ID: 1084381621

View in Genome Browser
Species Human (GRCh38)
Location 11:68816529-68816551
Sequence GGCGGCCGGAGCCAGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084381621_1084381626 -5 Left 1084381621 11:68816529-68816551 CCTTCATCCTGGCTCCGGCCGCC 0: 1
1: 0
2: 2
3: 11
4: 236
Right 1084381626 11:68816547-68816569 CCGCCTTCCTTCAGGCTCCTTGG 0: 1
1: 0
2: 0
3: 24
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084381621 Original CRISPR GGCGGCCGGAGCCAGGATGA AGG (reversed) Intronic
900120962 1:1048457-1048479 GGGGGCAGGAGCCCGGATTAAGG + Intronic
900203066 1:1419957-1419979 GGCAGCTGGAGCCAGGCTGGGGG - Intronic
900329001 1:2124577-2124599 CGAGGCTGGAGTCAGGATGACGG - Intronic
901511732 1:9721077-9721099 GGCGGCCGGGGTCAGGGTGGAGG - Intronic
902585727 1:17437936-17437958 GGCGGCCGAAGCCCGCACGAGGG - Intronic
902888569 1:19424817-19424839 AGCGGCCAAATCCAGGATGATGG - Intronic
903323556 1:22556506-22556528 GGCTGCCTGAGCCAAGCTGAAGG + Intergenic
904433359 1:30479242-30479264 GGTGGGGGCAGCCAGGATGAGGG - Intergenic
904547136 1:31283983-31284005 GGAGGCCGAGGCCAGGAGGATGG + Intronic
904590699 1:31613856-31613878 AGTGGCAGGAGCCAGGAAGAAGG - Intergenic
905218900 1:36430441-36430463 GAGGGCCTGAGCCAGGATGGTGG + Intronic
918072834 1:181145960-181145982 GGAGGCAGGAGCCAAGCTGAAGG - Intergenic
920435087 1:205942327-205942349 GGATGCCAGGGCCAGGATGAGGG + Intronic
922427151 1:225509312-225509334 GGCGGCGGGTGGAAGGATGAGGG + Intronic
923010240 1:230082865-230082887 GGAGCATGGAGCCAGGATGATGG + Intronic
923010291 1:230083101-230083123 GGAGCAGGGAGCCAGGATGATGG + Intronic
923010308 1:230083184-230083206 GGAGCAGGGAGCCAGGATGATGG + Intronic
923546019 1:234923797-234923819 GCCAGCAGGAGGCAGGATGAGGG - Intergenic
924396946 1:243630627-243630649 GGAGGCCAGAGACAGGGTGATGG - Intronic
924548665 1:245053894-245053916 GGCGGCAGGACCTAGGATGGGGG + Intronic
1063115465 10:3068691-3068713 GGGCGCCGGTGCCCGGATGATGG + Intronic
1063410496 10:5833199-5833221 GGCGGAGGGAGCCAGGATGGAGG + Intronic
1063430653 10:5985279-5985301 GGCGGACGGGGCCAGGCAGAGGG + Intergenic
1063614838 10:7592712-7592734 GGCGGCCTCAGCCAGGGTGCTGG + Intronic
1066220576 10:33334323-33334345 GCCGGCCGGGGCGAGGACGAGGG + Exonic
1067280106 10:44864725-44864747 GGCGGGCGGAGCCAAGACGGAGG + Intergenic
1067460790 10:46456818-46456840 GGTGGCTGGAGGCAGGAGGAGGG + Intergenic
1067626401 10:47927782-47927804 GGTGGCTGGAGGCAGGAGGAGGG - Intergenic
1067766628 10:49091994-49092016 GGGAGCAGGAGCCAGGATGCAGG + Intronic
1071438614 10:85669548-85669570 TGGGTCCGGAGCCAGGGTGAGGG - Intronic
1072189121 10:93066311-93066333 GGCGGCAGGAGGCAGGAGGCTGG - Intronic
1073212696 10:101818019-101818041 AGCGGCCGGGGGCAGGAGGATGG - Exonic
1073266387 10:102230736-102230758 GGCGGCCGGAGCCAGCCCGGGGG + Exonic
1075090619 10:119442239-119442261 GGCGGCCTTAGCCAGGGGGAGGG + Intronic
1076421830 10:130337317-130337339 GCCGGCTGGAGCCAGGAAGGTGG - Intergenic
1076466651 10:130687424-130687446 GGCGGCCGTACCCAGCATGGAGG + Intergenic
1077023583 11:430328-430350 GGCGGCCGGCACCAGCATGTAGG + Exonic
1078090706 11:8262931-8262953 GGCGGCTGGCGCGAGGGTGATGG + Intronic
1081594703 11:44450972-44450994 GGATGCAGGAGCCAGAATGAAGG - Intergenic
1081600393 11:44488617-44488639 GGCTGCCAGAGCCAGGAGGGAGG - Intergenic
1082810030 11:57474173-57474195 GGAGGCCTGAGCCAGGATTTGGG + Intronic
1083334155 11:61913145-61913167 TGCAGCCTGAGCCTGGATGAGGG + Intronic
1083941118 11:65896501-65896523 GGTGGCAGGAGCAAGGATGGAGG - Intronic
1084005855 11:66323154-66323176 GGAGGCCTGAGCCAGCATGAGGG + Intergenic
1084030215 11:66476559-66476581 GGCGGCAGCAGGAAGGATGAAGG - Exonic
1084072279 11:66744436-66744458 GGCGGCCAAAGCCCGGATTAGGG + Intronic
1084381621 11:68816529-68816551 GGCGGCCGGAGCCAGGATGAAGG - Intronic
1084530987 11:69727617-69727639 GGCGGTCAGAGCCATGATGGGGG + Intergenic
1084532679 11:69738053-69738075 GGCAGCCGGTGACAGGATGCAGG + Intergenic
1086293389 11:85336623-85336645 GGGGTCCTGAGCCAGGAGGAGGG + Intronic
1088859793 11:113789251-113789273 GGCGGCGGGAGGCAGCATGTAGG + Intergenic
1089135030 11:116242170-116242192 GAAGGCTGGAGCGAGGATGATGG - Intergenic
1089855122 11:121536943-121536965 TGCGGTGGGAGCCAGAATGAGGG + Intronic
1091558601 12:1594207-1594229 GGCGGCCGGAGCCGGAAGGCGGG - Intronic
1091761200 12:3088482-3088504 GCCGGCCACAGCCTGGATGATGG - Intronic
1091788300 12:3256382-3256404 GGCAGTCGCAGCCAGCATGACGG + Intronic
1092109047 12:5945841-5945863 GGCTGCCAGAGGCAGGAGGAGGG + Intronic
1092695973 12:11171582-11171604 GGCCTCCGGGGCCAGCATGATGG + Intronic
1098740749 12:74171005-74171027 AGCGGCTGGAGCAGGGATGACGG - Intergenic
1101874951 12:108591783-108591805 TGGGGACGGAGCCAGGATGGTGG - Exonic
1103209119 12:119154088-119154110 GGAGACCGGAGGGAGGATGACGG - Intronic
1103450289 12:121024113-121024135 GTCGGCCGGATCCAGGATGATGG + Exonic
1103800477 12:123534105-123534127 GGCGGCCGGGGCACGGGTGAGGG - Intergenic
1104887831 12:132121484-132121506 GGAGGCCGGGGCCAGGAGGGAGG + Intronic
1105503998 13:20994506-20994528 AGAGGTCGGAGCCAGGATGCGGG + Intronic
1105845434 13:24290165-24290187 GGCGGGCCCAGCCAGGGTGACGG + Intronic
1106963213 13:35026172-35026194 GGCAGCAGGAGACAGAATGAGGG - Intronic
1113254441 13:108492014-108492036 GGCGGCAGGAGAGAGAATGAGGG - Intergenic
1113647600 13:112010177-112010199 GGCCACCGGATCCAGGATGAGGG + Intergenic
1113656044 13:112068258-112068280 GGCGGCCGCGGCCATGATGCAGG + Exonic
1114529710 14:23388119-23388141 GGGGGCCGCAGCCAGCATGCAGG - Intronic
1114535062 14:23417467-23417489 GGGGGCCGCAGCCAGCATGCAGG - Intronic
1114536381 14:23425534-23425556 GGCAGCTGGAGCTGGGATGAGGG + Intronic
1121410503 14:93745579-93745601 GGGGGCCTGAGCCAGGAGGAAGG - Intronic
1122128895 14:99593758-99593780 GGTGGCCAGAGCCAGGATCCCGG - Intronic
1123040910 14:105489949-105489971 GGCGGCGGGAGCCAGGGGGATGG - Intronic
1123048184 14:105528383-105528405 GGCCGCCGGAGCCAGGAGGGAGG + Intronic
1124822287 15:33058126-33058148 GGAGGCTGAAGCCAGGATGGTGG + Intronic
1125191797 15:37002235-37002257 GGGGGCTGGAGCCAGCAGGACGG - Intronic
1127117416 15:55742503-55742525 CGCGGCCGGAGCCGGGACAATGG + Intronic
1128768800 15:70266799-70266821 GGGGGCCGCAGCCAGACTGAGGG - Intergenic
1128934849 15:71737761-71737783 GAAGGCAGGAGCCAGGAGGAGGG + Exonic
1129467059 15:75730204-75730226 GGCAGCTGGGGCCAGGCTGAAGG - Intergenic
1130707374 15:86246122-86246144 GGGGGCCTGAGGCAGGAGGACGG - Intronic
1132234214 15:100206945-100206967 GACAGCCGGAGCCAGGAAGAAGG + Intronic
1132695251 16:1199126-1199148 GGTGGGCGGAGCCATGATGGGGG - Intronic
1132695277 16:1199222-1199244 GGTGGGCGGAGCCATGATGGGGG - Intronic
1132695303 16:1199319-1199341 GGTGGGCGGAGCCATGATGGGGG - Intronic
1132695329 16:1199415-1199437 GGTGGGCGGAGCCATGATGGGGG - Intronic
1132730244 16:1357380-1357402 GGGGGCGGGGGCCAGGCTGAGGG + Intronic
1132904078 16:2273299-2273321 GGAGGCGTGAACCAGGATGACGG + Intergenic
1133029612 16:3004225-3004247 GGCGGCCGCAGCCAAGCTGGCGG + Intergenic
1133392894 16:5423449-5423471 GGCGTAGGGAGCCAGGATAAAGG - Intergenic
1135016156 16:18926414-18926436 GGCGGGCGGAGCCGGGAGGCGGG - Exonic
1136277367 16:29186937-29186959 GCCAGCCGGAGCCAGGGTGCTGG - Intergenic
1136333249 16:29595348-29595370 GGCGGGCGGAGCCGGGAGGCGGG - Intergenic
1136447933 16:30335379-30335401 GGCGGGCGGAGCCGGGAGGCGGG - Intergenic
1136550341 16:30979468-30979490 GGAGGCCGGAGCCGGGCTGGAGG + Exonic
1136933487 16:34437790-34437812 GGGGCCCGGAGCCAGGACGCCGG - Intergenic
1136971085 16:34974024-34974046 GGGGCCCGGAGCCAGGACGCCGG + Intergenic
1138335915 16:56252760-56252782 TGGGGCCGGGGCCAGGAGGAAGG - Intronic
1139584529 16:67893376-67893398 GGCGGCCCGGCCCAGGACGACGG + Intronic
1141099342 16:81185603-81185625 GGCGGCGGCAGGCAGGATGCTGG + Intergenic
1141483067 16:84319590-84319612 TGGGGCAGGAGCCAGGATCAGGG - Intronic
1141780175 16:86154134-86154156 GCCGGCCAGAGGCAGGAAGAGGG - Intergenic
1141976196 16:87518101-87518123 CCAGGCCGGAGCCAGGCTGAAGG - Intergenic
1142210767 16:88807433-88807455 GGTGGCCTGTGCCAGGATGGTGG + Exonic
1142471266 17:164527-164549 GGAGACGGGAGTCAGGATGATGG - Intronic
1142554592 17:765345-765367 GGAGGCTGGAGCCAGGATGATGG + Intronic
1143470777 17:7173923-7173945 GGCGGCCGGACCCAGGCCGAGGG + Intronic
1144150315 17:12436623-12436645 GGCATCCTGAGCCAGGATGGTGG - Intergenic
1144212156 17:13024669-13024691 GGAAGGCGGAGCCAGGAGGAGGG + Intergenic
1144781376 17:17810118-17810140 GGCGGCCGGATCCACGATCCGGG - Exonic
1147443792 17:40462796-40462818 GGCTTCCCGAGGCAGGATGACGG + Intergenic
1147980689 17:44272275-44272297 GGTGGCTGGAGCCAGGAGGCTGG + Intergenic
1151335218 17:73435667-73435689 GGAGGCAGGAGGCAGGTTGACGG - Intronic
1151346509 17:73506024-73506046 GGAGGCAGGATCCAGGAGGAGGG - Intronic
1152299089 17:79485027-79485049 GGCTCCCAGAGCCAGGATGGAGG + Intronic
1152510141 17:80781182-80781204 GGTGGCCTGAGCTAGGAGGAAGG + Intronic
1154214881 18:12408329-12408351 GGCGGCCGGAGCCGGGGGGGCGG + Intronic
1154241457 18:12657561-12657583 GGCCGCGGGCGCCAGGGTGACGG + Exonic
1156494996 18:37519873-37519895 GGGGGCCTGAGCCAGGAAAAGGG + Intronic
1158437765 18:57445924-57445946 AGCTGCAGGAGCCTGGATGAAGG + Intronic
1160685057 19:430789-430811 GGGGTCCAGAGCCAGGAAGAGGG - Intronic
1160785077 19:896584-896606 GGCTGCAGGAGCCAGGCTGGGGG - Exonic
1160807958 19:1000872-1000894 GACGCCCGGAGTCAGGACGAGGG + Intronic
1160807985 19:1000930-1000952 GACGTCCGGAGTCAGGATGGGGG + Intronic
1161607968 19:5225261-5225283 GGCGACCAGAGCCTGGATGGGGG + Intronic
1161684127 19:5694725-5694747 GGCGGCAGGTGCCAGGAGGGCGG + Intronic
1162035414 19:7935764-7935786 GGTGGCTGGAGGCTGGATGAGGG - Intronic
1162270720 19:9612898-9612920 GGGGGACTGAGGCAGGATGATGG - Intronic
1162349194 19:10138546-10138568 AGGGGCCGCGGCCAGGATGATGG + Exonic
1163431233 19:17268942-17268964 GGCAGCCGCAGCGAGGGTGAGGG + Exonic
1165721227 19:38081460-38081482 GGCAGCCAGGCCCAGGATGAAGG - Exonic
1165792471 19:38500361-38500383 AGGGGTCGGGGCCAGGATGAGGG + Intronic
1166695741 19:44850720-44850742 GGCTGCAGCAGCCAGGATGTAGG - Intronic
1168636721 19:58002610-58002632 GGAGGCCGGAGGCAGGCTGCTGG + Exonic
925048017 2:789289-789311 GGTGGGCTGATCCAGGATGATGG - Intergenic
925141261 2:1551091-1551113 GGACGCCGGGGCCAGGGTGAGGG + Intergenic
925187661 2:1860268-1860290 GGCCGCCGGAGCCAGTATTGGGG + Intronic
927772772 2:25878250-25878272 GGCGGCCGGAGCCCGGACACGGG - Intronic
928394821 2:30935447-30935469 GGCGGCAGCAGCCAGCCTGAAGG - Intronic
929858712 2:45657014-45657036 GGCAGGCGGAGCAAGGATTAGGG + Intronic
930023545 2:47015771-47015793 GGTGGGCAGAGCCAGGAAGATGG + Intronic
932089915 2:68797387-68797409 GGCTGCCATAGCCAGGATGGAGG - Intronic
932164591 2:69494466-69494488 GGCTGCAGAAGCCAGGAAGAAGG - Intronic
932702872 2:74002944-74002966 GGCAGCTGGAGGCAGGAAGATGG + Intronic
932777260 2:74535721-74535743 GGGGGCCGCAGCCAACATGAGGG - Exonic
934670395 2:96208731-96208753 GGCGCCCGGGGCCGGGATGCAGG + Exonic
935627575 2:105184105-105184127 GGAGGCCGGGCCCAGGCTGAGGG - Intergenic
937277276 2:120693043-120693065 GGATGCCGGTGCCAGGAAGAGGG - Intergenic
938058841 2:128236599-128236621 GGCAGCCGCAGCCAGGGAGATGG + Intergenic
938570952 2:132561379-132561401 GGGGGCAGGAGCCAGGACCATGG - Intronic
940161331 2:150717003-150717025 GGCGGCCCCAGCCATCATGAAGG - Intergenic
944715974 2:202376429-202376451 GGCGGCGGGAGGGCGGATGAAGG - Intergenic
946170068 2:217889878-217889900 GGAGGCTGCAGCCAGGATGGTGG - Intronic
1171114390 20:22512096-22512118 GGCGGTCAGAGCCTGGATAATGG + Intergenic
1172310680 20:33915963-33915985 GGAGGCCAGAGCCAGCAGGAAGG - Intergenic
1176075296 20:63245518-63245540 TGGGGCTGGAGCCAGGAGGATGG - Intronic
1176178645 20:63739801-63739823 GGCGGCCGGATCCAGGGCGGGGG + Intronic
1178789495 21:35686961-35686983 TGAGGGCAGAGCCAGGATGAAGG - Intronic
1180101609 21:45590371-45590393 GGCGGCCGGGGCCGAGATGGAGG - Intergenic
1180594986 22:16967249-16967271 GGATGCCGGAGCCAGGCAGAAGG + Intronic
1182236870 22:28883358-28883380 GGGGGGCGGAGCTGGGATGATGG + Intergenic
1183466747 22:37983917-37983939 GGCGGCCCGAGACAGGACGTGGG + Intronic
1183692141 22:39396478-39396500 GGTGGCCGGGACCAGGATGGTGG - Intergenic
1184412909 22:44336282-44336304 GGCGGAGGGAGGGAGGATGAGGG - Intergenic
1184795848 22:46731935-46731957 GGCGGCTGAACCCTGGATGATGG - Intronic
1184960033 22:47922038-47922060 GAGGGCCTGAGCCAGGATGGTGG - Intergenic
949855394 3:8456755-8456777 TGGAGCTGGAGCCAGGATGAGGG - Intergenic
950015252 3:9750452-9750474 GGCGGCAGGAGCCAGTCCGAGGG - Intronic
950865797 3:16188147-16188169 TACAGCCGGAGCCAGGATAATGG - Intronic
954031457 3:47822986-47823008 GGGGGGCTGAGCCAGGATAATGG + Intronic
954428087 3:50454167-50454189 GGCTTCCGGAGCCTGGCTGAGGG - Intronic
954622362 3:52003427-52003449 AGAGGCCTGAGCCGGGATGAGGG + Intergenic
954973127 3:54668367-54668389 TGCTGCTGGAGCTAGGATGATGG + Intronic
958942872 3:100334662-100334684 CCCGGCCGGGGCCAGGAGGAGGG + Intergenic
960702310 3:120450817-120450839 GGCGGCCGGAGCGAGCCTGCGGG - Intronic
960875287 3:122289598-122289620 GCCGGGCAGAGCCAGCATGAAGG + Intergenic
961044893 3:123701368-123701390 AGCTGCCGGGGCCAGGAGGAAGG + Intronic
961684800 3:128622382-128622404 AGCCGCAGAAGCCAGGATGAAGG - Exonic
963853746 3:150233215-150233237 GGCTGCCGTGGCAAGGATGATGG + Intergenic
966883607 3:184362744-184362766 GGTGGCGGGAGCCCGGCTGAAGG + Intronic
967055335 3:185825092-185825114 GGTGGGGGGAGCCAGGCTGAGGG - Intergenic
967076001 3:186002765-186002787 GGCGGCAGGAGAGAGAATGAAGG - Intergenic
968626828 4:1629563-1629585 GGCAGCCACAGGCAGGATGAGGG - Intronic
969340095 4:6535094-6535116 GGCGGCAGGAGCCAGGGTCGGGG + Intronic
969697022 4:8740766-8740788 GGCTGCAGGAGGCAGGCTGATGG - Intergenic
972670932 4:41213933-41213955 GGAGGCCGGTGCCAGGACAAGGG + Intronic
982438940 4:155411732-155411754 GGCTGTCGCAGCCAGGATGGAGG - Intergenic
982804564 4:159748181-159748203 GTCTGCTGGAGCCAGGCTGATGG + Intergenic
983229211 4:165112749-165112771 GGCGGCGGGGGGCAGGATGGAGG - Exonic
986128933 5:4909496-4909518 GGCGGCAGGAGAGAGAATGAGGG + Intergenic
992056491 5:72996543-72996565 GGGGGAGGGAGCAAGGATGAAGG - Intronic
992987677 5:82250402-82250424 GGCTACAGGATCCAGGATGAGGG + Intronic
995735647 5:115296829-115296851 GCCGGGCGGAGCCGGGATGCAGG + Exonic
997103724 5:130995327-130995349 GGCGCCTGGAGCGGGGATGACGG - Intergenic
997305078 5:132830672-132830694 CGCGGCCGGAGCCTGGAGGTGGG - Exonic
997591088 5:135072759-135072781 GGAGGCCAGAGACAGGATCATGG - Intronic
999256036 5:150210505-150210527 GGTGGCCTGAGCCAGGGTGCTGG + Exonic
999818086 5:155197911-155197933 GGAGGCAGGAGACAGGATCAAGG - Intergenic
1001450509 5:171820894-171820916 GTGGGCCGGGGCCAGGAGGAGGG - Intergenic
1001641294 5:173245886-173245908 AGGGGCGGGAGCCAGGATGAGGG + Intergenic
1002047557 5:176550401-176550423 GGTGCCCGGAGCAAGGATGTGGG - Intronic
1002285885 5:178162411-178162433 TGTGGCCTGATCCAGGATGATGG + Intergenic
1003325317 6:5086062-5086084 AGCGGCCGGAGCCGGGAAGGCGG - Exonic
1005594684 6:27368089-27368111 GGAGGCTGGAGCCGGGTTGAGGG + Intergenic
1006392649 6:33767732-33767754 GGCAGCTGGAGACAGGAAGAGGG + Intergenic
1007594115 6:43040867-43040889 GCTGGCGGGAGGCAGGATGATGG - Intronic
1014632418 6:123803473-123803495 GGCGGCAGGGAGCAGGATGAAGG + Intergenic
1015592833 6:134838921-134838943 GGCGGCAGGAGAGAGAATGAGGG + Intergenic
1017124373 6:151051867-151051889 GGAGGGCGCAGCCAGGGTGATGG - Intronic
1017620714 6:156293822-156293844 GGCGGGCGGTGACTGGATGATGG - Intergenic
1017713433 6:157190388-157190410 GCCAGCCGGGGACAGGATGAGGG - Intronic
1018651454 6:165994955-165994977 GGATGCAGGAGCCAGGTTGAGGG - Intergenic
1018797324 6:167196444-167196466 GGCGGCCTGTGCCAGGGTGGAGG - Intronic
1018818973 6:167358320-167358342 GGCGGCCTGTGCCAGGGTGGAGG + Intronic
1019159183 6:170057917-170057939 GGAGGCAAGAGCCAGGATGTGGG - Intergenic
1019731211 7:2630624-2630646 AGCTGCCAGAGCCAGGAGGATGG - Intergenic
1019907108 7:4073141-4073163 GGCGCCCGGAGCCAGGAGCGGGG - Intronic
1020771709 7:12403758-12403780 GGCCGCGGGTGCCAGGAGGATGG + Exonic
1022099742 7:27161911-27161933 GGCGGGCGGTGCGAGGATGCAGG + Intergenic
1023815172 7:43943920-43943942 GGCAGCAGGAGCCAGGGTGGTGG + Intronic
1023871503 7:44265440-44265462 GTGGGCCAGAGCCAGGCTGAGGG + Intronic
1024501670 7:50116218-50116240 GGGGGGCTGAGGCAGGATGATGG - Intronic
1025249548 7:57342823-57342845 GCTGTCAGGAGCCAGGATGAAGG - Intergenic
1026944337 7:74306453-74306475 GGAGGCAGGAGCCAGGAAGCGGG - Intronic
1029169583 7:98621167-98621189 GGTGGCCAAAGCCATGATGATGG - Intronic
1029422212 7:100477575-100477597 GGTGGACGGAGCCAGGAGGTGGG + Exonic
1029640831 7:101817648-101817670 CGTAGCCGGAGCCAGGTTGAAGG + Intronic
1034659988 7:152760225-152760247 GACGGCCGGAGCCGGGCTGCGGG - Intronic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1040355896 8:46617746-46617768 GGCGGCGGGAGGCAGCAAGAAGG + Intergenic
1044734785 8:95268703-95268725 GGCAGCCAGAAACAGGATGAAGG + Intronic
1045277585 8:100721655-100721677 GGGGGCCGGAGCCGGGGGGAGGG + Exonic
1047896117 8:129368402-129368424 GGTGGCTGAAGCTAGGATGAAGG + Intergenic
1049707854 8:144051089-144051111 GGGGGCGGGAGTCAGGTTGAGGG - Intergenic
1055766054 9:79664691-79664713 GGCAGCGGGAGGCAGGAGGAGGG - Intronic
1057125557 9:92613515-92613537 GGAGGCAGGAACCAGGATAAGGG - Exonic
1057432191 9:95004797-95004819 GGCGGCCGGAGCCCGGGAGCGGG + Intronic
1057527609 9:95816565-95816587 GGAGGTAGGAGCCAGGATGGGGG + Intergenic
1061287224 9:129630996-129631018 GGCAGACGGGGCCTGGATGAGGG - Intronic
1061804093 9:133128523-133128545 GGAGTCCGGGGCCAGGATGGCGG - Intronic
1061961635 9:133991851-133991873 GGCGGCGCGACCCAGGCTGAGGG + Intronic
1062024237 9:134333002-134333024 GGGGGCCGGAGCCAGGGCCAGGG - Intronic
1062295923 9:135826499-135826521 GGCTGCCGGAGTCAGGAGGAAGG - Intronic
1062393289 9:136342532-136342554 GGCGGCCCCAGCCAGGCTGCCGG - Intronic
1193062325 X:77220073-77220095 GGCAGCCGCAGCTAGGGTGATGG - Intergenic
1199601019 X:149541145-149541167 GGCCACCGGAGCCAGGACGATGG - Exonic
1200099726 X:153684648-153684670 GGCAGCTGGAGACAGGATGGGGG - Intronic