ID: 1084377950

View in Genome Browser
Species Human (GRCh38)
Location 11:68791297-68791319
Sequence GCCTGCCCTGGTCAGTGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 232}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084377942_1084377950 4 Left 1084377942 11:68791270-68791292 CCTGACCCACTTCCCTTTGGGGA 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1084377950 11:68791297-68791319 GCCTGCCCTGGTCAGTGAAGGGG 0: 1
1: 0
2: 2
3: 18
4: 232
1084377940_1084377950 5 Left 1084377940 11:68791269-68791291 CCCTGACCCACTTCCCTTTGGGG 0: 1
1: 0
2: 2
3: 29
4: 195
Right 1084377950 11:68791297-68791319 GCCTGCCCTGGTCAGTGAAGGGG 0: 1
1: 0
2: 2
3: 18
4: 232
1084377937_1084377950 13 Left 1084377937 11:68791261-68791283 CCAGGACACCCTGACCCACTTCC 0: 1
1: 0
2: 1
3: 35
4: 296
Right 1084377950 11:68791297-68791319 GCCTGCCCTGGTCAGTGAAGGGG 0: 1
1: 0
2: 2
3: 18
4: 232
1084377935_1084377950 15 Left 1084377935 11:68791259-68791281 CCCCAGGACACCCTGACCCACTT 0: 1
1: 0
2: 3
3: 20
4: 223
Right 1084377950 11:68791297-68791319 GCCTGCCCTGGTCAGTGAAGGGG 0: 1
1: 0
2: 2
3: 18
4: 232
1084377943_1084377950 -1 Left 1084377943 11:68791275-68791297 CCCACTTCCCTTTGGGGACACTG 0: 1
1: 0
2: 3
3: 19
4: 197
Right 1084377950 11:68791297-68791319 GCCTGCCCTGGTCAGTGAAGGGG 0: 1
1: 0
2: 2
3: 18
4: 232
1084377946_1084377950 -9 Left 1084377946 11:68791283-68791305 CCTTTGGGGACACTGCCTGCCCT 0: 1
1: 0
2: 2
3: 28
4: 254
Right 1084377950 11:68791297-68791319 GCCTGCCCTGGTCAGTGAAGGGG 0: 1
1: 0
2: 2
3: 18
4: 232
1084377936_1084377950 14 Left 1084377936 11:68791260-68791282 CCCAGGACACCCTGACCCACTTC 0: 1
1: 0
2: 2
3: 28
4: 232
Right 1084377950 11:68791297-68791319 GCCTGCCCTGGTCAGTGAAGGGG 0: 1
1: 0
2: 2
3: 18
4: 232
1084377944_1084377950 -2 Left 1084377944 11:68791276-68791298 CCACTTCCCTTTGGGGACACTGC 0: 1
1: 0
2: 1
3: 19
4: 250
Right 1084377950 11:68791297-68791319 GCCTGCCCTGGTCAGTGAAGGGG 0: 1
1: 0
2: 2
3: 18
4: 232
1084377945_1084377950 -8 Left 1084377945 11:68791282-68791304 CCCTTTGGGGACACTGCCTGCCC 0: 1
1: 0
2: 2
3: 23
4: 601
Right 1084377950 11:68791297-68791319 GCCTGCCCTGGTCAGTGAAGGGG 0: 1
1: 0
2: 2
3: 18
4: 232
1084377934_1084377950 18 Left 1084377934 11:68791256-68791278 CCTCCCCAGGACACCCTGACCCA 0: 1
1: 0
2: 3
3: 53
4: 478
Right 1084377950 11:68791297-68791319 GCCTGCCCTGGTCAGTGAAGGGG 0: 1
1: 0
2: 2
3: 18
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084377950 Original CRISPR GCCTGCCCTGGTCAGTGAAG GGG Intronic
900115956 1:1027999-1028021 GCCTCCCCTGGGGAGAGAAGGGG - Intronic
900657048 1:3763551-3763573 GCCTGCTCTGGTCAGTGAGCTGG + Intronic
901069123 1:6508491-6508513 GCCCCCCCAGGCCAGTGAAGCGG + Intronic
901647644 1:10725194-10725216 GGCTGCCCTGGGCAGTGACATGG - Intronic
901686098 1:10944406-10944428 GTCTGCCCTGGTCACAGAAATGG + Intergenic
902190419 1:14759036-14759058 GGCTACCCTGGACAATGAAGGGG + Intronic
903361465 1:22779865-22779887 GCCTGCCCTGGGCACAGAATTGG + Intronic
903578075 1:24351512-24351534 GCCTGCCCTTTGCCGTGAAGTGG - Intronic
903685757 1:25130754-25130776 CCCTGCCCTGGTCAGGGAAATGG + Intergenic
903741107 1:25559229-25559251 GCCTGCCCTGGTCAGCGGGCAGG - Intronic
904294978 1:29514279-29514301 TGGTGCCCTGGTCAGTCAAGAGG - Intergenic
904485180 1:30820056-30820078 CCCTGACCTTGTCAGTGGAGGGG - Intergenic
904607055 1:31703855-31703877 GCCTGGACTGCTCAGTGAGGTGG - Exonic
910929166 1:92425642-92425664 GCCTGCCCTGGGCAGAGAAGAGG + Intergenic
912703534 1:111895702-111895724 GCCTGCCGTGGGGAGTGGAGGGG + Intronic
914847693 1:151291971-151291993 GCCCGCCCTTCTCAGGGAAGAGG + Exonic
915364855 1:155309362-155309384 GTCTCCCCTGGGCAGTGGAGAGG - Intronic
917985377 1:180311727-180311749 GTCTTCCCAGGTCAGTGATGTGG - Intronic
919896492 1:202012629-202012651 GGCTGCCCTGGTCTGGGAAGAGG - Exonic
1062788202 10:282823-282845 GTCTGCCCCTGTCAGGGAAGAGG - Intronic
1067415349 10:46098006-46098028 TCCTGCACTGGTCAGGGCAGGGG + Intergenic
1067453756 10:46398335-46398357 GCGTTCCCTGGACAGAGAAGCGG + Intergenic
1067512700 10:46908971-46908993 GCCTGCACTGGGGAGTGAGGAGG + Intergenic
1067583471 10:47461411-47461433 GCGTTCCCTGGACAGAGAAGCGG - Intronic
1067633475 10:47986759-47986781 GCGTTCCCTGGACAGAGAAGCGG - Intergenic
1067649545 10:48142851-48142873 GCCTGCACTGGGGAGTGAGGAGG - Intergenic
1067756607 10:49010490-49010512 GCCAGCCCTGGTCAGGGAGTGGG - Intergenic
1070309475 10:75262867-75262889 GCCTGCCCTGGCCAGGGAGGAGG + Intergenic
1070713002 10:78696988-78697010 TCCTGCACTGGTCAGGGATGAGG - Intergenic
1070931025 10:80260646-80260668 GCCTGCCCTGTTCAGAGAGATGG + Intergenic
1073255272 10:102146919-102146941 GCCTGCCCTAGTCATTCCAGAGG + Exonic
1075404329 10:122184334-122184356 GTCTTCCCTGGCCAGTGCAGAGG + Intronic
1075499984 10:122964694-122964716 GCCTCCCCTGCCCAGGGAAGTGG + Intronic
1075707726 10:124511844-124511866 GCGTGCCCTGGTGAGTGGTGGGG + Intronic
1075875685 10:125803881-125803903 GCCTGCCCTTCTCTGTGGAGAGG + Intronic
1076625991 10:131822361-131822383 GCAGGCCTTGGTCAGAGAAGGGG + Intergenic
1077853384 11:6097054-6097076 GCCTGCCATGGTGAGTGATGGGG - Intergenic
1079097542 11:17520617-17520639 GCCTGCCCATGTCAGTGTTGTGG + Intronic
1079186863 11:18245843-18245865 GCCTGCCTTGGACAGTCAGGAGG - Intronic
1079189983 11:18269378-18269400 GCCTGCCTTGGACAGTCAGGAGG + Intronic
1083075693 11:60034773-60034795 GGGTGCCCTGGTCAGAGAATGGG + Intergenic
1084241231 11:67821900-67821922 GCCTTCCCTGGTGTGTGCAGTGG + Intergenic
1084377950 11:68791297-68791319 GCCTGCCCTGGTCAGTGAAGGGG + Intronic
1084787410 11:71451046-71451068 GCCAGGCCTGGGCAGAGAAGGGG - Intronic
1084831215 11:71770733-71770755 GCCTTCCCTGGTGTGTGCAGTGG - Intergenic
1085255363 11:75169552-75169574 GTCTCCCCTGGTCAGGGATGGGG - Intronic
1086215301 11:84371896-84371918 GACTGCCCTTTTCCGTGAAGTGG - Intronic
1087761996 11:102111245-102111267 GCCAGCTCTGGTCAGGGGAGGGG + Intronic
1088683619 11:112266562-112266584 GCCTACCGTGGTCAGTGGACTGG + Intronic
1089011012 11:115131785-115131807 TGCTGCCCTGGGCAGAGAAGAGG - Intergenic
1089891872 11:121889609-121889631 GCCTGCCCAGGTCAATGAGAGGG + Intergenic
1090351221 11:126109879-126109901 GCCTTCCATGCTCAGTGCAGAGG + Intergenic
1091093221 11:132792718-132792740 CGCGGCCCTGGTGAGTGAAGTGG + Intronic
1091615449 12:2047700-2047722 GCCAGCTTTGGTCAGGGAAGTGG + Intronic
1095831448 12:46591367-46591389 GGATGCCCTGACCAGTGAAGAGG + Intergenic
1096266933 12:50131017-50131039 GCCTTCCCTGTTCTTTGAAGTGG - Intronic
1096504349 12:52083109-52083131 GCATGTCCTGGGCACTGAAGTGG + Intergenic
1099007938 12:77257300-77257322 GCCTTCCCAGGTCTGTGATGTGG + Intergenic
1100817833 12:98403008-98403030 GGCTGCCCCGTGCAGTGAAGGGG + Intergenic
1101131950 12:101698336-101698358 GCCTCCCCTGGGCAGCGGAGGGG + Intronic
1103733428 12:123043443-123043465 CGCTGGCCTGGGCAGTGAAGAGG + Intronic
1104053516 12:125212032-125212054 GGCTGCCATGGTCCCTGAAGAGG - Intronic
1104477404 12:129082010-129082032 GCCTGCCGGGGACAGTGAAGAGG - Exonic
1104963501 12:132498971-132498993 GCCTGCCGTGGTGAGAGCAGAGG - Intronic
1105718272 13:23088936-23088958 TCCTGCCCTGATCTGTTAAGGGG - Intergenic
1107697836 13:43018104-43018126 GCCTGGTCTGGTCAGAAAAGAGG - Intergenic
1113335480 13:109372500-109372522 AGCTCCCCAGGTCAGTGAAGAGG + Intergenic
1113693462 13:112328215-112328237 AGCTGCCATGGTCATTGAAGAGG + Intergenic
1115176655 14:30569664-30569686 GCCTGACTTGGTCAGTGGAAGGG + Intronic
1116159852 14:41254067-41254089 GCCTGCCAAGGGCAGAGAAGAGG + Intergenic
1116661824 14:47719896-47719918 GCCTGCCTTGGTCACTGATGTGG - Intergenic
1117105468 14:52393867-52393889 GCATGCCCAGGTCAGTGCAGGGG - Intergenic
1117932172 14:60855003-60855025 ATATGCCCTGCTCAGTGAAGAGG + Intronic
1118383218 14:65234719-65234741 TCCTGACCTTGCCAGTGAAGTGG - Intergenic
1119264225 14:73254653-73254675 GCCAGGCCTGGTCACTGAGGAGG - Exonic
1122088356 14:99322295-99322317 GCCTTCTATGGTCAGTGATGGGG - Intergenic
1122199048 14:100110986-100111008 GCCTGCCATGGTCAGCACAGTGG + Intronic
1122750147 14:103927490-103927512 TCCTGCCCTGGCCAGTGAGGGGG + Intronic
1202899829 14_GL000194v1_random:28571-28593 GCCTGCCCAGGTCTGTGTTGAGG - Intergenic
1128688207 15:69702928-69702950 GCCTCACCTGGTTATTGAAGAGG - Intergenic
1129229156 15:74187133-74187155 GCCTGGCCTGGTGAGTGTACAGG + Intronic
1131713357 15:95080249-95080271 GCATGCTCAGGTCAGTCAAGAGG - Intergenic
1132467607 16:84683-84705 GCCTGGCCTGGTGAGGGAGGGGG + Intronic
1133333616 16:4991909-4991931 GCCTGCCCCAGTCCGTGAGGAGG + Exonic
1133352717 16:5112833-5112855 GCCTTCCCTGGTGTGTGCAGTGG + Intergenic
1138428168 16:56950375-56950397 GCCTGGCCTGGTCCCTGGAGTGG - Intergenic
1138457655 16:57130710-57130732 CCCAGCCATGGTCAGTGAAACGG - Intronic
1139877719 16:70159755-70159777 GCCTCCCCTGTTCACTCAAGAGG - Exonic
1141659635 16:85435124-85435146 GCCTGACCTGGACAGGGAATCGG - Intergenic
1142670126 17:1484285-1484307 GCAGGCCCTGGGCAGTGACGGGG - Exonic
1143631979 17:8144802-8144824 GCCTGCCCAGGTCTCGGAAGCGG + Exonic
1143760137 17:9096315-9096337 GACTGGCCTGGTCACTGAATAGG + Intronic
1144610641 17:16710717-16710739 GCCTGCCCTAATCAATGTAGAGG - Intronic
1147768528 17:42852306-42852328 GACTTCCCTGGACACTGAAGCGG - Exonic
1147771117 17:42868238-42868260 GACTTCCCTGGACACTGAAGCGG - Intergenic
1150002619 17:61451466-61451488 GCCTGCCCTAGTCTAGGAAGTGG - Intergenic
1151553292 17:74834268-74834290 CCCAACCCTGGTCAGTCAAGCGG - Intronic
1152544223 17:80992523-80992545 GTCTGCCCTGGTCCGAGGAGCGG + Intronic
1152811554 17:82385060-82385082 ACCTGCCCTTGTGAGTGATGAGG - Intergenic
1153812857 18:8766924-8766946 GCCAGCCCTGGTCTTTGAGGTGG - Intronic
1154486860 18:14878996-14879018 GCCTGCCCAGGTCTGTGCTGAGG - Intergenic
1154499068 18:14985455-14985477 GCCTCCCCAGGTCTGTGCAGAGG + Intergenic
1155025121 18:21934328-21934350 GGCTGTGCTGGTCAGTTAAGTGG + Intergenic
1155160493 18:23191482-23191504 GCCTTCTCTGGTCTGTGAAATGG + Intronic
1155173034 18:23281106-23281128 GGCTGCCTAGGTCAGTGGAGGGG + Intronic
1156582392 18:38393008-38393030 AGATGCCCTGGTCAGTGAGGAGG - Intergenic
1157681214 18:49608539-49608561 GCCTGGCCTGGACACTGCAGAGG + Intergenic
1160811146 19:1013450-1013472 CCCTGGCCTGGTCAGTGGTGGGG - Intronic
1161049382 19:2154646-2154668 TCCTGCCTTGGGCAGTGAAAAGG - Intronic
1161418180 19:4159649-4159671 ACCTGCCCTGGTCAGAAATGTGG + Exonic
1162852519 19:13441761-13441783 CCCTGCCCTGGTGAGAGGAGAGG + Intronic
1163144195 19:15369723-15369745 GCCTGCCCTGGGCTGTGCTGTGG - Intronic
1163317707 19:16552921-16552943 CCCTGCTCTGGTGAGGGAAGAGG + Exonic
1163345390 19:16738241-16738263 CCCTGTCCTGGACAGTAAAGAGG + Intronic
1164433921 19:28211803-28211825 CCCTGCCTTGGACAGTGGAGTGG + Intergenic
1165142025 19:33705348-33705370 GCCTGACCTGAACAGTGAACAGG - Intronic
1165154214 19:33777550-33777572 GCGTGCCCTGGGCAGTGAGAAGG - Intergenic
1165811880 19:38616830-38616852 GGCTGCTCTGGTCAGAAAAGTGG + Intronic
1165946839 19:39448582-39448604 GCCTCACCTGGTAACTGAAGAGG - Intronic
1167823290 19:51949343-51949365 GCCTGTGGGGGTCAGTGAAGGGG + Intergenic
925314979 2:2914585-2914607 GCCTGCCCATGTCAGTTAACTGG - Intergenic
927135382 2:20092962-20092984 GCCTGCCTGGCTCAGTGATGGGG - Intergenic
927277413 2:21273653-21273675 GTCTGCCCTGCTCTGTGCAGAGG - Intergenic
928224125 2:29432834-29432856 GTCTTCACTGCTCAGTGAAGTGG + Intronic
935341923 2:102066161-102066183 GGCTGCACTGGACAGAGAAGAGG - Intronic
936088292 2:109484482-109484504 GCCTGGGCTGGTGAGTGATGTGG - Intronic
937268744 2:120633631-120633653 CCCTGCCATGGGCAGGGAAGGGG - Intergenic
937365840 2:121260692-121260714 GCCTGCTCTGGGCAGTGCTGTGG - Intronic
938498033 2:131813541-131813563 GCCTCCCCGGGTCTGTGCAGAGG + Intergenic
938962524 2:136356185-136356207 GCCTGCCCTGGGCACAGGAGAGG + Intergenic
939499835 2:142969915-142969937 GCCTTCCTTGGTTAGTCAAGAGG - Intronic
945995487 2:216432605-216432627 GCCCGGGCTGGCCAGTGAAGTGG + Intronic
946049278 2:216848483-216848505 ACATGACCTGGTCAGTGGAGGGG + Intergenic
946093562 2:217251975-217251997 ACCAGCCCTGGTCAGAGATGTGG + Intergenic
948711605 2:239828851-239828873 GCCAGACCTGGGCAGGGAAGGGG + Intergenic
1171459122 20:25288673-25288695 GCCTGCCCAGCTCACTGGAGGGG + Intronic
1175307968 20:57991010-57991032 GGCTGCCCTGGTGGGTGCAGTGG - Intergenic
1175568530 20:60000394-60000416 GCCTGGCCAGGGCAGTGAGGAGG + Intronic
1176019389 20:62954725-62954747 ACCTGCCCAGCTCAGAGAAGGGG + Intronic
1176128249 20:63485469-63485491 GCCTGCCATGGTCTGTGCTGGGG - Intergenic
1176238616 20:64065673-64065695 GCCTGGCCTCGTCAGTGTTGAGG + Intronic
1176261297 20:64182268-64182290 GCCTGCCCTCTCCAGGGAAGTGG + Intronic
1176619203 21:9043345-9043367 GCCTGCCCAGGTCTGTGTTGAGG - Intergenic
1178753545 21:35326429-35326451 CCCTGCCATGGTGAGTGGAGAGG - Intronic
1179660727 21:42873158-42873180 GCCTGCCCTGGAGAGTGATAGGG - Intronic
1179874202 21:44259402-44259424 GCCTGCCCAGGGGGGTGAAGGGG - Intronic
1179995636 21:44972807-44972829 GCCTGCCCTGGCCAGGCAGGTGG + Intronic
1180716941 22:17878235-17878257 CACTGCCCTGCTCAGTGAAAAGG + Intronic
1180967695 22:19799140-19799162 GGCAGCCCTGGTCTGGGAAGTGG - Intronic
1181080062 22:20407997-20408019 CCCAGCCCTGGTCAGTGAAGAGG - Exonic
1181917958 22:26296017-26296039 GCCTGCCCTGTTTAGAGGAGAGG + Intronic
1182494323 22:30695360-30695382 GCCTGTCCTGGTCGCAGAAGAGG - Exonic
1182599325 22:31448146-31448168 GCCTGACCTGGGCTGTGATGGGG + Exonic
1183243266 22:36674075-36674097 GTCAGCCCTGGCCATTGAAGAGG + Intronic
1183732982 22:39628762-39628784 GACTGGCCAGGTCAGTAAAGGGG - Intronic
1184088903 22:42282372-42282394 GCCTGCCCTGGGCCAGGAAGCGG - Intronic
1184405524 22:44298535-44298557 CACTGCCCAGGTCAGTGAGGAGG + Intronic
1184985911 22:48134031-48134053 GGCAGCCCTGGTCCCTGAAGTGG + Intergenic
950287028 3:11753136-11753158 GGCTGCCCTGGCCAGCGCAGTGG + Intergenic
950465813 3:13153119-13153141 GCCTGGCCTGGACACTGGAGGGG - Intergenic
952179258 3:30900852-30900874 GGCTTCCCTGGGCAGTAAAGTGG + Intergenic
953481752 3:43258049-43258071 GCAGGCCCTGCTCACTGAAGTGG + Intergenic
957056699 3:75448806-75448828 GCCTTCCCTGGTGTGTGCAGTGG + Intergenic
957074082 3:75587908-75587930 GCCGGCCCCGGGCAGTGAGGGGG + Intergenic
957131269 3:76224882-76224904 GACTTTCCTGGTCAGGGAAGGGG - Intronic
960462645 3:117955471-117955493 GCCTGACCTGGTGAGTGCAGTGG + Intergenic
961358638 3:126354245-126354267 GCCTGCCCTGGTCACTGAGCAGG - Intronic
961534215 3:127559648-127559670 GCCAGCCCTGGTCAGAGCATTGG + Intergenic
963054990 3:141179084-141179106 CCCTGGCCTGGCCAGGGAAGTGG - Intergenic
965637763 3:170801724-170801746 CTCTGCCCTGGACACTGAAGAGG + Intronic
966152033 3:176875756-176875778 GCCTCCCCTGCCCAGGGAAGTGG - Intergenic
966652340 3:182315340-182315362 GGATGCCCTGCACAGTGAAGAGG + Intergenic
966753109 3:183341293-183341315 GACTTCTCTGGTCACTGAAGAGG - Intronic
968565262 4:1309356-1309378 GCCAGCCCAGGCCAGTGGAGGGG + Intronic
968999519 4:3969090-3969112 GCCTTCCCTGGTGTGTGCAGTGG + Intergenic
969754486 4:9139543-9139565 GCCTTCCCTGGTGTGTGCAGTGG - Intergenic
970555340 4:17225883-17225905 ACCTCCCCTGCTCAGGGAAGTGG - Intergenic
971043360 4:22778845-22778867 GCCAGCCCTGGGCAGTGAGGAGG - Intergenic
971487314 4:27173343-27173365 GCCTGCGAGGGTCAGGGAAGGGG + Intergenic
978254893 4:106681705-106681727 GCCGGCCCCGGGCAGTGAGGAGG - Intergenic
982122943 4:152159772-152159794 CCCTGCCCGGGTCAATTAAGGGG - Intergenic
986110385 5:4710093-4710115 GGCTGCCCTGCCCAGTGAGGAGG - Intergenic
988547858 5:32174540-32174562 TCCAGCCCTGGGTAGTGAAGGGG - Intergenic
992654462 5:78894821-78894843 GCATGCCCTGGTCAGAGGTGGGG - Intronic
997371493 5:133364062-133364084 GGCTGCCCTGTTCAGTGAGAAGG - Intronic
999999108 5:157120527-157120549 GCCTGCCATGGGCAGTCAACAGG - Intronic
1001013336 5:168118294-168118316 GCCTGCCCTGTCCTGTGCAGTGG + Exonic
1001576960 5:172770937-172770959 GCCGGCCATGGTCATGGAAGTGG - Exonic
1003889156 6:10548539-10548561 GGCTGCCCTGGCAAGTGGAGTGG - Intronic
1005412410 6:25564258-25564280 TCCTGACCTGGACAGTGCAGTGG - Intronic
1005799742 6:29409325-29409347 GCCTCCCCTGCCCAGAGAAGTGG + Intronic
1005908737 6:30289100-30289122 GTCTGGCCTGGGCAGTGGAGGGG - Intergenic
1006091659 6:31632126-31632148 GCCCACCCCGGGCAGTGAAGCGG - Exonic
1006374523 6:33664634-33664656 GGCTGCCCGTGTCAGTGCAGTGG + Intronic
1007416834 6:41695944-41695966 CCCTGCCCTGCTCGGTGCAGTGG + Intronic
1008624116 6:53301017-53301039 GCCTGCCCTGTTAAGTAAATTGG + Intronic
1009029162 6:58035973-58035995 GCATACCCTGGCCAGTGAAGTGG + Intergenic
1009204704 6:60787371-60787393 GCATACCCTGGCCAGTGAAGTGG + Intergenic
1014792774 6:125693489-125693511 GCCTGCCATGGTCACTGTTGGGG + Intergenic
1018182086 6:161232816-161232838 GCCTGCCCTGGACAAGGACGAGG + Intronic
1018668931 6:166163828-166163850 GCCGGCCCTGGCCAGAGCAGTGG + Intronic
1019916543 7:4136722-4136744 GCCTGCCCTGGCCAGACACGCGG + Intronic
1022182977 7:27939963-27939985 GGCTGCCGTGGCCAGTGAGGAGG + Intronic
1023763812 7:43492103-43492125 TCCTGGCCTGGCCAGTAAAGAGG - Exonic
1023768805 7:43536366-43536388 GCCTCCCCTGGGCAGTGGAGGGG - Intronic
1027645557 7:80793661-80793683 AGCTGCCAAGGTCAGTGAAGAGG + Intronic
1032017336 7:128388528-128388550 GCCTGCCCTGAAAGGTGAAGGGG + Intergenic
1035552935 8:544387-544409 GGCAGCCCTGGCCAGTTAAGCGG + Intronic
1036084125 8:5594675-5594697 GCCAGACTTGGCCAGTGAAGAGG - Intergenic
1036377722 8:8214872-8214894 GCCTTCCCTGGTGTGTGCAGTGG - Intergenic
1036391142 8:8325233-8325255 GCCTGGCCTGGTCATTGGGGGGG - Intronic
1036851841 8:12208277-12208299 GCCTTCCCTGGTGTGTGCAGTGG + Intergenic
1036873207 8:12450795-12450817 GCCTTCCCTGGTGTGTGCAGTGG + Intergenic
1037006651 8:13789830-13789852 TCCTGGCCTTCTCAGTGAAGAGG + Intergenic
1037802068 8:22041272-22041294 GCCTGCACTGGTCAGTGCATGGG + Intergenic
1038781416 8:30571480-30571502 GCCAGCCCTGGCCCTTGAAGGGG + Intronic
1040341503 8:46443454-46443476 GCCTGCCCGGGTCAGCCATGGGG + Intergenic
1040516163 8:48136738-48136760 GCCTGCCCTGCCCACTGAAAGGG - Intergenic
1042190720 8:66184315-66184337 GCCTACGCTGGACAGTGTAGTGG + Intergenic
1043471193 8:80565026-80565048 GCCTGCGTTGGCCAGTGCAGAGG - Intergenic
1043889880 8:85643540-85643562 CCTTCCCCTGGCCAGTGAAGAGG + Intergenic
1043891418 8:85655448-85655470 CCTTCCCCTGGCCAGTGAAGAGG + Intergenic
1043892491 8:85662285-85662307 CCTTCCCCTGGCCAGTGAAGAGG + Intergenic
1043893066 8:85715050-85715072 CCTTCCCCTGGCCAGTGAAGAGG - Intergenic
1043895753 8:85736504-85736526 CCTTCCCCTGGCCAGTGAAGAGG - Intergenic
1043896926 8:85745304-85745326 CCTTCCCCTGGCCAGTGAAGAGG + Intergenic
1043899250 8:85763671-85763693 CCTTCCCCTGGCCAGTGAAGAGG + Intergenic
1043900860 8:85775865-85775887 CCTTCCCCTGGCCAGTGAAGAGG + Intergenic
1043902824 8:85791140-85791162 CCTTCCCCTGGCCAGTGAAGAGG + Intergenic
1043904434 8:85803333-85803355 CCTTCCCCTGGCCAGTGAAGAGG + Intergenic
1043906046 8:85815524-85815546 CCTTCCCCTGGCCAGTGAAGAGG + Intergenic
1043907654 8:85827714-85827736 CCTTCCCCTGGCCAGTGAAGAGG + Intergenic
1045655995 8:104387123-104387145 GCCTGGCCTGGTGAATGTAGAGG + Intronic
1046681580 8:117176535-117176557 GCCTGCGCTGGACTGTTAAGTGG - Intronic
1047698578 8:127428030-127428052 GCCTGCTGTGGACAGTGAGGAGG + Intergenic
1048875630 8:138835083-138835105 GCCTGCGATGGTCTGGGAAGGGG + Intronic
1049243201 8:141549080-141549102 CCCAGCCCTGCTCAGGGAAGGGG + Intergenic
1049528005 8:143138808-143138830 GGCTGCCCTGTGCACTGAAGGGG - Intergenic
1049662922 8:143828494-143828516 GCCTGCCCTGCCCGGGGAAGTGG + Intronic
1049806838 8:144544942-144544964 GCCTGCCCTTGTCAGGGAGCGGG + Intronic
1050678761 9:8085685-8085707 GCATGCTCTGGTAAGGGAAGTGG + Intergenic
1051580657 9:18670240-18670262 ACCTGCCCTGGACAGTGTGGGGG - Intronic
1060104512 9:120865500-120865522 GCCTCCCCAGTTCAGTGGAGGGG - Intronic
1060933708 9:127504273-127504295 GCCTGCCCTGTTCAGTGCACAGG - Intergenic
1061878699 9:133557646-133557668 GACTGCCCTGGGAGGTGAAGAGG - Intronic
1062390136 9:136330561-136330583 CCCTCCCCTGGCCACTGAAGGGG + Intronic
1188400586 X:29739086-29739108 TCCTTCCCTGGTCTATGAAGTGG - Intronic
1190133899 X:47776698-47776720 GGATGCCCTGGCCAGTCAAGGGG + Intergenic
1190300989 X:49057535-49057557 GCCCGCCCCAGGCAGTGAAGTGG + Intronic
1194276617 X:91892534-91892556 GCATGCCATGATCAGGGAAGAGG - Intronic
1196090045 X:111731023-111731045 ACCTGCTCTGGCCAGTGAAATGG - Intronic
1198639501 X:138741305-138741327 GGCTGCACTGGTCAGTGTAGTGG + Intronic
1201152868 Y:11103330-11103352 GCCTGCCCAGGTCTGTGCTGAGG - Intergenic