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1090586197 11:128215525-128215547 CCGCCGGCCCTGGGCAATGAGGG - Intergenic
1090713125 11:129405883-129405905 CTGCCTGGAGTGGTCAGGGAAGG - Intronic
1090782721 11:130021780-130021802 CTACCAGCCCTGGGCAGTGAGGG + Intergenic
1091201195 11:133782410-133782432 GTGCCGGCCCTGGGCAATGAGGG + Intergenic
1091402246 12:188327-188349 CCGCCGGCCCGGGGCAGTGAGGG - Intergenic
1091686927 12:2569161-2569183 CTGCTTGGCCTAGACAGTGAGGG - Intronic
1092018464 12:5180015-5180037 TTCCCCGCCCTGGTCAGAGAAGG - Intergenic
1092336671 12:7639947-7639969 CTGCCGGCCCGGGGCAGTGAGGG + Intergenic
1092350527 12:7752326-7752348 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1092471765 12:8787374-8787396 CTGCGGGCCCTGGGCAATGAGGG + Intergenic
1092472955 12:8794831-8794853 CTGCCGGCCCCGGGCAGTGAGGG + Intergenic
1092545860 12:9450642-9450664 CCGCCAGCCCGGGGCAGTGAGGG - Intergenic
1092572429 12:9739829-9739851 CTGCCGGCCCGGGGCAATGAGGG - Intergenic
1093189394 12:16057490-16057512 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1093527095 12:20115482-20115504 CTGCGGGCCCTGGGCAGTGAGGG - Intergenic
1093653949 12:21674305-21674327 GTGCCGGCCCCGGGCAGTGAGGG - Intronic
1093810503 12:23486588-23486610 CTGCCTAGGCTGGTGAGTGAGGG - Intergenic
1093921658 12:24866184-24866206 CTGCCAGCCCCGGGCAGTGAGGG + Intronic
1094338617 12:29386493-29386515 CTGCCGGCCCCGGGCAGTGAGGG - Intergenic
1094405357 12:30110701-30110723 CCGCCTGCCCCGGTCAGTGAGGG - Intergenic
1094409828 12:30156978-30157000 CTGCCAGCCCCGGGCAGTGAGGG + Intergenic
1094507094 12:31071431-31071453 CCGCCAGCCCCGGGCAGTGAGGG + Intergenic
1095587402 12:43864001-43864023 CAGCCAGCCCTGGACAGTGAGGG + Intronic
1096515431 12:52152716-52152738 CTGCCTGTCCTGGCCTGTGCTGG + Intergenic
1097017933 12:56000396-56000418 CTGCCGGCCCCGGGCAATGAGGG - Intronic
1097291577 12:57920660-57920682 CTCCCTGGCCTGATCAGTCATGG + Intergenic
1097664194 12:62461486-62461508 CTGCCGGCCCTGGCCAGTGAGGG - Intergenic
1098168227 12:67719485-67719507 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1098171073 12:67747877-67747899 CTTCCTGCCCTGGTCAGGCCTGG - Intergenic
1099790705 12:87330323-87330345 CTGCTGGCCCCGGGCAGTGAGGG + Intergenic
1100164526 12:91901310-91901332 ATGCCTGCCCTGCTCAGTTTGGG + Intergenic
1100211893 12:92406771-92406793 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1100584691 12:95969242-95969264 CTGCTGGCCCCGGGCAGTGAGGG + Intergenic
1101008982 12:100430409-100430431 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1101791232 12:107929736-107929758 CTGTCTGCCCTGGTCTGTTTTGG - Intergenic
1102510764 12:113413870-113413892 CTGGCTGCACTGGCCAGGGAGGG - Intronic
1102904016 12:116660832-116660854 CTGCAAGCCCCGGGCAGTGAGGG + Intergenic
1103146154 12:118597428-118597450 CTGCCGGCCCCGGGCAGTGAGGG - Intergenic
1103497553 12:121374572-121374594 CCGCCGGCCTTGGGCAGTGAGGG + Intronic
1103504520 12:121432898-121432920 CTGCCTGCTCTGGTGCTTGAAGG - Intronic
1103668537 12:122592132-122592154 CTGCCGGCCCCGGGCAGTGAGGG + Intronic
1103853286 12:123947068-123947090 CTGCCGGCCCCGGGCAATGAGGG + Intronic
1104704600 12:130933843-130933865 CTGCCCGCCCGGGTCCGTGTGGG - Intergenic
1104815560 12:131643707-131643729 TGGCCTGCACTGGTCAGAGAAGG + Intergenic
1105871151 13:24507059-24507081 CCGCCGGCCCCGGACAGTGAGGG - Intronic
1108643983 13:52408329-52408351 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1108858967 13:54829753-54829775 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1109212300 13:59548348-59548370 GTGACTGCTCTGGGCAGTGAAGG - Intergenic
1109884369 13:68524050-68524072 CTGCCGGCCCCAGGCAGTGAGGG + Intergenic
1110368858 13:74718499-74718521 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1110792402 13:79600411-79600433 CTGCCGGCCCTGGGCAATGAGGG - Intergenic
1110862126 13:80355654-80355676 CTGCCAGCCCTGGGCAATGAGGG + Intergenic
1111441898 13:88291927-88291949 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1111591016 13:90348706-90348728 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1112226492 13:97545384-97545406 CTGCCGGCCCGGGGCAGTGAAGG + Intergenic
1112518636 13:100077623-100077645 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1112533177 13:100224302-100224324 CTGCCGGCCCCGGGCAATGAGGG - Intronic
1112622266 13:101064952-101064974 TTGCCTGGCCTGCTCTGTGATGG - Intronic
1113508573 13:110833143-110833165 CTGCCTGGCCTGGTGAGCCATGG - Intergenic
1113543003 13:111123382-111123404 CTGCCTGCCCTGCCCAGAGCAGG + Intronic
1113572104 13:111365468-111365490 ATGCCTGCCCTGGGCTGGGAAGG - Intergenic
1114559635 14:23580704-23580726 CCGCCGGCGCTGGGCAGTGAGGG + Intergenic
1114593527 14:23891864-23891886 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1115118272 14:29909104-29909126 CTGCCAGCCCCAGGCAGTGAGGG + Intronic
1115174604 14:30547770-30547792 CTGCCAGCCCTGGGCAGTGAGGG - Intergenic
1115533246 14:34346052-34346074 CTGCCAGCCCCGGGCAGTGAGGG - Intronic
1116223188 14:42113702-42113724 CCGCCGGCCCCGGGCAGTGAGGG - Intergenic
1116311004 14:43326712-43326734 CCACCGGCCCTGGGCAGTGAGGG + Intergenic
1116388327 14:44359963-44359985 CTGTCTCTCCTGGACAGTGAGGG - Intergenic
1116390519 14:44384850-44384872 CTGCCGGCCCTGGGCAATGAGGG + Intergenic
1116426519 14:44798700-44798722 CCGCCAGCCCCGGGCAGTGAGGG + Intergenic
1116452352 14:45080544-45080566 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1117082583 14:52166854-52166876 CTGCCGGCCCTGGGCAGTGAGGG + Intergenic
1117105470 14:52393869-52393891 CTGCATGCCCAGGTCAGTGCAGG - Intergenic
1117328619 14:54691065-54691087 CTGCCTGCACTGGGCTGTGTGGG + Intronic
1117449811 14:55839616-55839638 CCACCAGCCCTGGGCAGTGAGGG + Intergenic
1117787620 14:59303462-59303484 CTTCCTGCCCTGGTTAGCGATGG + Intronic
1118258705 14:64227287-64227309 CTGCAAGCCCTGGGCAGTTAAGG + Intronic
1118306325 14:64658274-64658296 CCGCCGGCCCGGGGCAGTGAGGG + Intergenic
1119038833 14:71254404-71254426 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1119090220 14:71773940-71773962 CTGCCTGCCCTGGCCTCTGTGGG - Intergenic
1119300328 14:73566586-73566608 CTGCCAGCCCCGGGCAATGAGGG - Intergenic
1119330567 14:73790257-73790279 ATTCCTGCCCTGGTCAGGGATGG - Intronic
1119681889 14:76598878-76598900 CTCCCTGGCCTGGGCTGTGAAGG + Intergenic
1119695053 14:76706917-76706939 CCGCCTGCGCGGGGCAGTGAGGG - Intergenic
1120214685 14:81668964-81668986 CTGCCGGCCCCGGGCAGTGAGGG - Intergenic
1120699001 14:87677223-87677245 CTGCCTTCCCTGGACACTTAGGG - Intergenic
1120844156 14:89111755-89111777 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1122088358 14:99322297-99322319 GTGCCTTCTATGGTCAGTGATGG - Intergenic
1122408124 14:101512380-101512402 CTGCCTGGCCTGCTCAGCCACGG - Intergenic
1122501943 14:102206680-102206702 CTGCCTGACAAGGCCAGTGATGG + Intronic
1122514526 14:102297793-102297815 CTGCTGGCCCCGGGCAGTGACGG + Intronic
1122750145 14:103927488-103927510 GATCCTGCCCTGGCCAGTGAGGG + Intronic
1123019335 14:105390314-105390336 CTGCCTGCCCGGGTTGGGGAGGG + Intronic
1123051874 14:105547934-105547956 CCGCCTGCCCTGGGCAGTGAGGG + Intergenic
1124061597 15:26298315-26298337 CCGCCGGCCCCGGGCAGTGAGGG - Intergenic
1124114865 15:26831432-26831454 CTGCCGGCCCCGGGCAATGAGGG - Intronic
1124168632 15:27352609-27352631 CTGCCTCCCCGGGGCAGTGTGGG - Intronic
1124595703 15:31089832-31089854 CTGCCTGCCCTTGTGAGTAAGGG + Intronic
1124658857 15:31528956-31528978 CTCACAGCCCTGGTCAGTCATGG + Intronic
1125112209 15:36047062-36047084 CTGACGGCCCCGGGCAGTGAGGG + Intergenic
1125657669 15:41371273-41371295 CTCCCTGCCTTGGACAATGATGG - Intronic
1125765709 15:42134148-42134170 TTGCATGCCCTGGGCTGTGATGG - Intergenic
1126128068 15:45314200-45314222 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1127916439 15:63459193-63459215 CTGCTGGCCCTGGGCAGTAAGGG + Intergenic
1128323231 15:66706753-66706775 CTCCCTGCAGTGGTCGGTGAAGG - Intronic
1128672646 15:69586129-69586151 CTGCCTGCTCTGGTGTGGGAGGG - Intergenic
1128682924 15:69664542-69664564 CTGCCTGCCCAAGCCAGAGAGGG - Intergenic
1128813317 15:70587427-70587449 CTGCCGGCCCCGGGCACTGAGGG - Intergenic
1129158268 15:73732398-73732420 CGGCCGGCCCCGGGCAGTGAGGG - Intergenic
1129724396 15:77894226-77894248 CCGCCCGCCCCGGGCAGTGAGGG - Intergenic
1129777507 15:78246390-78246412 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1130132854 15:81158730-81158752 CTGCCGGCCCCGGGCAATGAAGG + Intergenic
1131012709 15:89031910-89031932 CCGCCGGCCCCGGGCAGTGAGGG - Intergenic
1131992383 15:98104476-98104498 CCGCTAGCCCTGGGCAGTGAGGG - Intergenic
1132622159 16:872917-872939 CTGCCTGCCTGGGTCAGGGTGGG + Intronic
1132812969 16:1810549-1810571 CCATCTGCCCTGGTCAGTGCTGG - Intronic
1132836831 16:1958452-1958474 CTGCCGGCCCTGGGCAATGAGGG - Intergenic
1133050989 16:3117293-3117315 CTGCTTGCCCTGGAGAGAGATGG + Intronic
1133177410 16:4025663-4025685 TGGGCTGCCCTGGTCAGTGCAGG - Intronic
1133352161 16:5108763-5108785 CCGCCGGCCCTGGGCAGTGAGGG - Intergenic
1134717760 16:16365411-16365433 CTGCAGGCCGTGGTCAGGGATGG + Intergenic
1134956992 16:18386748-18386770 CTGCAGGCCGTGGTCAGGGACGG - Intergenic
1135262130 16:20989893-20989915 CTGCCGGCCCCGGGCAATGAGGG - Intronic
1135280842 16:21152705-21152727 CTGCCGGCCCCGGGCAATGAGGG + Intronic
1135299400 16:21313033-21313055 CTGCTGGCCCCGGGCAGTGAGGG - Intergenic
1135550179 16:23391795-23391817 CTGCCTGCCCTCTTCACTGGAGG - Intronic
1135884471 16:26293096-26293118 CTGGCTACCCTGGTCTATGAGGG - Intergenic
1136199677 16:28679510-28679532 CTGCCAGCCCCGGGCAATGAGGG - Intergenic
1136216024 16:28793683-28793705 CTGCCAGCCCCGGGCAATGAGGG - Intergenic
1138288484 16:55828146-55828168 CTTCCTACCCTGGGGAGTGATGG + Intronic
1138688768 16:58748962-58748984 CCGCCGGCCCCGGGCAGTGAGGG + Intergenic
1139237521 16:65355632-65355654 CTTCCTGCCCTGGTAATTAAAGG - Intergenic
1139676419 16:68526855-68526877 CCGCAAGCCCTGGGCAGTGAGGG + Intergenic
1139952105 16:70677510-70677532 CTGCCTGCCCTGCTCCATGTGGG - Intronic
1141140819 16:81495756-81495778 CTGCCTGCTGTGGTCAGCCATGG + Intronic
1141534560 16:84670140-84670162 GGGCCTGCGCTGCTCAGTGAGGG + Intergenic
1141598297 16:85110644-85110666 CTGCCTGGGCTGGTCAGTAGTGG + Intronic
1141611762 16:85185683-85185705 CTGGCTCCCCTGGTCTGTGTGGG + Intergenic
1141699293 16:85635118-85635140 CAGCCCGCCCTGGTCAGGGCAGG - Intronic
1141773681 16:86107329-86107351 CTGCCTGCCCTTGCCTGGGACGG + Intergenic
1141837698 16:86553518-86553540 CGGCTGGCCCTGGGCAGTGAGGG + Intronic
1142191578 16:88720605-88720627 CTGCCTGTCCCTGTGAGTGATGG - Exonic
1142259191 16:89034669-89034691 CTGCCTGACCTTGCCAGGGAAGG - Intergenic
1142414748 16:89935266-89935288 CTGGCTGCCCCGGGCTGTGAGGG - Exonic
1142583995 17:959370-959392 CTGCCTGCCCCGGCCAGAGCGGG + Intronic
1142670128 17:1484287-1484309 CTGCAGGCCCTGGGCAGTGACGG - Exonic
1143135271 17:4709303-4709325 CGGCCAGCCCCGGGCAGTGAGGG - Intergenic
1143552737 17:7640988-7641010 CTGCCGGCCCCGGGCAGTGAGGG + Intergenic
1144947605 17:18977878-18977900 GTGGCTGTCCTGGTCACTGAGGG + Exonic
1145050319 17:19654568-19654590 CCGCCAGCCCTGGGCAATGAGGG - Intronic
1145997795 17:29114555-29114577 CTCCCTTCCCTGATCTGTGAGGG - Intronic
1147046388 17:37755388-37755410 CTGCCAGCCTGGGTCAGGGATGG - Intergenic
1147997525 17:44368931-44368953 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1148016866 17:44528082-44528104 CTGCCGGCCCGGGGCAATGAGGG + Intergenic
1148841147 17:50498184-50498206 CTGCCTGACCTGCTGAGAGAAGG - Intergenic
1150525840 17:65921247-65921269 CTGGCTGCCCTGTTCAAAGAAGG + Intronic
1150583065 17:66492910-66492932 CTGTCTGCCCTGCACAGTCAGGG - Intronic
1150716688 17:67578326-67578348 CTGCTGGCCCTGGTCACAGAGGG - Intronic
1150772275 17:68051980-68052002 CTGCCGGCCCAGGGCAGTGAGGG + Intergenic
1150778272 17:68099390-68099412 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1150786757 17:68169610-68169632 CTGCCGGCACTGGGCAATGAAGG - Intergenic
1150788259 17:68179956-68179978 CTGCCGGCCCCGGGCAGTGAGGG + Intergenic
1151149628 17:72073790-72073812 CTGCCTGCCATGCTCAGTGATGG - Intergenic
1151289563 17:73139727-73139749 CTACTTGCCCTGGTCACTGAAGG - Intergenic
1151782686 17:76257900-76257922 CTGCCGGCCCGGGGCAATGAGGG - Intergenic
1152407893 17:80107942-80107964 CTGCCTGCCCTGGAGACTGGAGG + Intergenic
1152468624 17:80478606-80478628 CAGCCTGCCCTGGGCAGGGCAGG - Intergenic
1152604612 17:81282903-81282925 ATGCCTGCCCTGCCCAGTGAGGG + Intronic
1152619062 17:81352300-81352322 CTGCCAGCCCCGGGCAATGAGGG - Intergenic
1153617820 18:6950795-6950817 CACCCTGCACTGCTCAGTGATGG - Exonic
1153960379 18:10135130-10135152 CTGCCAGCCTTGGACAGGGAAGG + Intergenic
1153961677 18:10145441-10145463 CTGCCAGCCTTGGACAGGGAAGG + Intergenic
1154057252 18:11023899-11023921 CTGCCGGCCCCGGGCAATGAGGG - Intronic
1154255322 18:12777107-12777129 CCGCCGGCCCCGGGCAGTGAGGG - Intergenic
1155003308 18:21706625-21706647 CCGCCGGCCCTGGCCAGTGAGGG + Intronic
1155036220 18:22026968-22026990 CTGCCTGCCCAGGTGGGGGACGG - Intergenic
1155271964 18:24149806-24149828 CTGCCAGCCCCGGGCAATGAGGG - Intronic
1155508566 18:26553871-26553893 TTGCCTGCCCTGGTCAGGTCTGG - Intronic
1155611716 18:27674115-27674137 CTGCTGGCCCCGGGCAGTGAAGG - Intergenic
1156657816 18:39309201-39309223 CTGCCGGCCCCAGGCAGTGAGGG + Intergenic
1156683559 18:39618563-39618585 CTGCCGGCCCAGGGTAGTGAGGG + Intergenic
1156943159 18:42795340-42795362 CTGCCAGCCCCGGGCAATGAGGG + Intronic
1157712743 18:49861108-49861130 CTGGCTGCCCTGGGGAGTGGAGG - Intronic
1157856903 18:51112058-51112080 CTGCTGGCCCTGGGCAGTGAGGG - Intergenic
1158697270 18:59714345-59714367 CTGCCGGCCCCGGGCAGTGAGGG - Intergenic
1159109796 18:64043079-64043101 CTGCCAGCCTGGGGCAGTGAGGG + Intergenic
1159472958 18:68880247-68880269 CTGCCGGCCCCGGGCAATGAGGG - Intronic
1160017433 18:75155376-75155398 CTGCCTTCCCTTCTCGGTGAAGG - Intergenic
1160811149 19:1013452-1013474 CACCCTGGCCTGGTCAGTGGTGG - Intronic
1162020605 19:7866776-7866798 CTGGCTGCCCAGGTCAGGGCAGG + Intergenic
1162230136 19:9259621-9259643 CTGCCGGCCCTGGGCAATGAGGG + Intergenic
1162263040 19:9547915-9547937 CCACCAGCCCTGGGCAGTGAGGG + Intergenic
1162632710 19:11941548-11941570 CTGCTGGCCCTGGGCAATGAGGG - Intronic
1162987094 19:14277733-14277755 CTGCCGGCCCTGGGCAGTGAGGG + Intergenic
1163122843 19:15228213-15228235 CTGCCTGCCTGGGTCTGTGAAGG + Intronic
1163218837 19:15899791-15899813 CTGCCAGCCCCGGGCAATGAGGG + Intergenic
1163389900 19:17024382-17024404 TTGCATGTCCTGGTCAGTGCTGG - Intronic
1164270596 19:23668779-23668801 CTGCCCGCCCCGGGCAATGAGGG - Intronic
1164975785 19:32571696-32571718 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1165415533 19:35691311-35691333 CCGCCGGCCCCGGGCAGTGAGGG - Intergenic
1165825535 19:38703682-38703704 CTGCCTGCCCTCGTGAGGGCGGG - Intronic
1165846573 19:38821604-38821626 CCACCTGCCCTGAGCAGTGAGGG + Intronic
1166036231 19:40170393-40170415 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1166885968 19:45961080-45961102 CTGCCCGCCCTTGCCAATGATGG + Exonic
1167246632 19:48376942-48376964 CTCCCTCCCCTGGCCAGTGTGGG - Intergenic
1168659878 19:58157411-58157433 CCGCCAGCCCCGGGCAGTGAGGG + Intergenic
925172608 2:1759549-1759571 CCGCCGGCCCCGGGCAGTGAGGG - Intergenic
925294059 2:2766246-2766268 CTGACTGCCCTGCGCAGTGAAGG + Intergenic
926037402 2:9646346-9646368 CTCCCTCCCCTGTTCAGCGAGGG + Intergenic
926581881 2:14639633-14639655 TTCCCTGCCCTTGTCACTGATGG + Exonic
926616643 2:15002787-15002809 CTGCCGGCCCTGGGCAATGAGGG - Intergenic
927357076 2:22186450-22186472 CCGCCGGCCCCGGGCAGTGAGGG + Intergenic
927942191 2:27111720-27111742 CCGCCGGCCCCGGGCAGTGAGGG - Intronic
928446218 2:31335963-31335985 CTGCAAACCCTGGTCTGTGAGGG - Exonic
928617951 2:33057680-33057702 GTGCCGGCCCCGGGCAGTGAGGG - Intronic
928936887 2:36688369-36688391 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
929379677 2:41335698-41335720 CTGCCGGCCCCAGGCAGTGAGGG + Intergenic
929890881 2:45917923-45917945 CTGCCAGCCCTGGGCAATGAGGG - Intronic
930420894 2:51151871-51151893 CTGCCAGCTCTGGGCAGTGAGGG - Intergenic
930593384 2:53356542-53356564 CCGCCGGCCCTGGGCAGTGAGGG + Intergenic
931195499 2:60048772-60048794 CTGCCTCCCCTGGTCAGGAATGG + Intergenic
932902039 2:75711682-75711704 CTGCCAGCCCCGGGCAGTGAGGG + Intergenic
933060839 2:77734992-77735014 CCGCAAGCCCTGGGCAGTGAGGG - Intergenic
933139800 2:78779102-78779124 CCGCCGGCCCCGGTCAGTGAGGG + Intergenic
934464196 2:94244435-94244457 TGGGCTGCCATGGTCAGTGACGG + Intergenic
934763214 2:96867564-96867586 CTGCCTGCCCAGGTGTGGGAGGG - Intronic
934860079 2:97757405-97757427 CTGCCTGCCGGGCTCAGTGCTGG - Intronic
935896863 2:107747591-107747613 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
936074485 2:109393057-109393079 TTGCCTGCCCGTCTCAGTGAGGG + Intronic
936172707 2:110190441-110190463 CCACCGGCCCTGGGCAGTGAGGG - Intronic
936346878 2:111681958-111681980 CTGCCAGCCCCGGGCAATGAGGG + Intergenic
936581533 2:113704657-113704679 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
937315712 2:120930896-120930918 CTTCCTTCCCTTGCCAGTGAGGG + Intronic
937596840 2:123683881-123683903 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
937672303 2:124551085-124551107 CTCCCTGCACGGGCCAGTGAAGG - Intronic
937711858 2:124987662-124987684 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
937789441 2:125943177-125943199 CTGCCGGCCCCAGGCAGTGAGGG - Intergenic
938067147 2:128287359-128287381 CTGCCCCCCCTACTCAGTGAGGG + Intronic
938126089 2:128672377-128672399 CTGCCGGCCCTGGGCAATGAGGG - Intergenic
938401019 2:130991553-130991575 CTGCCGGCCCCGGGCAATGAGGG + Intronic
938726038 2:134109598-134109620 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
939229748 2:139410448-139410470 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
939281743 2:140073897-140073919 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
939777364 2:146403944-146403966 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
939886438 2:147686504-147686526 CCGCGGGCCCTGGGCAGTGAGGG - Intergenic
940666717 2:156618310-156618332 CTGCCAGCCCCGGGCAATGAGGG - Intergenic
941240075 2:163026383-163026405 CTGCCGGCCCTGGGCAATGAGGG + Intergenic
941309240 2:163909630-163909652 CTACCGGCCCCGGGCAGTGAGGG + Intergenic
941712132 2:168725150-168725172 CTGCCGGCCCTGGGCAATGAGGG - Intronic
942170267 2:173282841-173282863 CTGCCGGCCCCGGGCAGTGAGGG - Intergenic
942317612 2:174709829-174709851 CAGCCAGCCCCGGGCAGTGAGGG - Intergenic
942620014 2:177835781-177835803 CCGCCGGCCCTGGGCAGTGAGGG + Intronic
942867279 2:180691495-180691517 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
943426878 2:187749133-187749155 CTGCTTGCCCTTGGCAGGGATGG - Intergenic
943649851 2:190445516-190445538 CTGCCAGCCTTTCTCAGTGAGGG + Intronic
943680353 2:190761207-190761229 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
943941451 2:194002990-194003012 CTGCCAGCCCTGGGCAGTGAGGG - Intergenic
943942715 2:194020269-194020291 CCGCTGGCCCTGGGCAGTGAGGG + Intergenic
945069638 2:205977334-205977356 CCGCAAGCCCTGGGCAGTGAGGG + Intergenic
945186221 2:207142593-207142615 CTCCCTGCAGAGGTCAGTGAAGG + Intronic
945451492 2:210000826-210000848 CTGCTGGCCCCGGGCAGTGAGGG - Intergenic
945575487 2:211524630-211524652 CTGCCGGCCCCGGGCAATGAGGG - Intronic
945869139 2:215207981-215208003 CCGCCGGCCCCGGGCAGTGAGGG + Intergenic
945872837 2:215245981-215246003 CTGCCAGCCCCGGGCAGTGAGGG - Intergenic
945907903 2:215615138-215615160 CCGCCGGCCCCGGGCAGTGAGGG - Intergenic
946023973 2:216660775-216660797 CCCCCTGCCAGGGTCAGTGAGGG + Exonic
946224618 2:218257553-218257575 CTGCCTGGCCTCGGCAGTAAGGG - Intergenic
946376502 2:219312928-219312950 CCGCCGGCCCCGGGCAGTGAGGG + Intergenic
946982178 2:225229701-225229723 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
947103786 2:226648115-226648137 CTGCCGGCCCCGGGCAGTGAAGG + Intergenic
947263032 2:228245889-228245911 CTTCCTGCCCTTGTGAGTGCTGG + Intergenic
947720412 2:232366448-232366470 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
947826346 2:233108182-233108204 CTGCCAGCCCAGGGCAGAGAAGG - Intronic
947916148 2:233833060-233833082 CTGCATGCCCTGGGCAGTGATGG - Intronic
947999418 2:234555569-234555591 CTGCCTGCCCGTGTCAGGGAAGG + Intergenic
948438737 2:237971665-237971687 CTCCTTGCCATGGTCAGAGAGGG - Intronic
948909721 2:240996960-240996982 CTGGCCTCCCTGGTCAGGGAGGG - Intergenic
948976780 2:241468366-241468388 CTGACTGCCATGGTGAGTGTGGG + Exonic
949059904 2:241950856-241950878 CTGCCTCCTCTTGTCAGTGAAGG + Intergenic
1168971725 20:1935824-1935846 GTGCCAGCCCTGGCCAGGGAGGG + Intronic
1168974201 20:1951926-1951948 CTTCCTGCAGTGGTCAGGGAAGG - Intergenic
1169128556 20:3149502-3149524 CTGCTTGCCTTGTACAGTGAAGG - Intronic
1169630245 20:7622698-7622720 CTGCCAGCCCCGGGCAGTGAGGG - Intergenic
1170044362 20:12070175-12070197 TTTCCTGCTCTGGTGAGTGAGGG + Intergenic
1171445442 20:25199456-25199478 CTGCCTGGCCTAGCCATTGAAGG + Intronic
1171459120 20:25288671-25288693 CTGCCTGCCCAGCTCACTGGAGG + Intronic
1172173184 20:32955788-32955810 CTGCCTGCCCATGTAAGGGAGGG + Intronic
1172196586 20:33096032-33096054 CTGCCTGCCCTGTTTAGTCCTGG + Intronic
1173729059 20:45316380-45316402 CTGCCTGCACTGGGCAGTGGTGG + Intronic
1173778756 20:45736005-45736027 CCGCCGGCCCTGGGCAATGAGGG + Intergenic
1174092295 20:48058970-48058992 CCGCAGGCCCTGGGCAGTGAAGG + Intergenic
1175174243 20:57101066-57101088 CTGCCTGCTCAGGTCAGGCATGG - Intergenic
1175254144 20:57628902-57628924 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1175644301 20:60658156-60658178 CTGCCTGCACAGGAGAGTGATGG + Intergenic
1175814377 20:61875892-61875914 CCGCCTGCCCTGGGGAGAGAGGG + Intronic
1175901074 20:62360128-62360150 CTGCCAGCCTTGGTCAGGGTGGG - Intronic
1176128251 20:63485471-63485493 CTGCCTGCCATGGTCTGTGCTGG - Intergenic
1176382192 21:6119106-6119128 CTGCCTGGCCTCCTCACTGATGG - Exonic
1177389564 21:20450608-20450630 CTGCCGGCCCAGGACTGTGATGG - Intergenic
1177496922 21:21902530-21902552 CTGCCTGCCCCGGGCAATGAGGG + Intergenic
1178074175 21:29000288-29000310 CCGCCGGCCCGGGGCAGTGAGGG + Intergenic
1179741280 21:43419133-43419155 CTGCCTGGCCTCCTCACTGATGG + Exonic
1179887960 21:44322462-44322484 CTGCCTGGCCTGGCCAGGCAGGG - Intronic
1179949996 21:44704031-44704053 CTGTCTGCCCTGGAGAGTGTGGG + Intronic
1180145073 21:45914248-45914270 CTTCCTGCCCGGGTCAGGGAGGG - Intronic
1180278109 22:10664730-10664752 TGGGCTGCCATGGTCAGTGACGG + Intergenic
1180585358 22:16883583-16883605 TGGGCTGCCGTGGTCAGTGACGG + Intergenic
1180714749 22:17864324-17864346 CTGTCTGCCCTGCACCGTGATGG - Intronic
1180741055 22:18053609-18053631 CTGCCGGCCCCGGGCAATGAAGG - Intergenic
1180955209 22:19738394-19738416 CTGCGTGCCCAGGTCACAGACGG + Intergenic
1181001673 22:19990637-19990659 CAGCCTGGCATGGTCAGTGGTGG - Exonic
1181415575 22:22756348-22756370 CTGACAGCCCTTCTCAGTGAGGG - Intronic
1181592246 22:23892715-23892737 TTGCCTTACCTGGCCAGTGACGG - Intronic
1181600399 22:23948640-23948662 CTGTCTGCTCTGGGCAGTGATGG - Intergenic
1181608111 22:23992687-23992709 CTGTCTGCTCTGGGCAGTGATGG + Intergenic
1182349647 22:29692138-29692160 CTGGCTGCACTGGTCAGCAAGGG - Intronic
1182598318 22:31439867-31439889 CTGCCTGCCCTGCTCACTGTCGG + Exonic
1182599323 22:31448144-31448166 CAGCCTGACCTGGGCTGTGATGG + Exonic
1182766480 22:32761462-32761484 CTCCCTTCCAGGGTCAGTGAAGG - Intronic
1183422133 22:37718092-37718114 CTGCCGGCCCCGGGCAATGAGGG - Intronic
1183629587 22:39025183-39025205 CTGCCTGCCCTGTGTGGTGAAGG + Exonic
1183676011 22:39299281-39299303 CTTCCTGACCTGGGCTGTGATGG + Intergenic
1183706985 22:39480313-39480335 CTGCCTGCCTGGGTCACAGAGGG + Intronic
1183866497 22:40708417-40708439 CAGCCAGCCCTGAACAGTGAAGG - Intergenic
1184022034 22:41827270-41827292 CTGCCTCCACTGCCCAGTGAGGG - Intergenic
1184401833 22:44278958-44278980 GAGCCTGCCCTGGACAATGATGG - Intronic
1184401838 22:44278987-44279009 GTGCCTGCCCTGGACAGTGATGG - Intronic
1184582412 22:45426510-45426532 CTGCCAGACCTGCTCAGAGAAGG + Intronic
1184987368 22:48144866-48144888 CTGCCTGTTCTGGGCACTGAAGG + Intergenic
1185274098 22:49943013-49943035 CTGCCCTCCCAGGTCAGTGGTGG + Intergenic
949769982 3:7568704-7568726 CTGCCGGCCCTGGGCAATGAGGG + Intronic
950063111 3:10088937-10088959 CTCCCTTACCTGGTCAGTGTAGG - Exonic
950068954 3:10136645-10136667 CTGCAAGCCCAGGGCAGTGAGGG - Intergenic
950113920 3:10438355-10438377 CAGCCTGCCCTCCTCAGTGTGGG + Intronic
950470163 3:13179863-13179885 CCGCCAGCCCCGGGCAGTGAGGG + Intergenic
950600387 3:14029747-14029769 CTGACAGCCCTGGGCAATGAGGG - Intronic
951024866 3:17817938-17817960 CCACCGGCCCTGGGCAGTGAGGG - Intronic
951332953 3:21387462-21387484 CCACCAGCCCTGGGCAGTGAGGG - Intergenic
951415432 3:22417060-22417082 CCACCAGCCCTGGGCAGTGAGGG + Intergenic
951491243 3:23272265-23272287 CGGCCGGCCCCGGGCAGTGAGGG - Intronic
952393703 3:32902902-32902924 CTGCCCGCCCCGGGCAGTGAGGG + Intergenic
952398222 3:32939791-32939813 CTGTCGGCCCCGGGCAGTGAGGG + Intergenic
952784979 3:37144108-37144130 ATGCCTGGCCTGGGCAGTGGTGG + Intronic
952834369 3:37591044-37591066 CTGCCTCCACTGGGCAGTGCTGG + Intronic
953119120 3:40022581-40022603 CTCTCTGCTCTGGTCATTGAAGG + Intronic
953124523 3:40078179-40078201 CTGCCGGCCCTGGGCAATGAGGG - Intronic
953886176 3:46715524-46715546 CTGCCTGATCTGGTGAGTCAAGG - Exonic
954095976 3:48328421-48328443 CTTCATTTCCTGGTCAGTGAGGG - Intergenic
954333492 3:49903203-49903225 CTGCCTGCGCTGGTCAGTTGTGG - Exonic
954360499 3:50120145-50120167 CTTCCTGACCTGGTCAGGCATGG - Intergenic
954580541 3:51700713-51700735 CTGCCTGTCAGGGTCATTGAAGG + Intronic
955183341 3:56691987-56692009 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
955210277 3:56934573-56934595 CTGCCAGCCCAGGGCAATGAGGG + Intronic
955219655 3:57012973-57012995 CTGCTGGCCCTGGGCAGTGAGGG + Intronic
955266468 3:57449598-57449620 CTGCCGGCCCCGGGCAATGAGGG - Intronic
956392196 3:68785527-68785549 CGGCCGGCCCTGGGCAGTGAGGG - Intronic
956438813 3:69260383-69260405 CCGCCAGCCCTGGGCAGTGAGGG + Intronic
956563628 3:70611963-70611985 CTGCCGGCCCCGGGCAGTGAGGG + Intergenic
957074080 3:75587906-75587928 CTGCCGGCCCCGGGCAGTGAGGG + Intergenic
957419679 3:79951623-79951645 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
957665191 3:83217863-83217885 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
957830027 3:85504928-85504950 CTGCCGGCCCCGGGCAATGAGGG - Intronic
957919670 3:86731700-86731722 CGGCCAGCCCTGGGCAGTGAGGG - Intergenic
957921809 3:86757705-86757727 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
958548605 3:95588791-95588813 CTGCCAGCCCCGGGCAGTGAGGG - Intergenic
959422729 3:106148735-106148757 CTGCCAGCCCCGGGCAATGAGGG + Intergenic
959462446 3:106643878-106643900 CTGCTGGCCCTGGGCAGTGAGGG + Intergenic
959472831 3:106773719-106773741 CTGCTTGCCCTGGTTACTGATGG - Intergenic
960560050 3:119073654-119073676 CTCCCGGCCCTGGGCAGTGAGGG - Intronic
961175947 3:124835046-124835068 TTCCCTGCCTTGGTCAGTGAAGG + Intronic
961298225 3:125904041-125904063 CCGCCGGCCCTGGGCAGTGAGGG + Intergenic
961378754 3:126483508-126483530 CTGCCTGCTCTGTGCAGTGTTGG - Intronic
961460455 3:127046785-127046807 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
961473686 3:127134215-127134237 CTGCCTGCCCCATTCAGTGGGGG - Intergenic
961688792 3:128653507-128653529 CTGCCAGCCCTGGGCAATGAGGG + Intronic
961691236 3:128671308-128671330 CTGCCTGCCCATGTCAGAGGTGG + Intronic
962084549 3:132176381-132176403 CTGCCTGGCCTCATCAGTGCTGG - Intronic
962107389 3:132405698-132405720 CTGACTGCACTAGTCAGTTAGGG - Intergenic
962889144 3:139656108-139656130 CTTTCTGCCCTGGTTAGGGATGG + Intronic
963397873 3:144756990-144757012 CCGCTGGCCCTGGGCAGTGAGGG + Intergenic
963533256 3:146497406-146497428 CTGCCGGCCCCGGGCAGTGACGG + Intergenic
963862160 3:150323076-150323098 CTGCCAGCCCCGGGCAATGAGGG + Intergenic
964751851 3:160060632-160060654 CTGCCGGCCCCAGGCAGTGAGGG + Intergenic
964974162 3:162599806-162599828 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
965003520 3:162987465-162987487 CTGCCTGCCCTGGGCAGTGAGGG + Intergenic
965044145 3:163552574-163552596 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
965092239 3:164179356-164179378 CCGCCGGCCCTGTGCAGTGAGGG + Intergenic
965109433 3:164402142-164402164 CTGCCGGCCCTGGGCACTGAGGG - Intergenic
965298121 3:166975942-166975964 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
965652349 3:170947331-170947353 CTGCCGGCCCCGGGCATTGAGGG + Intergenic
965943495 3:174212224-174212246 CTGCTGGCCCCGGACAGTGAGGG - Intronic
966076057 3:175937481-175937503 CTGCCAGCCCCGGGAAGTGAGGG + Intergenic
966725444 3:183103998-183104020 CTGCCGGCCCGGGGCAATGAGGG - Intronic
967258059 3:187613427-187613449 CTGCCTGCCATGGTCATCTATGG + Intergenic
968469677 4:773674-773696 CTGCTGGCCCCGGGCAGTGAGGG + Intergenic
969287129 4:6209881-6209903 CTCCCTGTGCTGGTCTGTGATGG - Intergenic
969489101 4:7488715-7488737 ATGTCTGCCATGGCCAGTGACGG - Intronic
969534404 4:7747027-7747049 TTGCCTGACCTTGTCTGTGACGG - Intergenic
969638516 4:8383102-8383124 CGGCCTGCTCTGGTTTGTGACGG - Intronic
970108311 4:12609739-12609761 CTGCAAGCCCCGGGCAGTGAGGG + Intergenic
970272117 4:14358771-14358793 TTGCCGGCCCCGGGCAGTGAGGG + Intergenic
970391208 4:15615022-15615044 CTGCCGGCCCTGGGCAATGAGGG + Intronic
970649335 4:18159521-18159543 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
970803518 4:20004120-20004142 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
971030775 4:22634876-22634898 CTGCCGACCCCGGGCAGTGAAGG + Intergenic
971377123 4:26064231-26064253 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
971618753 4:28828104-28828126 CTGCCAGCCCTGGGCAGTGAGGG + Intergenic
971709455 4:30092815-30092837 CTGCCGGCCCCGGGCAGTGAGGG + Intergenic
971936202 4:33151085-33151107 GTGCCTGCCCTGGACAATGAAGG - Intergenic
972173365 4:36375056-36375078 CTGGCTGCCCCAGGCAGTGAGGG + Intergenic
972505790 4:39718754-39718776 CTGCTGGCCCTGGGCAGTGAGGG - Intronic
972778602 4:42266048-42266070 CTGCCAGCCCCAGGCAGTGAGGG + Intergenic
973039948 4:45457367-45457389 CCGCCAGCCCTGGGCAGTGAGGG - Intergenic
973587770 4:52409998-52410020 CTGCCAGCCCTGGGCAATGAGGG - Intergenic
973765102 4:54155376-54155398 CTGCCGGCCCCAGGCAGTGAGGG - Intronic
974188005 4:58465230-58465252 CTGCCGGCCCCAGGCAGTGAGGG + Intergenic
974299259 4:60042470-60042492 CCGCCGGCCCAGGGCAGTGAGGG - Intergenic
974484797 4:62492148-62492170 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
974781757 4:66561741-66561763 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
974804376 4:66860277-66860299 CTGCCGGCCCCAGGCAGTGAGGG + Intergenic
974807571 4:66899711-66899733 CGGCCAGCCCCGGGCAGTGAGGG - Intergenic
974838241 4:67275496-67275518 CTGCCAGCCCCAGGCAGTGAGGG - Intergenic
974839798 4:67286949-67286971 CCGCGGGCCCTGGGCAGTGAGGG - Intergenic
975028058 4:69576586-69576608 CCGCCCGCCCTGGGCAGTGAGGG - Intergenic
975595195 4:76043538-76043560 CTGCCGGCCCCGGGCAATGAGGG - Intronic
975755864 4:77570772-77570794 CTGCCGGCCCTGGGCAGTGAGGG + Intronic
975994939 4:80302948-80302970 CTGCAGGCCCTGGGCAGTGAGGG + Intronic
976520636 4:86021859-86021881 CTGCTGGCCCCGGGCAGTGAGGG - Intronic
976736294 4:88313399-88313421 CCGCTGGCCCTGGGCAGTGAGGG - Intergenic
977206512 4:94169953-94169975 CCGCCAGCCCCGGGCAGTGAGGG + Intergenic
977416656 4:96742627-96742649 TTGCTGGCCCTGGGCAGTGAGGG + Intergenic
977906474 4:102483235-102483257 CTGCCGGCCCTAGGCAATGAAGG + Intergenic
978207202 4:106092653-106092675 CGGCCGGCTCTGGGCAGTGAGGG - Intronic
978466246 4:109012585-109012607 GTGCCAGCCCTGGGCAGTAAGGG + Intronic
978643322 4:110897339-110897361 CTGCTTTCCATGGTCATTGATGG + Intergenic
978748557 4:112222541-112222563 CTGCCGGCCCCAGGCAGTGAGGG + Intergenic
979308312 4:119173894-119173916 CTGCCGGCCCGGGGCAATGAGGG + Intronic
979494832 4:121371561-121371583 CTGCCTTTCCTGGTCTGGGATGG - Intronic
979688579 4:123538025-123538047 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
979857510 4:125651981-125652003 CCGCTGGCCCTGGGCAGTGAGGG - Intergenic
979865208 4:125745100-125745122 CTGCCAGCCCTGGGCAGTGAGGG + Intergenic
979920451 4:126490118-126490140 CCGCCAGCCCTGGGCAGTGAGGG + Intergenic
979974481 4:127179918-127179940 CTGCTTGCCCTTTTCAGTCATGG + Intergenic
980043389 4:127964489-127964511 CTGCCGGCCCCGGGCAATGAGGG - Intronic
980051940 4:128047810-128047832 CTGCCGGCCCCGGGCAGTGAGGG - Intergenic
980230260 4:130038794-130038816 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
980774486 4:137421129-137421151 CCGCCTGCCCGGGGCAGTGAGGG + Intergenic
982770136 4:159390068-159390090 CACCCGGCCCTGGGCAGTGAGGG + Intergenic
982814589 4:159869285-159869307 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
982985754 4:162203696-162203718 CTGCCGGCCCTGGGCATTGAGGG + Intergenic
983230666 4:165126189-165126211 CTGCCGGCCCCGGGCAATGAGGG - Intronic
983425693 4:167581668-167581690 CTGCCGGCCCCGGGCAGTGAGGG + Intergenic
983553065 4:169036087-169036109 CTGCCGGCCCCGGGCAGTGAGGG - Intergenic
983835404 4:172377788-172377810 CAGCCAGCCCTGGGCAGTGAGGG - Intronic
983843190 4:172482124-172482146 CCACCGGCCCTGGGCAGTGAGGG - Intronic
984265647 4:177495700-177495722 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
984776121 4:183482944-183482966 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
984805354 4:183746693-183746715 ATGCCGGCCCCGGGCAGTGAGGG - Intergenic
985087091 4:186324692-186324714 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
985269290 4:188179070-188179092 CCGCCCGCCCCGGGCAGTGAGGG + Intergenic
985324698 4:188754607-188754629 CTGCCAGCACTGGGCAGTGACGG + Intergenic
985366392 4:189236416-189236438 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
985403609 4:189615469-189615491 CCACCAGCCCTGGGCAGTGAGGG - Intergenic
985590879 5:764470-764492 CTGCCGGCCCCGGGCAGTGAGGG + Intronic
985646636 5:1088069-1088091 CTGCCTACCCTGGCAAGAGACGG + Intronic
985784097 5:1885291-1885313 CTGGCTGCCCTGGGAAGTGGAGG - Intronic
986121125 5:4837646-4837668 CTGCCAGCCCGGGGCAATGAGGG + Intergenic
986302025 5:6484792-6484814 CTCCCTGCACTGGTTAGTGCTGG + Intronic
986625891 5:9723603-9723625 CTGCCTCTCCTTGGCAGTGAGGG - Intergenic
986626159 5:9725426-9725448 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
986629004 5:9751019-9751041 CTGCATGCCCTGGTCATTTCTGG - Intergenic
986912541 5:12574726-12574748 CCGCCTGCCCTGGGCAGTGAAGG - Intergenic
986919020 5:12662015-12662037 CCGCCAGCCCTGGGCAGTGAGGG + Intergenic
986962746 5:13235257-13235279 CTGCATCCTTTGGTCAGTGAAGG - Intergenic
987146257 5:14994057-14994079 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
987156797 5:15096807-15096829 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
987274855 5:16351789-16351811 CTTCCTGCCCCAGTCACTGATGG - Intergenic
987283722 5:16436291-16436313 CTGCCGGCCCTGGGCAATGAGGG + Intergenic
987384020 5:17312024-17312046 CTGCCGGCCCCAGGCAGTGAGGG - Intergenic
987476705 5:18399924-18399946 CTGCCGGCCCCGGGCAATGATGG - Intergenic
987532791 5:19143022-19143044 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
987543822 5:19287853-19287875 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
988073494 5:26324569-26324591 CTGCCGGCCCGGGGCAATGAGGG + Intergenic
988132152 5:27120007-27120029 CTGCCGGCCCCGGGCAATGAGGG + Intronic
988177256 5:27743570-27743592 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
988684742 5:33515638-33515660 CTGCCGGCCCCGGGCAATGAAGG - Intergenic
988883581 5:35531735-35531757 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
989165611 5:38431001-38431023 ATGCCTGCCCAGGTTGGTGAGGG + Intronic
989977906 5:50608031-50608053 CTGCCCGGCCTGGGAAGTGAAGG + Intergenic
990345255 5:54865185-54865207 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
990448391 5:55914067-55914089 CTGCTTGCCCTGGCCACTGTGGG + Intronic
991214937 5:64150188-64150210 CTGCCGGCCCCAGGCAGTGAGGG + Intergenic
991567574 5:68020654-68020676 CTGCCAGCCCCGGGCAATGAGGG - Intergenic
992018544 5:72599712-72599734 TTGACAGCCCTGGTCAGTAAGGG + Intergenic
992048855 5:72925600-72925622 CTGCTGGCCCTGGGCAGTGAGGG + Intergenic
992050353 5:72935347-72935369 CTGCCGGCCCCGGGCAGTGAGGG + Intergenic
992560583 5:77948784-77948806 CTACCTGCCATGGTCAGCAAGGG - Intergenic
992654464 5:78894823-78894845 GTGCATGCCCTGGTCAGAGGTGG - Intronic
993020380 5:82584539-82584561 CTGCCAGCCCTGGAGAGTCAGGG - Intergenic
993031862 5:82714798-82714820 CTGCCGGCCCCGGGCAGTGAGGG + Intergenic
993678604 5:90847726-90847748 CTGCCAGCCCCGGGCAGTGAGGG - Intronic
994096332 5:95851276-95851298 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
994509849 5:100689119-100689141 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
994570291 5:101506136-101506158 CCACCAGCCCTGGGCAGTGAGGG + Intergenic
994841385 5:104929112-104929134 TTGCCGGCCCTGGGCAATGAGGG + Intergenic
994928813 5:106154415-106154437 CCGCCCGCCCGGGGCAGTGAGGG + Intergenic
995388354 5:111612417-111612439 CGGCCAGCCCCGGGCAGTGAGGG - Intergenic
996234215 5:121107286-121107308 CTGCCGGCCCTGGGCAATGAGGG + Intergenic
996529310 5:124510933-124510955 CTGCTTCCCCTGGTCTGAGATGG + Intergenic
996530387 5:124521730-124521752 CTGCCGGCCCTGGGCAATGAGGG + Intergenic
997158205 5:131580285-131580307 CTGCCGGCCCTGGGCAGTAAGGG - Intronic
997641745 5:135452923-135452945 CTGGCTGCCCTGGAATGTGAAGG + Intergenic
999855291 5:155587003-155587025 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1000066028 5:157693947-157693969 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1000085856 5:157886956-157886978 CAGCCAGCCCTGGGCAGTGAGGG + Intergenic
1000212358 5:159119281-159119303 CTGCAAGCCCTGGGCAGTGAGGG + Intergenic
1000432362 5:161166359-161166381 CTGCCGGTCCCGGGCAGTGAAGG - Intergenic
1000609139 5:163355966-163355988 CCGCCGGCCCCGGGCAGTGAGGG + Intergenic
1001841536 5:174880777-174880799 CCGCCGGCCCCGGGCAGTGAGGG + Intergenic
1001843554 5:174901627-174901649 CCGCTGGCCCTGGGCAGTGAGGG + Intergenic
1002004642 5:176222276-176222298 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1002063764 5:176642132-176642154 CTGCCTGACCTGGATGGTGAGGG - Exonic
1002221735 5:177688344-177688366 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1002281079 5:178130602-178130624 CTGCCCGCCCTGCTCAGTGAGGG - Intergenic
1002451040 5:179318675-179318697 CCACCTGCCCTGGTCTGAGAAGG - Intronic
1002556554 5:180046195-180046217 GCACCTGCCCCGGTCAGTGAGGG - Intronic
1002817702 6:694734-694756 CCGCCGGCCCTGGGCAGTGAGGG + Intergenic
1003224474 6:4191549-4191571 CGGCTGGCCCTGGGCAGTGAGGG - Intergenic
1003589602 6:7425891-7425913 CCGCCGGCCCCGGGCAGTGAGGG + Intergenic
1003593712 6:7456469-7456491 CCGCCGGCCCGGGGCAGTGAGGG + Intergenic
1003671531 6:8164442-8164464 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1003770165 6:9290691-9290713 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1003881412 6:10482972-10482994 CTGCCGGCCCCAGGCAGTGAGGG - Intergenic
1003901587 6:10659995-10660017 CCGCCGGCCTTGGGCAGTGAGGG + Intergenic
1003908121 6:10720698-10720720 CGGCCGGCCCTGGGCAATGAGGG + Intergenic
1003947273 6:11087326-11087348 CTGCCGGCCCCGGGCAATGAAGG + Intergenic
1003956669 6:11171174-11171196 CTGCCAGCCCCGGGCAATGAGGG + Intergenic
1003982473 6:11402833-11402855 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1004036959 6:11933190-11933212 CTGCCGGCCCCGGGCATTGAGGG + Intergenic
1004369375 6:15038843-15038865 ATGCCTGCCCTGGTCTCTGCTGG + Intergenic
1004497782 6:16180976-16180998 CTGCCGTCCCTAGGCAGTGAGGG - Intergenic
1004503214 6:16227149-16227171 CTGCCAGCCCGGGGCAATGAGGG - Intergenic
1004861385 6:19807219-19807241 GTGCCGGCCCCGGGCAGTGAGGG - Intergenic
1004866062 6:19854678-19854700 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1004906209 6:20239172-20239194 CCGCCGGCCCCGGGCAGTGAGGG + Intergenic
1004914441 6:20319027-20319049 CTGCAAGCCCCGGGCAGTGAGGG + Intergenic
1005039517 6:21588453-21588475 CTGTCAGTTCTGGTCAGTGACGG + Intergenic
1005596220 6:27381319-27381341 CTGCCGGCCCCGGGCAATGAGGG - Intronic
1005611826 6:27533302-27533324 CTGCCTGCACTGCTCAGTAGAGG - Intergenic
1005707452 6:28469604-28469626 CTGCCGGCCCCGGACAATGAGGG - Intergenic
1005908739 6:30289102-30289124 CTGTCTGGCCTGGGCAGTGGAGG - Intergenic
1005977012 6:30807693-30807715 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1005978247 6:30816549-30816571 CTGCCAGCCCCAGGCAGTGAGGG - Intergenic
1006005765 6:31000574-31000596 CTGCCGGTCCTGGGCAATGAAGG + Intergenic
1006008296 6:31020829-31020851 CTGCAGGCCCCGGGCAGTGAGGG + Intronic
1006114646 6:31769007-31769029 ATGGCTGCCCTGGTAAGTGGGGG - Exonic
1006473199 6:34239597-34239619 CTGCCTGCCATGGTAAGGGGTGG - Intronic
1006517387 6:34552556-34552578 CTGCCTTCCCTGGCCTGTGCTGG - Intronic
1006748908 6:36364483-36364505 CTGCCAGCCCCGGGCAATGAGGG - Intronic
1007268966 6:40621096-40621118 CTGGCTGCTCTGGTCACTGTAGG + Intergenic
1007738731 6:43998208-43998230 CCACCGGCCCTGGGCAGTGAGGG + Intergenic
1008038776 6:46774708-46774730 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1008230893 6:48984053-48984075 CTGCCGGCCCTGGGCAGTGAGGG + Intergenic
1008254063 6:49275551-49275573 CTGCCGGCCCCGGGCAGTGAAGG + Intergenic
1008270500 6:49483668-49483690 CTGCCAGCCCTGGGCAATGAGGG - Intronic
1008284352 6:49629800-49629822 CTGCCGGCCCCGGGCAATGAGGG - Intronic
1008308353 6:49933787-49933809 CTGCTGGCCCCGGGCAGTGAGGG + Intergenic
1008844827 6:55950419-55950441 CCACCTGCCCTGGGCAGTGAGGG + Intergenic
1009407109 6:63326705-63326727 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1009471412 6:64031266-64031288 CCACCGGCCCTGGGCAGTGAGGG + Intronic
1009510801 6:64547932-64547954 CTGCTGGCACTGGGCAGTGAGGG - Intronic
1009746673 6:67825509-67825531 CTGCTAGCCCCGGGCAGTGAGGG + Intergenic
1010270364 6:73910097-73910119 CCACCGGCCCTGGGCAGTGAGGG + Intergenic
1010617377 6:78029912-78029934 CTGCCGGCCCCGGGCAGTGAGGG + Intergenic
1011129344 6:84037734-84037756 CCACCAGCCCTGGGCAGTGAGGG - Intronic
1011147113 6:84229809-84229831 CTGCATGCCTTGGTGAGTGGGGG - Intergenic
1011256118 6:85422958-85422980 CTCCCTGGCCAGGTCAGTGCTGG + Intergenic
1011410334 6:87060008-87060030 TGGCCAGCCCTGGGCAGTGAGGG - Intergenic
1011931797 6:92723610-92723632 CCGCCAGCCCCGGGCAGTGAGGG + Intergenic
1011974757 6:93282752-93282774 CTGCCAGCCCCGAGCAGTGAGGG + Intronic
1012426620 6:99121994-99122016 CTGGCTGCTCTGGTAACTGATGG + Intergenic
1012578224 6:100829440-100829462 CCGCCAGCCCTGGGCAATGAGGG - Intronic
1012760508 6:103294655-103294677 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1013025728 6:106269657-106269679 CTGCCGGCCCCGGGCAATGAGGG - Intronic
1013410785 6:109881394-109881416 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1014240735 6:119015433-119015455 CTGCGGGCCCCGGGCAGTGAGGG + Intronic
1014460260 6:121686662-121686684 CCGCCCACCCTGGTCAGTGAGGG - Intergenic
1014507754 6:122280690-122280712 CTGCCAGTCCTGGGCAATGAGGG + Intergenic
1014586290 6:123202060-123202082 CTGCCAGCCCTGAGCAATGAGGG + Intergenic
1015572260 6:134633796-134633818 CTGCCGGCCCCGGGCAGTGAGGG - Intergenic
1016067377 6:139698166-139698188 CTGCCGGCCCTGGGCAATGAGGG - Intergenic
1016172939 6:141041823-141041845 GGGCCGGCCCTGGGCAGTGAGGG - Intergenic
1016431247 6:143988600-143988622 ATGCCTGCCTTGGTCAGTTCAGG + Intronic
1017298976 6:152834453-152834475 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1017537363 6:155363178-155363200 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1017581229 6:155867006-155867028 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1018099815 6:160427406-160427428 CTGCCAACCCTGGACAGTGGGGG + Intronic
1019110855 6:169712447-169712469 CTCCCTGCTCTAGACAGTGATGG - Exonic
1019618361 7:1977367-1977389 TTGCCGGCCCCGGGCAGTGAGGG - Intronic
1019729910 7:2623974-2623996 CAGCCTGCCCGGCCCAGTGAGGG + Intergenic
1019944276 7:4314189-4314211 CTGCGGGCCCCGGGCAGTGAGGG - Intergenic
1019965760 7:4497181-4497203 CTGCGGGCCCCGGGCAGTGAGGG - Intergenic
1020083699 7:5299433-5299455 CTGCCTGCCCTGCCCGGTGTCGG + Intronic
1020662210 7:10995803-10995825 CTGCCAGCCCCGGGCAGTGAGGG - Intronic
1020694681 7:11398785-11398807 CAGCCAGCCCTGATCAGTGAGGG + Intronic
1021264447 7:18502364-18502386 CTGCCTTCCCAGCTCAGTCATGG - Intronic
1021587651 7:22226743-22226765 TTGCCTTGCCTGGACAGTGACGG - Intronic
1021748408 7:23768111-23768133 CTGCATGGTTTGGTCAGTGATGG + Intronic
1022750429 7:33219083-33219105 CTGCTGGCCCTGGGCAATGAGGG + Intronic
1023030539 7:36086882-36086904 CTGCCTGCATGGGGCAGTGATGG + Intergenic
1023495312 7:40788744-40788766 CAGCCTCCCCTGGGCAATGAGGG + Intronic
1023866565 7:44241225-44241247 CTGCCTGCTTTGGTCAGGGCTGG - Intronic
1024055436 7:45657416-45657438 GGGACTGCCCTGGTCAGGGAGGG + Intronic
1024691269 7:51805944-51805966 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1024700644 7:51901146-51901168 CTGCCGGCCCCGGGCAGTGAGGG - Intergenic
1024748214 7:52431492-52431514 CCGCAGGCCCTGGGCAGTGAGGG - Intergenic
1024794336 7:53004041-53004063 CTGCCGGCCCCGGGCAGTGAGGG + Intergenic
1024834038 7:53495130-53495152 CTGCCGGCCCTGGGCAATGAGGG + Intergenic
1025210578 7:57017751-57017773 CTGCCTGCCCTGCCCGGTGTCGG - Intergenic
1025661378 7:63559096-63559118 CTGCCTGCCCTGCCCGGTGTCGG + Intergenic
1025962080 7:66231591-66231613 CTGCCGGCCCCGGGCAATGAGGG - Intronic
1026202938 7:68231140-68231162 CTGCCGGCCCCGGGCAGTGAGGG + Intergenic
1026512333 7:71037703-71037725 CTGCCGGCCCAGGGCAATGAGGG + Intergenic
1027238015 7:76309688-76309710 CCGCCGGCCCCGGGCAGTGAGGG - Intergenic
1027579722 7:79977854-79977876 CTGCCGGCCCTGGGCAGTGAGGG - Intergenic
1027665885 7:81042817-81042839 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1027674462 7:81141847-81141869 CTGCCGGCCCTGGGCAATGAGGG + Intergenic
1027698294 7:81437340-81437362 CTGCTGGCCCTGGGCAGTGAGGG - Intergenic
1027868090 7:83673427-83673449 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1028070089 7:86440676-86440698 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1028303297 7:89228979-89229001 CCGCCGGCACTGGGCAGTGAGGG - Intronic
1028511228 7:91627644-91627666 CTGCAGGCCCTGGGCAATGAGGG - Intergenic
1028727169 7:94101001-94101023 CCGCTGGCCCTGGGCAGTGAGGG + Intergenic
1028857197 7:95605515-95605537 CTGCCAGCCCCGGGCAGTGAGGG + Intergenic
1028912979 7:96228816-96228838 CCGCCAGCCCTGGGCACTGAGGG + Intronic
1029037909 7:97541319-97541341 CCGCCAGCCCCGGGCAGTGAGGG + Intergenic
1029407082 7:100381828-100381850 CGGCCGGCCCCGGGCAGTGAGGG + Intronic
1029641210 7:101821174-101821196 CTACATGCTCTGGTCAGTCAAGG - Intronic
1030599989 7:111582194-111582216 CTGCCGGCCCGGGGCAATGAGGG - Intergenic
1030819320 7:114077094-114077116 CTGCCGGCCCGGGGCAATGAGGG - Intergenic
1031056540 7:116998249-116998271 CTGCCGGCCCAGGGCAGTGAGGG - Intronic
1031845754 7:126804420-126804442 CTGCCTGACCTGGCCAATTATGG - Intronic
1031902857 7:127429279-127429301 CTGCTGGCCCTGGGCAGTGAGGG + Intronic
1032129079 7:129214301-129214323 CTTCCTCCCCTGGCCAGTCAGGG + Intergenic
1032362709 7:131271198-131271220 CTGCCTACCTAGGTCAGGGAAGG + Intronic
1032437111 7:131909436-131909458 CTGCCGGCCCCGGGCAGTGAGGG + Intergenic
1032561613 7:132898858-132898880 CTGCCGGCCCCGGGCAATGAGGG - Intronic
1032737995 7:134710680-134710702 CTGCCTGCCCTGCTCTGTAGGGG + Intergenic
1033664111 7:143424648-143424670 CTGCCGGCCCCAGGCAGTGAGGG - Intergenic
1034097903 7:148426517-148426539 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1034274038 7:149816310-149816332 CTCCCTGAGGTGGTCAGTGAGGG + Intergenic
1034413992 7:150955526-150955548 CTGCCTGCCCTGGGGCCTGAGGG + Intronic
1034900570 7:154905791-154905813 CTGTCTGCTCTGCTCAGTGCTGG - Intergenic
1035309482 7:157956195-157956217 CTGCATGCCCAGGGCTGTGAGGG + Intronic
1035463910 7:159063391-159063413 CTGCCGGCCCCGGGCAGTGAGGG - Intronic
1035999234 8:4582936-4582958 CTGCCGGCCCTGAGCAATGAGGG + Intronic
1036391144 8:8325235-8325257 GTGCCTGGCCTGGTCATTGGGGG - Intronic
1036441041 8:8781643-8781665 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1036831354 8:12022757-12022779 CTACCGGCCCCGGACAGTGAGGG + Intergenic
1036914969 8:12796404-12796426 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1036928660 8:12931556-12931578 CTGCCGGCCCCGGGCAGTGAGGG - Intergenic
1036952525 8:13154449-13154471 CCGCCGGCCCTGGGCAGTAAGGG - Intronic
1037263851 8:17037069-17037091 CTGCTGGCCCCGGGCAGTGAGGG - Intronic
1037776538 8:21839272-21839294 GTGGCTGCCCCGGTCAGGGAGGG - Intergenic
1037957563 8:23071037-23071059 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1037983518 8:23272225-23272247 CTGCTGGCCCTGGGCAATGAGGG + Intronic
1038847604 8:31244358-31244380 CGACCGGCCCTGGGCAGTGAGGG - Intergenic
1039284857 8:36028935-36028957 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1039400705 8:37266467-37266489 CTGCCTCCCTGGGTCAGAGAAGG - Intergenic
1039958230 8:42223500-42223522 CTGCCTGCCATGGCAAGGGAGGG - Intergenic
1040341501 8:46443452-46443474 CAGCCTGCCCGGGTCAGCCATGG + Intergenic
1040806845 8:51405058-51405080 CTGCCGGCCCCAGGCAGTGAGGG - Intronic
1040964596 8:53071389-53071411 CTGCCAGCCCCAGGCAGTGAGGG - Intergenic
1041034666 8:53776150-53776172 CTGCTGGCCCTGGGCAATGACGG - Intronic
1041914519 8:63126218-63126240 CTGCCAGCCCTGGGCAATGAGGG + Intergenic
1042169494 8:65978043-65978065 CCACCAGCCCTGGTCAGTGAGGG - Intergenic
1042681023 8:71384425-71384447 TGGCCTGCACTGGTCAGAGAAGG - Intergenic
1043073357 8:75665716-75665738 CTGCCGGCCCTGGGCAATGAGGG - Intergenic
1043129946 8:76447865-76447887 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1043346453 8:79303603-79303625 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1043435314 8:80231917-80231939 CTGCCGGCCCCGGGCAGTGAGGG + Intergenic
1043726006 8:83611411-83611433 CCACCAGCCCTGGGCAGTGAGGG - Intergenic
1043928888 8:86068734-86068756 CTGCCAGACCTGGTGTGTGAAGG - Intronic
1044404888 8:91816472-91816494 CCACCAGCCCTGGGCAGTGAGGG + Intergenic
1044441637 8:92230884-92230906 CTGCCAGACCCGGGCAGTGAGGG + Intergenic
1044633484 8:94300585-94300607 CTGCCAGCCCCGGGCAATGAGGG - Intergenic
1044788674 8:95823747-95823769 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1044862158 8:96534061-96534083 CCGCCGGCCCCGGGCAGTGAGGG - Intronic
1045096206 8:98800696-98800718 CCGCCAGCCCTGGGCAGTGAAGG + Intronic
1045743344 8:105387538-105387560 CCGCCCGCCCTAGGCAGTGAGGG - Intronic
1046208900 8:111041089-111041111 CTGCCAGCCCCGGGCAGTGAGGG - Intergenic
1046288894 8:112132800-112132822 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1048757510 8:137755372-137755394 CTGCCAGCCCCGGGCAATGAGGG - Intergenic
1048789164 8:138084244-138084266 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1049041230 8:140113420-140113442 CATCCTGCCATGGTAAGTGATGG - Intronic
1049157700 8:141076796-141076818 CTGCCGGCCCTGGGCAGTGAGGG + Intergenic
1049258286 8:141625366-141625388 CGGGCTGCCCTGGTGAGTCAGGG + Intergenic
1049500303 8:142959585-142959607 CTGCCGGCCCTGGGCAGTGAGGG + Intergenic
1049704422 8:144034136-144034158 CTGCCTTCCCTGGCCAATGCTGG - Intronic
1049857930 8:144875278-144875300 CTGCAAGCCCTGGGCAGTGAGGG + Intergenic
1051305100 9:15700293-15700315 CTGCCAGCCCCGGGCAATGAGGG - Intronic
1051425103 9:16924674-16924696 CTGCTGGCTCTGGGCAGTGAGGG - Intergenic
1051580659 9:18670242-18670264 CAACCTGCCCTGGACAGTGTGGG - Intronic
1052258530 9:26488232-26488254 CTTCCTGCCTTTGTCTGTGAAGG + Intergenic
1052932633 9:34068167-34068189 ATACCTGCCATGGTCACTGATGG - Intergenic
1053027296 9:34740488-34740510 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1053104660 9:35399378-35399400 CTGGGTGCCCTGGGCAGAGAGGG - Exonic
1054722439 9:68617132-68617154 CTGCCAGCCCTGGGCAATGAGGG + Intergenic
1054871392 9:70049916-70049938 CTGCCTGACTTGGTCTGTGTAGG - Intronic
1056080972 9:83093549-83093571 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1056743738 9:89282534-89282556 CTGCCGGCCCTGGGCAATGAGGG + Intergenic
1057075057 9:92134284-92134306 CTTCTTGCCCTGGGCAGAGAAGG + Intergenic
1057494055 9:95545992-95546014 CTGCCTGCCCACGTGTGTGAGGG + Intergenic
1058174879 9:101724367-101724389 CTGCCGGCCCTGGGCAATGAGGG - Intronic
1058428210 9:104894706-104894728 CTGTATGCTCTGGTAAGTGAAGG - Intronic
1058727516 9:107817902-107817924 CTGCCAGCCCCGGGAAGTGAGGG + Intergenic
1060091347 9:120746496-120746518 CTGCCGGCCCCAGGCAGTGAGGG + Intergenic
1060759419 9:126235182-126235204 TTGCCTGCCCTGGTCAGGGCAGG + Intergenic
1061370164 9:130193435-130193457 CAGCCAGCCCTGGACAGTGGGGG + Intronic
1061799559 9:133106515-133106537 CTGCCAACTCAGGTCAGTGAAGG + Intronic
1061883052 9:133577605-133577627 GTGCCTTCCCTGGGCAGAGAGGG + Intergenic
1062058828 9:134483628-134483650 CTGCCTGCCCTGCTGAGGGACGG + Intergenic
1062315872 9:135966800-135966822 CTGCCTGAACTGGTCAGAGCTGG - Intergenic
1062464845 9:136676397-136676419 CTGCCCTCCCTGGTCGGTCAGGG + Intronic
1203460435 Un_GL000220v1:31238-31260 CTGCCAGCCCCAGGCAGTGAGGG - Intergenic
1185503942 X:618835-618857 CTGTCTGCACTGGTCACTCAGGG - Intergenic
1186152607 X:6690759-6690781 CTGCCGGCCCCGGGCAGTGAGGG - Intergenic
1186295650 X:8145182-8145204 CCGCCAGCCCGGGGCAGTGAGGG - Intergenic
1187067323 X:15854293-15854315 CTCCCGGGCTTGGTCAGTGATGG - Intronic
1188189517 X:27157112-27157134 CTGCCGGCCCCAGGCAGTGAGGG + Intergenic
1189467129 X:41285961-41285983 CTGCCAGCCCCGGGCAGTGAGGG - Intergenic
1189896848 X:45665030-45665052 CTGCCTGCCCCAGGCAGTGAGGG - Intergenic
1190045882 X:47111256-47111278 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1191105075 X:56767600-56767622 CTGCCTGCCCAGGGCAGTGAGGG + Intergenic
1192330938 X:70174744-70174766 CTGCCTGCCCTGGGAGGTGAGGG - Intergenic
1192869670 X:75173850-75173872 CTGCCAGCCCCGGGCAATGAGGG - Intergenic
1192870577 X:75179770-75179792 CTGCCAGCCCCGGGCAATGAGGG - Intergenic
1193271057 X:79530688-79530710 CTGCCGGCCCCAGGCAGTGAGGG + Intergenic
1193538169 X:82738456-82738478 CTGCCGGCCCTGGGCAATGAGGG - Intergenic
1193804055 X:85972610-85972632 CTGCCGGCCCCGGGCAGTGAGGG - Intronic
1194025595 X:88746580-88746602 CTGCAAGCCCCGGGCAGTGAGGG - Intergenic
1194173493 X:90618009-90618031 CCGCCAGCCCTGGGCAGTGAGGG - Intergenic
1194384373 X:93235839-93235861 CCGCTGGCCCTGGGCAGTGAGGG + Intergenic
1194901840 X:99521190-99521212 TTGTCTGCACTGGTGAGTGAGGG - Intergenic
1196582684 X:117394789-117394811 CTGTCGGCCCTGGGCAATGAGGG + Intergenic
1196705925 X:118717189-118717211 CAGCCGGCCCCGGGCAGTGAGGG - Intergenic
1196761986 X:119208725-119208747 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1196793991 X:119488116-119488138 CTGCCGGCCCTGGGGAATGAGGG - Intergenic
1196827288 X:119751081-119751103 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1196845048 X:119890699-119890721 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1197000302 X:121431781-121431803 CTGCCGGCCCCGGGCAATGAGGG - Intergenic
1197344839 X:125319315-125319337 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1197607915 X:128606712-128606734 CCGCCAGCCCTGGACAGTGAGGG + Intergenic
1197978745 X:132194194-132194216 CTGCCGGCCCCAGGCAGTGAGGG + Intergenic
1198060905 X:133044485-133044507 CTGCCGGCCCCAGGCAGTGAGGG + Intronic
1198299973 X:135325562-135325584 CTGCCGGCCCCGGGCAATGAGGG + Intronic
1198468103 X:136921517-136921539 CCGCCGGCCCGGGGCAGTGAGGG + Intergenic
1198694435 X:139320910-139320932 CTGCCAGCCCCGGGCAATGAGGG + Intergenic
1199356261 X:146867135-146867157 CTGCCGGCCCCGGGCAGTGAGGG - Intergenic
1199467771 X:148158801-148158823 CTGCTTTCACTGGTCAGTTAAGG - Intergenic
1199628105 X:149758676-149758698 CCCCCTGCCCGGGGCAGTGAGGG + Intergenic
1200330646 X:155293062-155293084 CTCCCTGCTCTAGACAGTGACGG + Intronic
1200519714 Y:4195701-4195723 CAACCAGCCCTGGGCAGTGAGGG - Intergenic
1201488149 Y:14512922-14512944 CTGCCGGCCCCGGGCAATGAGGG + Intergenic
1201573021 Y:15433952-15433974 CTGCTGGCCCCGGGCAGTGAGGG + Intergenic
1202271505 Y:23078592-23078614 CTGCCAGCCCCAGGCAGTGAGGG - Intergenic
1202294521 Y:23342090-23342112 CTGCCAGCCCCAGGCAGTGAGGG + Intergenic
1202424500 Y:24712336-24712358 CTGCCAGCCCCAGGCAGTGAGGG - Intergenic
1202446289 Y:24957749-24957771 CTGCCAGCCCCAGGCAGTGAGGG + Intergenic