ID: 1084380027

View in Genome Browser
Species Human (GRCh38)
Location 11:68805865-68805887
Sequence GCCCATTGTAGTCATGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 118}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084380027_1084380039 21 Left 1084380027 11:68805865-68805887 CCAGGGCCATGACTACAATGGGC 0: 1
1: 0
2: 0
3: 16
4: 118
Right 1084380039 11:68805909-68805931 CCCGCCTGCAGGGGGTCACAGGG 0: 1
1: 0
2: 1
3: 11
4: 123
1084380027_1084380030 -10 Left 1084380027 11:68805865-68805887 CCAGGGCCATGACTACAATGGGC 0: 1
1: 0
2: 0
3: 16
4: 118
Right 1084380030 11:68805878-68805900 TACAATGGGCAGATGGTACACGG 0: 1
1: 0
2: 0
3: 11
4: 151
1084380027_1084380034 11 Left 1084380027 11:68805865-68805887 CCAGGGCCATGACTACAATGGGC 0: 1
1: 0
2: 0
3: 16
4: 118
Right 1084380034 11:68805899-68805921 GGGGCACACACCCGCCTGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 158
1084380027_1084380041 22 Left 1084380027 11:68805865-68805887 CCAGGGCCATGACTACAATGGGC 0: 1
1: 0
2: 0
3: 16
4: 118
Right 1084380041 11:68805910-68805932 CCGCCTGCAGGGGGTCACAGGGG 0: 1
1: 0
2: 0
3: 8
4: 202
1084380027_1084380035 12 Left 1084380027 11:68805865-68805887 CCAGGGCCATGACTACAATGGGC 0: 1
1: 0
2: 0
3: 16
4: 118
Right 1084380035 11:68805900-68805922 GGGCACACACCCGCCTGCAGGGG 0: 1
1: 0
2: 0
3: 18
4: 199
1084380027_1084380032 -8 Left 1084380027 11:68805865-68805887 CCAGGGCCATGACTACAATGGGC 0: 1
1: 0
2: 0
3: 16
4: 118
Right 1084380032 11:68805880-68805902 CAATGGGCAGATGGTACACGGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1084380027_1084380036 13 Left 1084380027 11:68805865-68805887 CCAGGGCCATGACTACAATGGGC 0: 1
1: 0
2: 0
3: 16
4: 118
Right 1084380036 11:68805901-68805923 GGCACACACCCGCCTGCAGGGGG 0: 1
1: 0
2: 3
3: 17
4: 161
1084380027_1084380037 20 Left 1084380027 11:68805865-68805887 CCAGGGCCATGACTACAATGGGC 0: 1
1: 0
2: 0
3: 16
4: 118
Right 1084380037 11:68805908-68805930 ACCCGCCTGCAGGGGGTCACAGG 0: 1
1: 0
2: 1
3: 15
4: 101
1084380027_1084380031 -9 Left 1084380027 11:68805865-68805887 CCAGGGCCATGACTACAATGGGC 0: 1
1: 0
2: 0
3: 16
4: 118
Right 1084380031 11:68805879-68805901 ACAATGGGCAGATGGTACACGGG 0: 1
1: 0
2: 0
3: 6
4: 138
1084380027_1084380033 10 Left 1084380027 11:68805865-68805887 CCAGGGCCATGACTACAATGGGC 0: 1
1: 0
2: 0
3: 16
4: 118
Right 1084380033 11:68805898-68805920 CGGGGCACACACCCGCCTGCAGG 0: 1
1: 0
2: 0
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084380027 Original CRISPR GCCCATTGTAGTCATGGCCC TGG (reversed) Intronic
900697439 1:4021071-4021093 GGCCACTGTAGACATGGCCGGGG + Intergenic
903774510 1:25783974-25783996 GGCCAGTGTGGCCATGGCCCTGG - Exonic
903929795 1:26855590-26855612 GGCCACTGCAGTGATGGCCCAGG - Exonic
911407835 1:97464571-97464593 GCCCATTTTAGTCATGGCTGGGG - Intronic
912584346 1:110748839-110748861 CACCATTGTATTCCTGGCCCTGG - Intergenic
916282425 1:163066544-163066566 GCCCATTTTATTCATGGTACAGG + Intergenic
918502807 1:185217261-185217283 GCCAATACCAGTCATGGCCCAGG - Intronic
921195195 1:212749935-212749957 GCACTTTGTAGTCAGGGGCCAGG - Intronic
1063391619 10:5653231-5653253 GCCCCTTGTAGGCCTTGCCCAGG - Intronic
1065688327 10:28307920-28307942 GCACATTTTAGTCATTGTCCAGG - Intronic
1068135349 10:52947566-52947588 GCCCACTGTAGACATAGACCTGG + Intergenic
1072207294 10:93215604-93215626 GCCCATTGTCACCCTGGCCCTGG + Intergenic
1075861747 10:125683164-125683186 GCCCATTGTTGTCATGGAATGGG + Intergenic
1076055322 10:127367932-127367954 GCCCACTGCAGCCATGCCCCTGG + Intronic
1084380027 11:68805865-68805887 GCCCATTGTAGTCATGGCCCTGG - Intronic
1084705898 11:70815817-70815839 GCCCACTGCAGTCCTGGCCAAGG + Intronic
1087725126 11:101707771-101707793 GCCCCTTTTAGTCATGGCTGGGG - Intronic
1088640760 11:111871089-111871111 GCCCACTCTAGGCCTGGCCCAGG + Intronic
1089665032 11:120012964-120012986 GCTCACTGGAGTCCTGGCCCTGG + Intergenic
1098311289 12:69151672-69151694 GCCCATTGTGGTCAACGCCAAGG + Intergenic
1098485261 12:71013910-71013932 GGCCATTTTGGTCATGGCCAAGG - Intergenic
1100602121 12:96120915-96120937 GCCTTTTGTTGTCATGGCCATGG + Intergenic
1101529304 12:105559695-105559717 GCGCATTGGACCCATGGCCCTGG + Intergenic
1104095312 12:125551857-125551879 GCACATTGTTTTCATGGTCCTGG + Intronic
1104760824 12:131296798-131296820 CACCATTGTAGTCACTGCCCTGG + Intergenic
1105451022 13:20500441-20500463 GGCCATTTTAGTCAAAGCCCTGG - Intronic
1113403370 13:110016332-110016354 GCTCATTGTATCCATGTCCCAGG - Intergenic
1113645276 13:111990630-111990652 GCCCTTTTTAGTCATGGCTGGGG - Intergenic
1113725946 13:112601849-112601871 GCTCTCTGTAGCCATGGCCCTGG - Intergenic
1114398144 14:22385258-22385280 GTCCATAGTAGGCATTGCCCAGG - Intergenic
1115278324 14:31632773-31632795 GCCCATTGTAGTAATAGGTCAGG + Intronic
1117648041 14:57873009-57873031 ATCCATTGCAGACATGGCCCAGG - Intronic
1117931062 14:60840505-60840527 GCCCATGGGAATCATGGCCTTGG + Intronic
1121349493 14:93162081-93162103 GCCCACTGTATTCATTTCCCAGG - Intergenic
1202918988 14_KI270723v1_random:13499-13521 GCCCCTTGCAGTCAGGGCCCAGG + Intergenic
1202925641 14_KI270724v1_random:21496-21518 GCCCCTTGCAGTCAGGGCCCAGG - Intergenic
1132189526 15:99839608-99839630 GCCCTTTGTAAGCAAGGCCCAGG + Intergenic
1132194120 15:99897357-99897379 GCCCTTTTTAGTCATGGCTGGGG + Intergenic
1134450248 16:14358896-14358918 GCCCATTTTGGGCAGGGCCCTGG + Intergenic
1135327290 16:21534805-21534827 GCACACTGTGGTCATGGCCCAGG - Intergenic
1136232846 16:28897419-28897441 GCCCACTGTAGCCTTGGCTCTGG - Intronic
1136337639 16:29620828-29620850 GCACACTGTGGTCATGGCCCAGG - Intergenic
1137035589 16:35566946-35566968 GCCCACTGTAGGCAGGGCACAGG + Intergenic
1137036053 16:35570917-35570939 GCCCACTGTAGGCAAGGCCCAGG + Intergenic
1139449328 16:67017262-67017284 GCCCCCTGTAGCCATGGTCCAGG + Intergenic
1140653840 16:77118965-77118987 GACCACTGTTGTCATGGCCCAGG + Intergenic
1142572012 17:880912-880934 GCCCCTTGGAGCCCTGGCCCAGG - Intronic
1144006649 17:11106266-11106288 GCCCACTGTAGTCATAAGCCAGG - Intergenic
1145241411 17:21242786-21242808 GCCCAGTGCAGGCAGGGCCCTGG - Exonic
1147578155 17:41614238-41614260 GCCCATGGTGGGCATGGCCTTGG + Intronic
1147625744 17:41898711-41898733 GGCCATTGTGGGCATGGCCCTGG - Exonic
1158004495 18:52656712-52656734 GACCATTAAAGTCAAGGCCCTGG - Intronic
1158416447 18:57253200-57253222 CCCCATTGGAGTCATGGCTTCGG - Intergenic
1163826795 19:19528593-19528615 GCCAATTGTAGGCATGGCGAGGG + Intronic
1164099731 19:22044130-22044152 GCCCTCTGTAGTCAGGGCCAAGG + Intergenic
1164120257 19:22259554-22259576 TCCTTTTGTAGACATGGCCCAGG + Intergenic
1164129715 19:22350538-22350560 GCCCCTTGTAGACAGGGCCCTGG - Intergenic
1164169833 19:22715488-22715510 GCCCCTTGTAGACAGGGCCCTGG + Intergenic
1164181637 19:22824193-22824215 GCCCACTGTGGGCAAGGCCCAGG - Intergenic
1164211551 19:23102054-23102076 GCCCTCTGTAGACAAGGCCCAGG - Intronic
1164227231 19:23256501-23256523 GCCCCCTGTAGTCAAGGCCCAGG + Intergenic
1166504952 19:43365238-43365260 GCCCAGTGTAGGCAGAGCCCGGG - Intergenic
1166505588 19:43369676-43369698 GCCCAGTGTAGGCAGAGCCCGGG + Intergenic
1167712466 19:51120789-51120811 ACCCATTGTTCTCAGGGCCCTGG - Intergenic
925524837 2:4787990-4788012 GCCCCTTTTAGTCATGGCTGGGG + Intergenic
925922304 2:8645844-8645866 CCCCAGTGGAGTCACGGCCCCGG + Intergenic
932330690 2:70896836-70896858 GCCCATTCTGGTCATTCCCCCGG - Intergenic
932340206 2:70958774-70958796 CCCCATTAGAGTCATGGTCCTGG + Intronic
935287301 2:101576431-101576453 GCCCATAGGAGGCATGGCCTTGG + Intergenic
937334100 2:121050300-121050322 GCCCTTTGCAGTCAGGGTCCTGG + Intergenic
939830402 2:147064295-147064317 GCCCATTTTAGTCATGGCTGGGG - Intergenic
942732155 2:179072382-179072404 GCCCACTGTATACAAGGCCCGGG + Intergenic
945503654 2:210610580-210610602 GCCCATTATAGTCATTCCACTGG + Intronic
945995448 2:216432387-216432409 GCCCACTGTAGGCAGGGCACAGG - Intronic
947745925 2:232507253-232507275 GCCCATGGCAGTCCTGGCTCCGG - Intergenic
948446807 2:238039598-238039620 GCCCATTGGAGGCAGAGCCCAGG + Intronic
1169282159 20:4277183-4277205 GCCCCTTGCAGTCAAGGCCAGGG + Intergenic
1170552179 20:17487495-17487517 GCCCAGTGGAGTCATTGACCAGG + Intergenic
1170569316 20:17623962-17623984 GGCCTCTGAAGTCATGGCCCAGG - Intronic
1170736411 20:19017288-19017310 GCCCATGCTGGTCAGGGCCCAGG - Intergenic
1171782959 20:29437816-29437838 GCCCCTTGTAGGCAGGGCCCAGG + Intergenic
1174292353 20:49518067-49518089 GGCCATTGTAGTCATCCCCCAGG + Intronic
1179511417 21:41876585-41876607 TCCTCTTGCAGTCATGGCCCTGG - Intronic
1180869810 22:19139771-19139793 GGGCATTGTACCCATGGCCCTGG + Intronic
1181883237 22:25998309-25998331 GCCCTGTCTATTCATGGCCCAGG + Intronic
950498372 3:13348030-13348052 GCCCATTGCAGGCAGGACCCGGG - Intronic
953394159 3:42553899-42553921 GCTCAATGTAGTCGTGGCTCAGG - Intronic
954535228 3:51354899-51354921 GCCTCTCGTAGTCATGGCCACGG - Exonic
954880868 3:53835287-53835309 GCCCATTGTGGACAAGGCTCAGG + Intronic
955869080 3:63417769-63417791 GCCCCTTTTAGTCATGGCTGGGG + Intronic
956152517 3:66258453-66258475 GTCATTTGTAGTCATGGTCCTGG + Intronic
956277747 3:67521349-67521371 CCCCTGTCTAGTCATGGCCCTGG - Intronic
957082526 3:75648776-75648798 GCCCCTTGTAGGCAGGGCCCAGG - Intergenic
965849690 3:173009408-173009430 GGCCTTTGTAGTCCTGGCCATGG + Intronic
986754581 5:10823800-10823822 GGCCATTGTAGTCAGAGCCTTGG - Intergenic
991017173 5:61944823-61944845 GCTCATTGTGGTGTTGGCCCTGG + Intergenic
992285004 5:75226036-75226058 GCCTATGGTAGTGATGGCCATGG + Intronic
997699302 5:135885266-135885288 GCCCATTGTATGCCTGGCACTGG - Intronic
997731011 5:136175902-136175924 GCTTATGGTAGTCTTGGCCCAGG - Intronic
999363868 5:151008403-151008425 TCCCATTCAAGTCAGGGCCCTGG - Intergenic
1000359619 5:160434905-160434927 TTCTATTGTAGTCATGTCCCTGG + Intergenic
1015274073 6:131366587-131366609 GCCCAAAATAGTCATGGCGCTGG - Intergenic
1025722575 7:64029802-64029824 GCCCACTGTACTCAGGGCACAGG + Intergenic
1025744094 7:64227691-64227713 GCCCACTGTAGGCAGGGCACAGG + Intronic
1025744357 7:64230006-64230028 TCCCACTGTCGGCATGGCCCAGG + Intronic
1025744705 7:64232701-64232723 CCCCTTTGTAATCAGGGCCCAGG + Intronic
1025751588 7:64298544-64298566 TCCCACTGTTGGCATGGCCCAGG + Intergenic
1025784862 7:64635029-64635051 GCACAATGTATTCAGGGCCCAGG - Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1032361549 7:131260420-131260442 TCTCATTGTAGTCATCTCCCTGG - Intronic
1032402223 7:131631262-131631284 GCCCAAGGTAATCATGGCCGTGG - Intergenic
1039799204 8:40939690-40939712 GCCCATTCAGGTCATCGCCCAGG + Intergenic
1040377582 8:46841425-46841447 GCCTCTTGTAGACAGGGCCCAGG - Intergenic
1043924322 8:86020107-86020129 GGCCATTTTAGTCAAAGCCCTGG - Intronic
1046143326 8:110122865-110122887 GCCCATTGTAATTATGCCCAAGG - Intergenic
1049656878 8:143802908-143802930 GCTCCCTGGAGTCATGGCCCAGG + Intronic
1051566428 9:18504610-18504632 GCCCACTTCAGTCATTGCCCAGG + Intronic
1051963771 9:22801090-22801112 GCCCCTTTTAGTCATGGTCCAGG + Intergenic
1052079090 9:24180684-24180706 GTCCATTTTAGTCATGGCTAGGG + Intergenic
1055610667 9:78020878-78020900 GCCCACTTTACTCCTGGCCCAGG - Intronic
1060622690 9:125082181-125082203 GCCCCTTTTAGTCATGGCTGGGG - Intronic
1061054537 9:128215441-128215463 GCCCATCTCTGTCATGGCCCAGG - Intronic
1062417504 9:136459767-136459789 GCCCATGGTAGCCATCGTCCTGG + Exonic
1203442978 Un_GL000219v1:28651-28673 GCCCCTTGCAGGCAGGGCCCAGG + Intergenic
1203513786 Un_KI270741v1:147560-147582 GCCCCTTGCAGGCAGGGCCCAGG + Intergenic
1189123217 X:38417453-38417475 GAGCATTGTAGTCAGGACCCAGG + Intronic
1189426702 X:40908214-40908236 GCTCATTGATGTCATGGACCAGG - Intergenic
1189460302 X:41236908-41236930 GCTCTTTGTTGTCATGTCCCAGG + Intergenic
1192423298 X:71053111-71053133 GGCCGTTGAAGTCATGGGCCTGG - Intergenic
1194300574 X:92181662-92181684 GCCCCTTTTAGTCATGGCTGTGG - Intronic
1196834651 X:119802971-119802993 GTCCATTGAAGTCATGACCATGG - Intergenic
1196837846 X:119829762-119829784 GTCCATTGAAGTCATGACCATGG - Intergenic
1202252886 Y:22891311-22891333 GCCTATTGTTGACAGGGCCCAGG + Intergenic
1202405875 Y:24525060-24525082 GCCTATTGTTGACAGGGCCCAGG + Intergenic
1202464905 Y:25145022-25145044 GCCTATTGTTGACAGGGCCCAGG - Intergenic