ID: 1084377955

View in Genome Browser
Species Human (GRCh38)
Location 11:68791318-68791340
Sequence GGCAACTGCCCCTCCAATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 100}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084377942_1084377955 25 Left 1084377942 11:68791270-68791292 CCTGACCCACTTCCCTTTGGGGA 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1084377955 11:68791318-68791340 GGCAACTGCCCCTCCAATCAGGG 0: 1
1: 0
2: 1
3: 8
4: 100
1084377944_1084377955 19 Left 1084377944 11:68791276-68791298 CCACTTCCCTTTGGGGACACTGC 0: 1
1: 0
2: 1
3: 19
4: 250
Right 1084377955 11:68791318-68791340 GGCAACTGCCCCTCCAATCAGGG 0: 1
1: 0
2: 1
3: 8
4: 100
1084377940_1084377955 26 Left 1084377940 11:68791269-68791291 CCCTGACCCACTTCCCTTTGGGG 0: 1
1: 0
2: 2
3: 29
4: 195
Right 1084377955 11:68791318-68791340 GGCAACTGCCCCTCCAATCAGGG 0: 1
1: 0
2: 1
3: 8
4: 100
1084377952_1084377955 -7 Left 1084377952 11:68791302-68791324 CCCTGGTCAGTGAAGGGGCAACT 0: 1
1: 0
2: 0
3: 14
4: 112
Right 1084377955 11:68791318-68791340 GGCAACTGCCCCTCCAATCAGGG 0: 1
1: 0
2: 1
3: 8
4: 100
1084377945_1084377955 13 Left 1084377945 11:68791282-68791304 CCCTTTGGGGACACTGCCTGCCC 0: 1
1: 0
2: 2
3: 23
4: 601
Right 1084377955 11:68791318-68791340 GGCAACTGCCCCTCCAATCAGGG 0: 1
1: 0
2: 1
3: 8
4: 100
1084377953_1084377955 -8 Left 1084377953 11:68791303-68791325 CCTGGTCAGTGAAGGGGCAACTG 0: 1
1: 0
2: 0
3: 19
4: 151
Right 1084377955 11:68791318-68791340 GGCAACTGCCCCTCCAATCAGGG 0: 1
1: 0
2: 1
3: 8
4: 100
1084377946_1084377955 12 Left 1084377946 11:68791283-68791305 CCTTTGGGGACACTGCCTGCCCT 0: 1
1: 0
2: 2
3: 28
4: 254
Right 1084377955 11:68791318-68791340 GGCAACTGCCCCTCCAATCAGGG 0: 1
1: 0
2: 1
3: 8
4: 100
1084377943_1084377955 20 Left 1084377943 11:68791275-68791297 CCCACTTCCCTTTGGGGACACTG 0: 1
1: 0
2: 3
3: 19
4: 197
Right 1084377955 11:68791318-68791340 GGCAACTGCCCCTCCAATCAGGG 0: 1
1: 0
2: 1
3: 8
4: 100
1084377951_1084377955 -3 Left 1084377951 11:68791298-68791320 CCTGCCCTGGTCAGTGAAGGGGC 0: 1
1: 0
2: 1
3: 19
4: 280
Right 1084377955 11:68791318-68791340 GGCAACTGCCCCTCCAATCAGGG 0: 1
1: 0
2: 1
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084377955 Original CRISPR GGCAACTGCCCCTCCAATCA GGG Intronic
901755458 1:11438956-11438978 AGCACCTGCCCCTCCCAGCACGG + Intergenic
902602919 1:17552162-17552184 GGCATCTGCCCTTCCCAGCAGGG - Intronic
903058009 1:20649955-20649977 GCCAGCTGCCACTCCAATTATGG - Intronic
907571590 1:55488865-55488887 GGTACCTGTCCCTCCATTCACGG - Intergenic
908262287 1:62348543-62348565 GGAAACTGACAATCCAATCATGG + Intergenic
914639381 1:149588820-149588842 GGCATTTACCCCTTCAATCATGG + Intergenic
916754128 1:167752386-167752408 GGAAAATGGCCCTCCAAGCAGGG - Intronic
917227100 1:172795957-172795979 AGCAACTGCCTGTCCAATCATGG - Intergenic
919662695 1:200262843-200262865 GGCAGCTGCCCCCACAACCAGGG + Intergenic
919914718 1:202132415-202132437 GGGAACTGCCTCTCCAGGCAGGG + Exonic
920129865 1:203723812-203723834 GGCAGCTGGCCCTCCAGCCAAGG - Intronic
920348311 1:205321205-205321227 GACCACTGTCCCTGCAATCACGG + Intronic
921112832 1:212055518-212055540 TGCAGCTGCCCCTCCACTCAGGG - Intronic
922642119 1:227244947-227244969 GTCAAATGCCCCTCCAAGCATGG - Intronic
1069651859 10:70054326-70054348 GGTAACTGCCCTTAAAATCAGGG - Intronic
1071426879 10:85566107-85566129 TCCAACTGCCCCTTCTATCATGG - Intergenic
1072408513 10:95177598-95177620 AGCAACTGCCTCTCCAACCTTGG + Intergenic
1075095933 10:119470974-119470996 TGTAACTGCCGCTGCAATCAAGG - Intergenic
1075536326 10:123275096-123275118 GGCAGCTTCCTCTCCAATTACGG - Intergenic
1078549901 11:12272791-12272813 GGCCACTACCCCTTCAGTCAGGG - Intergenic
1079251394 11:18790638-18790660 GGCACCTGCCCCTCCAAGTGGGG + Intronic
1081718451 11:45268117-45268139 GGCAGCTGCCCCTCCCAACCCGG + Intronic
1082095235 11:48124568-48124590 GCCAGCTGCCCCACCAACCAGGG + Intronic
1084377955 11:68791318-68791340 GGCAACTGCCCCTCCAATCAGGG + Intronic
1086820710 11:91433227-91433249 GGTAGCTGCCCCTCCCACCATGG + Intergenic
1088756478 11:112889524-112889546 GCCAAATGCCCCTCCGATCTAGG - Intergenic
1092309780 12:7340024-7340046 GGAACCTGCCTCTCCAGTCAAGG + Intergenic
1095465789 12:42486911-42486933 GCCAACTGCCCCTCAAATTTAGG - Intronic
1095874913 12:47069492-47069514 GGCAACTGCCCCTACATTCAAGG + Intergenic
1098234200 12:68402681-68402703 CTCACCTGCCCCGCCAATCAGGG + Intergenic
1103719043 12:122963815-122963837 AGCAGCTGCCCCTCCAAAGACGG + Intronic
1121463120 14:94097274-94097296 AGCAACTGCCCGTTCAATCTTGG - Intronic
1124406891 15:29401007-29401029 GGCCACTGCCCCTTCAAGCCTGG + Intronic
1126418616 15:48446738-48446760 TTCAACTGCCGCTGCAATCATGG - Exonic
1127572573 15:60258677-60258699 AGCAACTGCACCTACAATTAAGG + Intergenic
1131197907 15:90371723-90371745 GGTAACTTCCCCACTAATCAGGG - Intergenic
1132104946 15:99056792-99056814 CACCACTGCCCCTCCAAACAGGG + Intergenic
1133139204 16:3731967-3731989 GGCAAGTGCCCCTCCACACTTGG + Intronic
1133217899 16:4304532-4304554 GCCAGATTCCCCTCCAATCAAGG + Intergenic
1136024640 16:27461737-27461759 GGCAGCTGCCTCTCCCACCAGGG - Intronic
1137044361 16:35642213-35642235 GGCAACTTCCCATCCAAGCATGG + Intergenic
1140190076 16:72807983-72808005 GAAAAATGCCCCTCTAATCAGGG - Intronic
1141288025 16:82690853-82690875 CGCAACTGCCTGTCCCATCATGG + Intronic
1142143564 16:88483267-88483289 GGCACCTGCCCCTCCTGTCCAGG + Intronic
1142762987 17:2052153-2052175 GGGAACTGCCCCACAAGTCATGG - Intergenic
1146644671 17:34569029-34569051 GGCCCCTGCCCCTACAATCTAGG - Intergenic
1149993502 17:61395640-61395662 GTCAACTTCCCCTCGAACCATGG - Intergenic
1152997897 18:425334-425356 GGCAGCTGCCCCTCCCACCCAGG + Intronic
1164536068 19:29087456-29087478 GGCACCTGCCCCTCCCCTGAGGG + Intergenic
1168303341 19:55419558-55419580 GGCAACTGCCCTCCCAGGCATGG + Intergenic
927298192 2:21479306-21479328 AGCAACTGCCTCTCCAACCTCGG - Intergenic
929547178 2:42863334-42863356 GGGAACTGCTCCTTCAGTCATGG - Intergenic
933757075 2:85648111-85648133 GGTACCTGGCCCTCCAACCAAGG - Intronic
937296706 2:120813822-120813844 TGCATCTTCCCCTCAAATCAGGG - Intronic
937698387 2:124835480-124835502 AGCAACTGCCCCTGCATTCTTGG - Intronic
937787860 2:125923489-125923511 GGTAACTGCTCCTGCATTCATGG - Intergenic
937921942 2:127137223-127137245 GGAACCTGCCCCTCCAGTCAAGG + Intergenic
945186923 2:207148717-207148739 GGCAACTGCCCCTTCAGATAGGG + Intronic
1170254532 20:14325893-14325915 GGCCACAGCCCCACCAATGATGG + Exonic
1170621071 20:17996571-17996593 GGAAACTGCAGCTCCAACCAGGG + Intronic
1170725332 20:18921040-18921062 GGCTACGGGCCCTCCAAGCATGG - Intergenic
1174113370 20:48211264-48211286 TGCAGCTGCCCCTCCACACAGGG + Intergenic
1178788151 21:35673585-35673607 AGGAACTGTCCATCCAATCAGGG - Intronic
1179822307 21:43943928-43943950 GGCACTTGCCCCTCCACTCCAGG - Intronic
1179922317 21:44513839-44513861 TGCCACTGCCCCCCCAACCAGGG - Intronic
1181383940 22:22529573-22529595 AGCAACTGCCTCTCCAACCTTGG - Intergenic
955231055 3:57098940-57098962 AGAATCTGCCCCTCCAATCTAGG - Intronic
958256533 3:91331940-91331962 CACAGCAGCCCCTCCAATCACGG + Intergenic
961561656 3:127734388-127734410 GCCCACTGCCTCTCCCATCAGGG + Intronic
961948483 3:130719920-130719942 AGCTACTGCCCCTACAATGAGGG + Intronic
964431395 3:156610353-156610375 GGAAACTGCCACTCCAGTCCAGG + Intergenic
967095230 3:186172383-186172405 GGGCCCTGCCCCTCCATTCAGGG - Intronic
967368573 3:188716527-188716549 TTCAACTGCACCTCAAATCATGG - Intronic
968094892 3:195921955-195921977 AGTAACTGTCACTCCAATCAAGG - Intergenic
968335946 3:197913747-197913769 GGCAACAGCCCCTCCACTTGAGG - Intronic
974180525 4:58379249-58379271 AGCAACTGCACCTCCACTGAAGG - Intergenic
978827104 4:113038688-113038710 GGCAAGTGCCTGTCCAATTAAGG - Intronic
995204561 5:109464484-109464506 TGCAATTGGCCATCCAATCACGG + Intergenic
996891561 5:128427189-128427211 TGCCACTGCCCCACCAAGCATGG + Intronic
997669537 5:135658967-135658989 AGCAGCAGCCCCTCCCATCACGG - Intergenic
1001672869 5:173488721-173488743 TGCAGCTACCACTCCAATCAAGG + Intergenic
1003746358 6:9006820-9006842 GGCAACTGCCCTGCCCACCAAGG - Intergenic
1004983933 6:21059040-21059062 TGCAGCTGCCCCTCCCCTCAGGG + Intronic
1006983406 6:38162951-38162973 GGCACCTCCACCTCCAAGCAGGG + Intergenic
1007703051 6:43775429-43775451 GGCAGCCGCCCCTCCAAGGAGGG - Intronic
1014410861 6:121118641-121118663 AGTAACTGCCTCTCCAACCATGG - Intronic
1024229384 7:47352736-47352758 GAGAGCTGCCCCTCCACTCAAGG + Intronic
1024403176 7:48948273-48948295 AGCAACTGCCTGTCCAATCTTGG + Intergenic
1031949098 7:127873391-127873413 GGCAAATCCCACTCCAATTACGG - Intronic
1032479183 7:132232911-132232933 AGCAACAGCCCCTCCAAGCTTGG - Intronic
1033362003 7:140644470-140644492 TGAATGTGCCCCTCCAATCAAGG - Intronic
1033868213 7:145718350-145718372 AGCAGCTGCCCCTCCCAACAGGG + Intergenic
1033998980 7:147388183-147388205 GGCATCTGCTCCTCAAATTAAGG - Intronic
1034148546 7:148894074-148894096 GTTAACTGCCCCGCCAACCATGG - Intergenic
1035634346 8:1132677-1132699 GGCAGCTGCCGCTCTAATCCTGG + Intergenic
1039226305 8:35392308-35392330 GGCAACTGACCCTCCCACCTCGG + Intronic
1039531193 8:38264567-38264589 GGCAAATGTCATTCCAATCATGG + Exonic
1042040980 8:64587923-64587945 GCCAACTCCCCATCCAAGCATGG - Intronic
1042804238 8:72754543-72754565 TGCAACTGCACCTACATTCAGGG - Intronic
1046081873 8:109379257-109379279 CGGAACTGACCCTCCAATTATGG + Intronic
1047899676 8:129406353-129406375 GGCACCTGCCCCTCCCCTAAAGG + Intergenic
1049211508 8:141388602-141388624 GGCCACTGCCACTGAAATCAGGG + Intergenic
1049751995 8:144289328-144289350 GACAACTGCCCCTCCAGGCATGG + Intronic
1056477467 9:86966962-86966984 GGCAACTGACCCTCCCAACCAGG - Intergenic
1057196460 9:93118172-93118194 GGCAACTGGACCTCCATTCAAGG - Intergenic
1057499625 9:95586217-95586239 GGCAACAGCACCCCCAATCAGGG - Intergenic
1057971825 9:99566001-99566023 GGCTCCTGACCCTCAAATCATGG - Intergenic
1061825035 9:133252597-133252619 GGCAACCGCCCCTCCCTGCAAGG - Intronic
1190929544 X:54935759-54935781 GTCAACTGCCCCTGCCATCCAGG + Intronic
1199718786 X:150526947-150526969 GGCCTCTGCCCCTCAAACCAGGG - Intergenic