ID: 1084384890

View in Genome Browser
Species Human (GRCh38)
Location 11:68837375-68837397
Sequence AGCGTTAGGAAAGCTGTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084384885_1084384890 19 Left 1084384885 11:68837333-68837355 CCACTGCGCTTAGCTGACAGTTT 0: 1
1: 0
2: 3
3: 57
4: 351
Right 1084384890 11:68837375-68837397 AGCGTTAGGAAAGCTGTCTGTGG 0: 1
1: 0
2: 1
3: 10
4: 132
1084384888_1084384890 -6 Left 1084384888 11:68837358-68837380 CCAGGGCATCAGAACACAGCGTT 0: 1
1: 0
2: 0
3: 13
4: 134
Right 1084384890 11:68837375-68837397 AGCGTTAGGAAAGCTGTCTGTGG 0: 1
1: 0
2: 1
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084384890 Original CRISPR AGCGTTAGGAAAGCTGTCTG TGG Intronic
902022826 1:13360217-13360239 AGCATTATGAAAGCTTACTGTGG + Intergenic
902343406 1:15799183-15799205 AGGGTTAAGAATGCTCTCTGGGG + Intergenic
907317088 1:53579416-53579438 AGCCTTTCAAAAGCTGTCTGAGG - Intronic
909712818 1:78672324-78672346 ATCGTTGAGAGAGCTGTCTGGGG + Intergenic
911719548 1:101176090-101176112 AGCATTAGGAAAACTGCCTCAGG - Intergenic
913071721 1:115304820-115304842 AGTGGCAGGACAGCTGTCTGAGG + Intronic
915163282 1:153934083-153934105 GTGGTTAGGAAAGCTGACTGGGG + Intronic
917086261 1:171308180-171308202 ACCTTGAGGACAGCTGTCTGGGG - Intergenic
918342406 1:183578665-183578687 AGCATTAGAAAAACTATCTGGGG - Intronic
919030983 1:192242424-192242446 AGGCTCAGGAAAGCTGCCTGGGG + Intergenic
919558832 1:199093854-199093876 ACCTTGAGGACAGCTGTCTGAGG - Intergenic
920502989 1:206497107-206497129 ATCATTTGGAAAGCTGTGTGAGG + Intronic
921932826 1:220769271-220769293 AGTGATAAGAAAGCTGTGTGAGG - Intronic
922555129 1:226527109-226527131 AGGGTAAGGGAGGCTGTCTGGGG + Intergenic
1067802379 10:49368004-49368026 GGCATTAGGAAGGCTGTCTTGGG - Intronic
1068971783 10:62966525-62966547 TGCATTAAGAAAGCTGTGTGGGG + Intergenic
1070311774 10:75279027-75279049 GGAGTTTGGGAAGCTGTCTGTGG + Intergenic
1070506548 10:77118389-77118411 AGCTTTAGGACAACTCTCTGAGG - Intronic
1071324596 10:84500152-84500174 AGCCTTATGGAAGCTGTCTGAGG + Intronic
1071815654 10:89230124-89230146 AGCGTTAGGTAAGCAGCTTGAGG - Intronic
1072784792 10:98272366-98272388 AGCCACAGGACAGCTGTCTGTGG - Intergenic
1073992410 10:109277233-109277255 AGACTTATCAAAGCTGTCTGAGG + Intergenic
1075345075 10:121676079-121676101 AGCTCCAAGAAAGCTGTCTGGGG - Intergenic
1079104896 11:17564261-17564283 AGCTGTATGGAAGCTGTCTGAGG - Intronic
1084365142 11:68692884-68692906 AGCGGCAGGAAAGCTTGCTGGGG - Intergenic
1084384890 11:68837375-68837397 AGCGTTAGGAAAGCTGTCTGTGG + Intronic
1086006816 11:82047529-82047551 AGTGTGATGAAAGCTGTCAGTGG - Intergenic
1087994175 11:104782866-104782888 AGGTTGAGGAAAGCTGCCTGAGG - Intergenic
1091198710 11:133753800-133753822 AGTGCTAGAAAAGCTGCCTGTGG - Intergenic
1091794298 12:3288608-3288630 AGCCTTTAGAAAGCTGGCTGTGG + Intergenic
1094155603 12:27333748-27333770 AGCTTCAGGAAAGCCGTCAGTGG + Intronic
1094712414 12:32978235-32978257 AGGAGTAGGAAAGCTGACTGAGG + Intergenic
1095383612 12:41624715-41624737 AGGGTTAAGGAAGCTCTCTGGGG + Intergenic
1096574619 12:52544882-52544904 AGCATTAGGGAAGCTGTCTTTGG - Intronic
1098631813 12:72732494-72732516 AGGCTCAGGAAAGCTGCCTGGGG + Intergenic
1104743224 12:131193979-131194001 ATGGTCAGGAAAGCTCTCTGAGG + Intergenic
1105457608 13:20555829-20555851 TCCGTCAGGAAAGCAGTCTGTGG - Intergenic
1108091013 13:46849703-46849725 AGGGTGAGGAAGGCTGACTGGGG - Intronic
1110849727 13:80231555-80231577 AGCGTTAGCAAAAAGGTCTGAGG - Intergenic
1110856895 13:80306490-80306512 AGCTTGTGGAAAGCTCTCTGTGG + Intergenic
1110987310 13:81986632-81986654 AGGGTGAGGGAAGCTATCTGGGG + Intergenic
1115270049 14:31541287-31541309 AAAGTTAGGAAAGCTGGGTGAGG - Intronic
1118498162 14:66329419-66329441 AGTGTTAGGAAGGCTCTGTGTGG - Intergenic
1121530324 14:94648231-94648253 AGGCTCAGGAAAGCTGCCTGGGG + Intergenic
1124244085 15:28055583-28055605 AGGCTTAGGAAAGCTATGTGTGG + Intronic
1124350687 15:28953553-28953575 AGTGTCAGGAGAGGTGTCTGTGG - Intronic
1127816291 15:62611936-62611958 AGTGTTAGCAAAGATGTCAGTGG + Intronic
1131133042 15:89912471-89912493 AGCCTTCGGAGACCTGTCTGGGG + Intronic
1135247655 16:20870876-20870898 AGCTGTAGAAAAGCTGTCTGAGG - Intronic
1137341869 16:47615322-47615344 GGAGTCAGGAAAGCCGTCTGGGG + Intronic
1140348103 16:74234363-74234385 AGGGTTGGGGAAGCTCTCTGGGG - Intergenic
1144343051 17:14326376-14326398 GGCTTTTGGAAAGATGTCTGTGG + Intronic
1144374725 17:14627691-14627713 AGCGTAGGGAAAGGTGACTGGGG + Intergenic
1147245333 17:39116567-39116589 AGGTTTGGGAATGCTGTCTGTGG - Intronic
1160594039 18:79962141-79962163 GTGGTTAGGAAAGCTGCCTGTGG + Intergenic
1161598088 19:5162619-5162641 ACCTTGAGGACAGCTGTCTGGGG + Intronic
1162452527 19:10763681-10763703 AGCATTAGCAAAGCAGTGTGGGG + Intronic
1165253986 19:34561960-34561982 AGGGTCAAGACAGCTGTCTGGGG + Intergenic
931019948 2:58032824-58032846 AGGCTCAGGAAAGCTGGCTGGGG - Intronic
931039963 2:58286297-58286319 AGGCTCAGGAAAGCTGCCTGTGG + Intergenic
932009207 2:67958598-67958620 AGGCTTAGAAAAACTGTCTGGGG + Intergenic
933626999 2:84612488-84612510 AACTTCAGGGAAGCTGTCTGAGG - Intronic
933785539 2:85838341-85838363 AGCATTAAGAACGTTGTCTGAGG + Intergenic
934150964 2:89147162-89147184 AGGCTCAGGAAAGCTGCCTGGGG + Intergenic
934216309 2:90034863-90034885 AGGCTCAGGAAAGCTGCCTGGGG - Intergenic
935210466 2:100935501-100935523 TGCTTTAAGAAAGCTGGCTGTGG - Intronic
936779446 2:116014454-116014476 AGAGTGAGGAAAGCTTTATGAGG + Intergenic
937740551 2:125347638-125347660 AGCCTTAGGAAAGTTGTAGGGGG - Intergenic
938564965 2:132510343-132510365 AGGCTCGGGAAAGCTGTCTGGGG + Intronic
940031016 2:149261362-149261384 AGCCTTAGGACAGCTTTCTCTGG + Intergenic
940083135 2:149827709-149827731 AGCCTCAGGAAAGCTACCTGGGG + Intergenic
941262815 2:163318481-163318503 ACTATTAGGAAAGCTGTATGTGG + Intergenic
944667354 2:201968790-201968812 AGAGGTAGGAAAGGTGACTGTGG + Intergenic
948476558 2:238224550-238224572 AGTGTTAGGGAAGCCGCCTGAGG + Intronic
1169045011 20:2528206-2528228 AGAGTTAGGAGAGCGCTCTGTGG - Intergenic
1169271656 20:4204217-4204239 AGGCTCAGGAAAGCTGCCTGGGG + Intergenic
1169531461 20:6489696-6489718 CACTTTGGGAAAGCTGTCTGTGG - Intergenic
1172168403 20:32913328-32913350 AGGGTTAAGAAATCTCTCTGGGG + Intronic
1180140202 21:45888604-45888626 GGCGGGAGGAAAGCTGCCTGTGG - Intronic
1180725525 22:17944078-17944100 GGCCTTAGGAAAGCTGTTTTTGG + Intronic
1181329345 22:22077124-22077146 AGCCCCAGGAAAGCTGTCAGAGG + Intergenic
1182065524 22:27428839-27428861 AGTGTTGGCAGAGCTGTCTGGGG - Intergenic
1185421709 22:50738595-50738617 CGGGTTGGGACAGCTGTCTGTGG - Intronic
955157258 3:56428812-56428834 AGTGTAAGTAAACCTGTCTGGGG - Intronic
959461248 3:106628639-106628661 AGGCTCAGGAAAGCTGCCTGGGG + Intergenic
960291091 3:115885810-115885832 AGCCTTAAGAGAGCTGTCCGTGG - Intronic
960615643 3:119593657-119593679 AGGCTTAGGAAAGCTGCCTGTGG + Intergenic
961132282 3:124480106-124480128 AGCTTAAGGAAAGCTGCATGTGG - Intronic
961801388 3:129452806-129452828 AGGGTTAGGACATCTGTGTGAGG + Intronic
963915166 3:150852530-150852552 AGGCTCAGGAAAGCTGCCTGGGG - Intergenic
966888703 3:184390801-184390823 AGTGTTAGGCATGCTGTATGTGG + Intronic
970270279 4:14339305-14339327 AATGTTAGCAGAGCTGTCTGGGG + Intergenic
972123491 4:35735304-35735326 AATATCAGGAAAGCTGTCTGGGG + Intergenic
974258014 4:59487476-59487498 AGGCTCAAGAAAGCTGTCTGAGG + Intergenic
975556460 4:75670724-75670746 AGCCTAAGGAAAGGTGTTTGGGG + Intronic
975885204 4:78956885-78956907 AGGCTCAGGAAAGCTGCCTGGGG - Intergenic
978948491 4:114527651-114527673 AACGTCTAGAAAGCTGTCTGGGG + Intergenic
980349803 4:131670104-131670126 AGACTCAGGAAAGCTGTCTAGGG + Intergenic
986073610 5:4312043-4312065 AGGATTAGGAAACCTGGCTGAGG - Intergenic
990050621 5:51494989-51495011 AGGGTTAGGTAAGCTGTCTCAGG + Intergenic
990276876 5:54206559-54206581 AGAGTTAGGAAAACCCTCTGTGG + Intronic
991660204 5:68943354-68943376 AGTGTTTGCAATGCTGTCTGTGG - Intergenic
995434594 5:112121005-112121027 AGGCTTAGGAAAGCTTCCTGTGG - Intergenic
996256404 5:121409399-121409421 AGGGGTAGGAAATCTGTCTGTGG + Intergenic
997024550 5:130042991-130043013 AGCTTTAGGATAACTATCTGAGG - Intronic
997629715 5:135357526-135357548 GGAGTTAGGAAGGCAGTCTGAGG - Intronic
998830436 5:146152241-146152263 AGTGTTGGGAAAGGTGTGTGTGG - Intronic
998893414 5:146771020-146771042 TGCAGCAGGAAAGCTGTCTGTGG - Intronic
999421878 5:151451416-151451438 GAAGTTAGGAAATCTGTCTGTGG + Intronic
1004388737 6:15191535-15191557 AGCCCTAGGAAAGGTGTCTTTGG - Intergenic
1004531481 6:16459001-16459023 ATCTTGAGGACAGCTGTCTGGGG - Intronic
1008286623 6:49660649-49660671 AGGCTCAGGAAAGCTGCCTGGGG - Intergenic
1010339575 6:74732535-74732557 AGGGTCAAGAGAGCTGTCTGGGG - Intergenic
1011887169 6:92110325-92110347 AACGTTAGGACAGCTGCTTGGGG + Intergenic
1015148496 6:130014431-130014453 GGGGTTAGGAAAGCAGTCTGTGG + Intronic
1015720891 6:136240788-136240810 AGAGTTAGAAAAGCTTACTGAGG + Intronic
1015880795 6:137868024-137868046 AGCGTCTGGGAAGCTGTCTCTGG - Intronic
1017953830 6:159161679-159161701 AGCCTGAGGACATCTGTCTGCGG + Intergenic
1018422733 6:163653352-163653374 AGGGCAAGGGAAGCTGTCTGGGG - Intergenic
1019335353 7:480158-480180 AGCGTCAGGAAAGGAGTGTGGGG + Intergenic
1020206011 7:6116810-6116832 AGTGATAGGAAAGCTGTCTGTGG - Intronic
1021405263 7:20260408-20260430 AGGGGAAGGAAAGCTGACTGTGG - Intergenic
1022466388 7:30655531-30655553 AGCCTCAGGAAAGCTCACTGTGG + Intronic
1022922771 7:35033246-35033268 AGGGTCAGGAAAGGTCTCTGGGG - Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1034375632 7:150641553-150641575 AGATTCAGGAAAGCTGCCTGGGG + Intergenic
1037710247 8:21349604-21349626 AGGCTTAGGAAAGCTGCCTGGGG - Intergenic
1038815112 8:30894913-30894935 AGCGAAAAGACAGCTGTCTGTGG + Intergenic
1039371382 8:36987320-36987342 AGCGTTTGGAAATCTCGCTGCGG - Intergenic
1041329934 8:56713907-56713929 AGGGGCAGGAAAGCTGTCTGGGG - Intergenic
1046719481 8:117603140-117603162 AGCGTTAGTAAAGCAAGCTGTGG - Intergenic
1048108773 8:131443103-131443125 AGGCTTAGAAAAGCTGGCTGGGG + Intergenic
1049048307 8:140170661-140170683 AGCCTTAGAAAAGCAGTCTCAGG + Intronic
1053409560 9:37906757-37906779 AGCCTTACGCAAGCTGTCAGTGG + Intronic
1056067285 9:82949801-82949823 GGTGTCAGCAAAGCTGTCTGAGG + Intergenic
1056069895 9:82975319-82975341 AGTGTTACGAAAGCTGAGTGAGG + Intergenic
1057693838 9:97309937-97309959 GGGGTCAGGAAAGCTCTCTGAGG + Intronic
1060282725 9:122225212-122225234 AAGGATAGGAAAGATGTCTGTGG + Intronic
1061155142 9:128855409-128855431 AGCATTATGAAAGCTTACTGTGG + Intronic
1061210049 9:129186257-129186279 AGGGTTAAGCAAGCTGGCTGTGG - Intergenic
1185767893 X:2740841-2740863 AGGGTTAGAACAGCTGCCTGAGG + Exonic
1191785689 X:64915140-64915162 AGCCTTAGCCAAGCTGTCTGAGG + Intergenic
1196419274 X:115506312-115506334 ACCTTGAGGACAGCTGTCTGGGG + Intergenic
1199216742 X:145267729-145267751 AGGGTTAGTATTGCTGTCTGTGG - Intergenic