ID: 1084377954

View in Genome Browser
Species Human (GRCh38)
Location 11:68791317-68791339
Sequence GGGCAACTGCCCCTCCAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084377951_1084377954 -4 Left 1084377951 11:68791298-68791320 CCTGCCCTGGTCAGTGAAGGGGC 0: 1
1: 0
2: 1
3: 19
4: 280
Right 1084377954 11:68791317-68791339 GGGCAACTGCCCCTCCAATCAGG 0: 1
1: 0
2: 0
3: 4
4: 105
1084377952_1084377954 -8 Left 1084377952 11:68791302-68791324 CCCTGGTCAGTGAAGGGGCAACT 0: 1
1: 0
2: 0
3: 14
4: 112
Right 1084377954 11:68791317-68791339 GGGCAACTGCCCCTCCAATCAGG 0: 1
1: 0
2: 0
3: 4
4: 105
1084377943_1084377954 19 Left 1084377943 11:68791275-68791297 CCCACTTCCCTTTGGGGACACTG 0: 1
1: 0
2: 3
3: 19
4: 197
Right 1084377954 11:68791317-68791339 GGGCAACTGCCCCTCCAATCAGG 0: 1
1: 0
2: 0
3: 4
4: 105
1084377946_1084377954 11 Left 1084377946 11:68791283-68791305 CCTTTGGGGACACTGCCTGCCCT 0: 1
1: 0
2: 2
3: 28
4: 254
Right 1084377954 11:68791317-68791339 GGGCAACTGCCCCTCCAATCAGG 0: 1
1: 0
2: 0
3: 4
4: 105
1084377942_1084377954 24 Left 1084377942 11:68791270-68791292 CCTGACCCACTTCCCTTTGGGGA 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1084377954 11:68791317-68791339 GGGCAACTGCCCCTCCAATCAGG 0: 1
1: 0
2: 0
3: 4
4: 105
1084377944_1084377954 18 Left 1084377944 11:68791276-68791298 CCACTTCCCTTTGGGGACACTGC 0: 1
1: 0
2: 1
3: 19
4: 250
Right 1084377954 11:68791317-68791339 GGGCAACTGCCCCTCCAATCAGG 0: 1
1: 0
2: 0
3: 4
4: 105
1084377940_1084377954 25 Left 1084377940 11:68791269-68791291 CCCTGACCCACTTCCCTTTGGGG 0: 1
1: 0
2: 2
3: 29
4: 195
Right 1084377954 11:68791317-68791339 GGGCAACTGCCCCTCCAATCAGG 0: 1
1: 0
2: 0
3: 4
4: 105
1084377953_1084377954 -9 Left 1084377953 11:68791303-68791325 CCTGGTCAGTGAAGGGGCAACTG 0: 1
1: 0
2: 0
3: 19
4: 151
Right 1084377954 11:68791317-68791339 GGGCAACTGCCCCTCCAATCAGG 0: 1
1: 0
2: 0
3: 4
4: 105
1084377945_1084377954 12 Left 1084377945 11:68791282-68791304 CCCTTTGGGGACACTGCCTGCCC 0: 1
1: 0
2: 2
3: 23
4: 601
Right 1084377954 11:68791317-68791339 GGGCAACTGCCCCTCCAATCAGG 0: 1
1: 0
2: 0
3: 4
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084377954 Original CRISPR GGGCAACTGCCCCTCCAATC AGG Intronic
901613366 1:10517308-10517330 GGGCAACTCCCTCTCCTATTGGG + Intronic
905646411 1:39627553-39627575 GGGCATCTGCCCCTCTCAGCAGG - Intronic
906216415 1:44043552-44043574 GAGCAACAGCCCCTCCTCTCTGG - Intergenic
907318547 1:53588369-53588391 GGGAAAGTGACCCTCCAATTAGG - Intronic
907320167 1:53596974-53596996 GGGCAGCTCCCCTTCCAATAGGG + Intronic
916754129 1:167752387-167752409 GGGAAAATGGCCCTCCAAGCAGG - Intronic
919914717 1:202132414-202132436 GGGGAACTGCCTCTCCAGGCAGG + Exonic
921112833 1:212055519-212055541 GTGCAGCTGCCCCTCCACTCAGG - Intronic
924927313 1:248695738-248695760 GGGCAGCTGGCCCTCCACCCGGG - Intergenic
1069651860 10:70054327-70054349 GGGTAACTGCCCTTAAAATCAGG - Intronic
1069714054 10:70509347-70509369 GGGCAACTGTCCCATCAAGCAGG - Intronic
1070076495 10:73141467-73141489 GCGCCACTGCACCTCCAACCTGG + Exonic
1071183092 10:83009711-83009733 GGGCCACTGCACCTCCAGCCTGG - Intergenic
1076683898 10:132188052-132188074 AGGCAGCAGCCCCTCCCATCTGG - Intronic
1076829639 10:132987855-132987877 GGGCCACTGCCTCTCCAGGCCGG - Intergenic
1077254328 11:1573626-1573648 GGGCCACTGCCGCTCCCCTCAGG - Intergenic
1077279926 11:1739144-1739166 GTGCACCTGCCCTTCCAGTCTGG - Intronic
1079251393 11:18790637-18790659 TGGCACCTGCCCCTCCAAGTGGG + Intronic
1081662697 11:44897624-44897646 GGGCAACTGTCCTGCTAATCTGG - Intronic
1081995023 11:47358818-47358840 GGGCACCTGGCCCTCCACCCTGG - Intronic
1084377954 11:68791317-68791339 GGGCAACTGCCCCTCCAATCAGG + Intronic
1084737019 11:71112022-71112044 GGGCAACTGCCGCCCACATCTGG + Intronic
1088430819 11:109756966-109756988 GGGCAAAACCCCCTCAAATCTGG - Intergenic
1098234199 12:68402680-68402702 GCTCACCTGCCCCGCCAATCAGG + Intergenic
1098345308 12:69496392-69496414 GCGCCACTGCACCTCCAGTCTGG + Intronic
1098981700 12:76963156-76963178 GTGCATCTGGCCCTCCCATCTGG - Intergenic
1101725866 12:107387761-107387783 GGACACCTGCCCCTGCCATCTGG + Intronic
1103661534 12:122523471-122523493 GCGCCACTGCCCCTCCAGCCTGG + Intronic
1107966749 13:45604221-45604243 GGGCTCCTGCCCCTCTAACCAGG + Intronic
1109282399 13:60372201-60372223 GGGCAGCTGCTCCTCTACTCTGG - Intergenic
1114214528 14:20646199-20646221 GGGCAGCTGCTCCTCAAGTCTGG - Intergenic
1115508825 14:34119814-34119836 GGGCACCTGCTACTCCACTCTGG + Intronic
1116850027 14:49899348-49899370 GGGCCACTGCCACTCCAGCCTGG + Intergenic
1117676336 14:58158480-58158502 GGGCCACTGCGCCTCCAGCCTGG - Intronic
1118006594 14:61569019-61569041 GGGGAAAAGCCCCTTCAATCTGG - Intronic
1125305121 15:38303139-38303161 GTGCCACTGCACCTCCAATGTGG + Intronic
1125823944 15:42659567-42659589 GCGCCACTGCCCCTCCAGCCTGG - Intronic
1130981661 15:88816105-88816127 GGACATCTTCCCCTCCAATAAGG + Intronic
1131197908 15:90371724-90371746 GGGTAACTTCCCCACTAATCAGG - Intergenic
1131842489 15:96452241-96452263 GGGCAACTGCCCGGCAATTCTGG - Intergenic
1131891042 15:96971587-96971609 GTGCAACTGCACCTCCAGCCTGG - Intergenic
1132104945 15:99056791-99056813 GCACCACTGCCCCTCCAAACAGG + Intergenic
1132273287 15:100544720-100544742 GGGACACTGCCCCTCCAGCCCGG + Exonic
1132672651 16:1108073-1108095 GGGTCACTGCCCCGCAAATCAGG - Intergenic
1136063301 16:27741567-27741589 GGGCGGCTGCCACTCCACTCAGG + Intronic
1137718528 16:50613432-50613454 GGGCACCTGCCCCTCCATCTGGG - Intronic
1139971135 16:70775951-70775973 GGGTAACTGCTCTTCCAATTTGG - Intronic
1142972797 17:3624021-3624043 GGGCAACTGCACTTTCACTCGGG - Intronic
1145963531 17:28901423-28901445 GGGCAACTGCCCCCTCCAGCGGG - Intronic
1149190587 17:54056820-54056842 GGGCCACTGCACCTCCAGCCTGG + Intergenic
1150105662 17:62460839-62460861 GTGCCACTGCACCTCCAGTCTGG - Intronic
1152942591 17:83180821-83180843 GGGAAACAGCCCGTTCAATCAGG + Intergenic
1156310566 18:35918513-35918535 GGGGAGCTGGCCCTCCAAGCAGG - Intergenic
1164536067 19:29087455-29087477 GGGCACCTGCCCCTCCCCTGAGG + Intergenic
925908311 2:8553127-8553149 GGGCCACTGCCACTCCAGCCTGG - Intergenic
926119596 2:10234874-10234896 GGGCAGCTTCCCCTCGAACCTGG - Intergenic
926888687 2:17620430-17620452 GGGCCCCTGCACCTCCCATCTGG - Intronic
927368202 2:22324423-22324445 GGCCAAATGCACATCCAATCAGG - Intergenic
928797104 2:35035134-35035156 GGGCTCCTGCCCCTCCAAGTTGG + Intergenic
930014295 2:46959790-46959812 CTGCAACTGCCCCTTCACTCAGG - Intronic
932420732 2:71599842-71599864 GGCCAGCTGCCCCTGCCATCTGG - Intronic
932636237 2:73390811-73390833 GGGCCACTGCCACTCCAGCCTGG - Intronic
935723375 2:105999293-105999315 GGGCAGCTGTGCCTCCAATGTGG + Intergenic
937061370 2:118982537-118982559 GGGCAACTGCCCCCATAACCAGG - Intronic
937370078 2:121291202-121291224 GGGCACATGCCACTCCAATAAGG - Intergenic
938732680 2:134158638-134158660 GGGCTCCTGCCCCACCAATTCGG + Intronic
1169974167 20:11304843-11304865 TGGCAGCTGCCCCTGCAGTCTGG + Intergenic
1176738552 21:10575378-10575400 TGGCAGCTGCCCCTCCCACCAGG - Intronic
1179644021 21:42764573-42764595 GAGCGGCTGCTCCTCCAATCAGG - Intronic
1180025764 21:45161229-45161251 GGGCTCCTGCCCCTCCAACTTGG - Intronic
1182238367 22:28894928-28894950 GGGCAGCTGCCACTCCACTATGG - Intronic
1182666618 22:31964816-31964838 GTGCCACTGCCCCTCCAGCCTGG - Intergenic
1183378980 22:37481305-37481327 GGGCAAGTGCATGTCCAATCTGG - Intronic
1183514325 22:38255066-38255088 GTGCTACTGCCCCTCCAGCCTGG - Intronic
956515368 3:70040670-70040692 GGCCAAGTGCCCCTCCCACCTGG - Intergenic
959789881 3:110346829-110346851 GGGCAACTGGCCCTCAAAACTGG + Intergenic
960764656 3:121112175-121112197 TGGCAGCTGCCCCTCCCCTCAGG + Intronic
964228248 3:154432147-154432169 GTGCCACTGCCACTCCAACCTGG - Intergenic
967095231 3:186172384-186172406 GGGGCCCTGCCCCTCCATTCAGG - Intronic
967649973 3:191973923-191973945 GGGCAGCTGCCACTCCACGCAGG + Intergenic
967889469 3:194354835-194354857 GTGCCACTGCCCCTCCAGCCTGG - Intergenic
968838443 4:2982181-2982203 GGGCTCCTGCCCCACCAACCTGG + Intronic
969689046 4:8694303-8694325 GGGCACCTGACACTCCCATCTGG - Intergenic
972855596 4:43102567-43102589 GCGCCACTGCACCTCCAGTCTGG + Intergenic
984164220 4:176288293-176288315 GGGCCACTGCCACTCCAGCCTGG - Intergenic
986309681 5:6543022-6543044 GGGCACCTGGCCCTCAAGTCTGG - Intergenic
1006374624 6:33665055-33665077 GGGCACCTGCCCCACCAAGGAGG + Exonic
1006638634 6:35477259-35477281 TGGCACCTGCACCTCCACTCAGG - Intronic
1006983405 6:38162950-38162972 GGGCACCTCCACCTCCAAGCAGG + Intergenic
1008922724 6:56859921-56859943 GGGGAACTGCATCTCCAATCTGG - Intronic
1016782640 6:147976799-147976821 TGGCAGCTGCCACTTCAATCTGG - Intergenic
1018681646 6:166270305-166270327 GGGCCACAGCCCCTCCCACCTGG - Intergenic
1018898575 6:168038774-168038796 TGGCACCTGCCCCTCCCACCTGG + Intronic
1019991174 7:4692436-4692458 GTGCCACTGCCCCTCCAGCCTGG - Intronic
1022742598 7:33137397-33137419 GGGCTCCTGGCCCTCCAACCTGG + Intronic
1032034822 7:128514038-128514060 GTGCCACTGCACCTCCAGTCTGG - Intergenic
1035099868 7:156387911-156387933 GTGCAGCTGCCCCCCGAATCTGG - Intergenic
1037474165 8:19239948-19239970 GGGCAACGGCCCTTACAATGTGG - Intergenic
1046407398 8:113791412-113791434 GGGCTCCTGCCCCTCCAACTTGG + Intergenic
1049211507 8:141388601-141388623 GGGCCACTGCCACTGAAATCAGG + Intergenic
1049424201 8:142530817-142530839 GGGCACCTGCCTCTCCAGACAGG + Intronic
1053300376 9:36944769-36944791 GGGTAACTGCCCCACCAGTGTGG - Intronic
1057499626 9:95586218-95586240 GGGCAACAGCACCCCCAATCAGG - Intergenic
1061754569 9:132803710-132803732 GAGCCACGGCCCCTCCCATCTGG + Intronic
1190254453 X:48752160-48752182 GAGCATCTGCACCTCCAACCTGG - Intergenic
1192575253 X:72238611-72238633 GGGCAAATGACCCTCCAGTATGG - Intronic
1199664900 X:150088826-150088848 GGGCACCTGCTGCTCCAGTCAGG + Intergenic
1199718787 X:150526948-150526970 GGGCCTCTGCCCCTCAAACCAGG - Intergenic
1199848767 X:151710478-151710500 CAGCAGCTGCCCCTCCAAGCTGG - Intergenic
1200806895 Y:7442798-7442820 GTGCAACTGCCACTGCTATCTGG - Intergenic