ID: 1084385241

View in Genome Browser
Species Human (GRCh38)
Location 11:68839556-68839578
Sequence CGCAGGGCTCGACCTTCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084385241_1084385246 -7 Left 1084385241 11:68839556-68839578 CCGTGGGAAGGTCGAGCCCTGCG 0: 1
1: 0
2: 0
3: 5
4: 139
Right 1084385246 11:68839572-68839594 CCCTGCGGTGCCCAGCTGTGGGG 0: 1
1: 0
2: 3
3: 30
4: 267
1084385241_1084385248 2 Left 1084385241 11:68839556-68839578 CCGTGGGAAGGTCGAGCCCTGCG 0: 1
1: 0
2: 0
3: 5
4: 139
Right 1084385248 11:68839581-68839603 GCCCAGCTGTGGGGACAGCTCGG 0: 1
1: 0
2: 3
3: 47
4: 385
1084385241_1084385243 -9 Left 1084385241 11:68839556-68839578 CCGTGGGAAGGTCGAGCCCTGCG 0: 1
1: 0
2: 0
3: 5
4: 139
Right 1084385243 11:68839570-68839592 AGCCCTGCGGTGCCCAGCTGTGG 0: 1
1: 0
2: 3
3: 31
4: 228
1084385241_1084385244 -8 Left 1084385241 11:68839556-68839578 CCGTGGGAAGGTCGAGCCCTGCG 0: 1
1: 0
2: 0
3: 5
4: 139
Right 1084385244 11:68839571-68839593 GCCCTGCGGTGCCCAGCTGTGGG 0: 1
1: 0
2: 0
3: 26
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084385241 Original CRISPR CGCAGGGCTCGACCTTCCCA CGG (reversed) Intronic
900639298 1:3681221-3681243 GGCAGGCCTGGACCTGCCCACGG - Intronic
901730190 1:11273426-11273448 AGCAGGGCCCGACCTTCCTTCGG - Exonic
903951649 1:26999127-26999149 CTCAGGGCTCAAGCCTCCCAAGG + Intronic
909086158 1:71172265-71172287 CACAGGGGTGGAGCTTCCCAAGG - Intergenic
911265094 1:95733889-95733911 CAAAGGGCTCAAACTTCCCAGGG + Intergenic
911788358 1:101979900-101979922 CACAGGGGTGGAGCTTCCCAAGG + Intronic
913117456 1:115710594-115710616 GGCTGGCCTCTACCTTCCCATGG + Intronic
915321329 1:155057949-155057971 CGCAGGGCTCGCCATCCCCTAGG - Exonic
922757823 1:228106266-228106288 CCCAGGGCAGGACCTTCCCTGGG + Intergenic
923878313 1:238075145-238075167 CACAGGGGTGGAGCTTCCCAAGG - Intergenic
1064436090 10:15312499-15312521 CGGGGGGCTCCACCTTCTCAGGG + Intronic
1065236815 10:23660442-23660464 CTCAGGGCATGCCCTTCCCATGG + Intergenic
1067085607 10:43236767-43236789 CTCAGGGCTCGCCCCTCCCTCGG + Intronic
1072660629 10:97361478-97361500 CCCAGGGCTCCAGCTACCCAGGG + Intronic
1075631440 10:124003096-124003118 CCCAGGGCTCGGCCTTGCCCAGG - Intergenic
1077797398 11:5507107-5507129 TGCAGGCCTCGACCTTCAAAAGG + Intronic
1080679893 11:34464657-34464679 TGCAGGGCTCGTCCTTCACGTGG + Intronic
1082862309 11:57868122-57868144 CACAGGGGTGGAGCTTCCCAAGG - Intergenic
1084385241 11:68839556-68839578 CGCAGGGCTCGACCTTCCCACGG - Intronic
1084779552 11:71399421-71399443 CGCAGGGCTGGTCCCTCCCAAGG + Intergenic
1096070621 12:48773697-48773719 TGCAGGGCTCTCCCTGCCCAAGG - Intronic
1097571206 12:61334837-61334859 CACAGGGGTTGAGCTTCCCAAGG - Intergenic
1098741514 12:74178901-74178923 CGCAGGGGTGGAGCTCCCCAAGG - Intergenic
1099796744 12:87409588-87409610 CACAGGGGTGAACCTTCCCATGG + Intergenic
1102119335 12:110428790-110428812 GGCAGGGCCCCACCTTCCCTGGG + Intergenic
1103846251 12:123903703-123903725 CGCATGGCTTGGCCTCCCCAGGG + Intronic
1107810938 13:44199098-44199120 CGCAGGGCAGAACCTCCCCAGGG + Intergenic
1107946108 13:45418685-45418707 CGCAGGGGGCAACCTTCTCACGG + Intergenic
1110868369 13:80422630-80422652 CGCAGGGATGGAGCTTCCAAAGG - Intergenic
1110929161 13:81194083-81194105 CACAGGGGTGGAGCTTCCCAAGG - Intergenic
1111105675 13:83642590-83642612 CACAGGGGTGGAGCTTCCCAAGG - Intergenic
1114171134 14:20273363-20273385 CACAGGGGCAGACCTTCCCAAGG + Intronic
1118892421 14:69921331-69921353 AGTAGGCCTGGACCTTCCCAGGG + Intronic
1122824852 14:104364634-104364656 AGCAGGGGTCACCCTTCCCAGGG + Intergenic
1125608554 15:40956100-40956122 CCCAGGCCTCCACCTCCCCAGGG + Exonic
1129607597 15:77032440-77032462 CTCAGGGCCGGGCCTTCCCAGGG - Intronic
1129802826 15:78429143-78429165 CGCCGGCCTCGACCTCCCAAAGG + Intergenic
1130026053 15:80271420-80271442 CGTAGGGCTCGATGGTCCCAGGG + Intergenic
1132578464 16:674638-674660 CCCAGGGCGTGGCCTTCCCAAGG + Intronic
1132765994 16:1534439-1534461 CCCAGGGCTCGGCCCTCCCCGGG - Exonic
1135401965 16:22172164-22172186 CCCAGGGCTGCACCTTCCCTGGG - Intronic
1135707416 16:24686775-24686797 AGCAGAGCTCGGGCTTCCCACGG - Intergenic
1136929482 16:34406436-34406458 CGCAGGGCTGGTCCTTCTGAGGG - Intergenic
1136975092 16:35005368-35005390 CGCAGGGCTGGTCCTTCTGAGGG + Intergenic
1139962598 16:70726422-70726444 CACAGGGCTTGTGCTTCCCAGGG - Intronic
1152340331 17:79720847-79720869 CGCAGGGCAGGCCCTGCCCAAGG + Intergenic
1155074429 18:22342288-22342310 GGCCTGGCTCGACCTTGCCAAGG + Intergenic
1159134914 18:64326383-64326405 CAAAGGGCACGAACTTCCCAGGG + Intergenic
1160424346 18:78769917-78769939 CGCCGGGCACGACATTCCCAGGG - Intergenic
1161112761 19:2479166-2479188 CGCAGGCCGCGACCTTTCCACGG + Intergenic
1163609032 19:18291735-18291757 CGCAGGCCCCGCCCTTCCCCAGG - Intergenic
1163721699 19:18900974-18900996 CCCAGAGCCCGACCTGCCCACGG + Intronic
1167432374 19:49461878-49461900 CGAAGGGCACGCCCTTCCTAGGG - Exonic
925061841 2:897402-897424 CACAGGGCTGGAGCTGCCCAAGG + Intergenic
926976604 2:18522205-18522227 CGCAGGCCTCTACCTCCACAGGG + Intergenic
927553717 2:24018521-24018543 GGCAGGGCCCCACCTTCCCTGGG - Intronic
930419727 2:51135355-51135377 CACAGGGGTAGAGCTTCCCAAGG + Intergenic
933489386 2:82966343-82966365 GCCAGAGCTGGACCTTCCCATGG + Intergenic
937620619 2:123980722-123980744 CACAGGGATGGAGCTTCCCAAGG + Intergenic
938466858 2:131530359-131530381 CCTAGGGCTCTCCCTTCCCAGGG + Intronic
939999113 2:148949511-148949533 CCCAGGGCCCGAGCTACCCATGG + Intronic
946239094 2:218343196-218343218 CGCAGGGCTGCTCTTTCCCACGG - Intronic
947259983 2:228210132-228210154 AGCAGGGCTTGTCCTTTCCAGGG + Intergenic
948208817 2:236177885-236177907 CGCCAGGCACGGCCTTCCCAGGG + Intergenic
1173132512 20:40408092-40408114 CCCAGGGCTCAGCATTCCCAGGG - Intergenic
1175819766 20:61902465-61902487 TGCGGGGCCCCACCTTCCCAGGG + Intronic
1177656251 21:24020611-24020633 CACAGGGGTGGAGCTTCCCAAGG + Intergenic
1178011279 21:28289868-28289890 CACAGGGCCCGAGCTACCCAAGG - Intergenic
1178441023 21:32598440-32598462 GGCAGGGCTGGTTCTTCCCAAGG + Intronic
1179249163 21:39658331-39658353 CACAGGGCTCTAAATTCCCAGGG - Intronic
1180222198 21:46366134-46366156 CTCAGGCCTCGCCCTCCCCATGG + Intronic
1181948743 22:26539225-26539247 CCCATGGCTGGTCCTTCCCATGG - Intronic
1182477077 22:30582188-30582210 CGCTGGGCCTGGCCTTCCCAAGG - Intronic
1182650585 22:31848133-31848155 CACAGGGCTGGAGCTACCCAAGG - Intronic
1183665203 22:39242764-39242786 CGCAGGGGCCGACCCTCCCCGGG + Intronic
1184551798 22:45208593-45208615 CCCAGGGCTCAACCTCCCCCTGG - Intronic
951449319 3:22818896-22818918 CGCAGGGGTGGAGTTTCCCAAGG - Intergenic
953931659 3:47008804-47008826 CCCAGGGCAAGACCTCCCCATGG - Intronic
954568759 3:51622912-51622934 CCCAGGTCTCGCTCTTCCCAAGG + Intronic
956610158 3:71114567-71114589 AGCAGGGTTCCACTTTCCCATGG - Intronic
961311768 3:126006910-126006932 GGCAGGGGTCAACCATCCCAAGG + Intronic
962509546 3:136084695-136084717 CACAGGGGTGGACCTGCCCAAGG + Intronic
963416342 3:145000359-145000381 CACAGGGGTAGACCTGCCCAAGG - Intergenic
963824101 3:149932706-149932728 CACAGGGATGGAGCTTCCCAAGG - Intronic
966346844 3:178989968-178989990 CACAGGGGTGGAGCTTCCCAAGG - Intergenic
967221520 3:187251699-187251721 GGGAGGGCTCGATTTTCCCATGG + Exonic
968479348 4:826545-826567 GCCCGGGCTCGACCTTCCCCCGG + Intergenic
976724518 4:88202628-88202650 CAAAGGGCTCAAACTTCCCATGG + Intronic
978265791 4:106823022-106823044 CACAGGGCTGGAGTTTCCCAAGG - Intergenic
980422825 4:132585734-132585756 CACAGGGGCAGACCTTCCCAAGG + Intergenic
987545850 5:19309588-19309610 CACAGGGGTGGAGCTTCCCAGGG - Intergenic
989144534 5:38235439-38235461 CACAGGGGTGGAGCTTCCCAAGG + Intergenic
989695928 5:44200638-44200660 CACAGGGATGGAGCTTCCCAAGG + Intergenic
989726794 5:44597052-44597074 CACAGGGGTGGAACTTCCCAAGG - Intergenic
990520264 5:56572939-56572961 CACAGGGATGGAGCTTCCCAAGG - Intronic
990798627 5:59573498-59573520 CGCAGTTCTCAGCCTTCCCAGGG + Intronic
991186619 5:63815880-63815902 CACAGGGATAGAGCTTCCCAAGG + Intergenic
993743259 5:91565038-91565060 CACAGGGTTGGAGCTTCCCAAGG - Intergenic
995120610 5:108532208-108532230 CACAGGGGTGGAGCTTCCCAAGG - Intergenic
997052468 5:130398783-130398805 CACAGGGGTGGAGCTTCCCAAGG + Intergenic
1002527221 5:179821370-179821392 GGCAGGGCTCCACCGCCCCAGGG - Intronic
1003015099 6:2461970-2461992 CGCAGGCCTCGCTCTTCACAGGG - Intergenic
1003069566 6:2935310-2935332 TGCAGGGCTCCACATTCACAGGG - Intergenic
1006474591 6:34246033-34246055 GGCAGGGCCCCACCTTCCCTGGG - Exonic
1008886891 6:56441077-56441099 CATAGGGCTAGACCTTACCAAGG - Intergenic
1011792773 6:90915938-90915960 CACAGGGTTGGAGCTTCCCAAGG + Intergenic
1011895312 6:92217437-92217459 CACAGGGGTGGAGCTTCCCAAGG + Intergenic
1014668756 6:124272773-124272795 CACAGGGGTAGAGCTTCCCAAGG + Intronic
1014951262 6:127558569-127558591 CACAGGGGTGGAGCTTCCCAAGG + Intronic
1015239665 6:131008667-131008689 CACAGGGGTGGAACTTCCCAAGG + Intronic
1017441028 6:154464470-154464492 CGCAGGCCTCGGCCTCCCAAAGG - Intronic
1018869416 6:167769929-167769951 CCCAGAGCTCGGTCTTCCCATGG + Intergenic
1019611008 7:1936623-1936645 CGCACGGATGGACCTACCCACGG + Intronic
1019921281 7:4164727-4164749 TGCAGGGCTCGAGCTCCCCTTGG + Intronic
1020696599 7:11420789-11420811 CACAGGGGTCGAGCTGCCCAAGG + Intronic
1021400996 7:20209341-20209363 CACAGGGCTAGAGCTGCCCAAGG + Intronic
1024487235 7:49932336-49932358 CACAGGGGTGGAGCTTCCCAAGG + Intronic
1029128988 7:98315825-98315847 CCAAGGGCTTGACATTCCCACGG + Intronic
1031254909 7:119435239-119435261 CACAGGGGTGGAGCTTCCCAAGG - Intergenic
1035529364 8:338745-338767 CTCAGGACCTGACCTTCCCATGG - Intergenic
1036227452 8:6971662-6971684 CGCTGTGCATGACCTTCCCATGG - Intergenic
1036229911 8:6990822-6990844 CGCTGTGCACGACATTCCCATGG - Intergenic
1036232362 8:7009925-7009947 CGCTGTGCACGACATTCCCATGG - Intronic
1036808635 8:11852494-11852516 CGCAGGGCTCATGCTGCCCAGGG - Intronic
1039577364 8:38634145-38634167 CGCAGGGCACCCCCTGCCCAGGG - Intergenic
1040741390 8:50580055-50580077 CACAGGGGTGGACCTGCCCAAGG + Intronic
1048043269 8:130750861-130750883 CACAGGGGTGGAGCTTCCCAAGG - Intergenic
1049206302 8:141365233-141365255 CGCTGGGCTCATCCTTCCCAGGG + Intronic
1051114174 9:13675025-13675047 CCCAGGGCTCGACCTGGCAAAGG + Intergenic
1051114266 9:13675877-13675899 CCCAGGGCTCGACCTGGCAAAGG - Intergenic
1055334925 9:75223964-75223986 CACAGGGGTGGAGCTTCCCAAGG - Intergenic
1056653379 9:88488449-88488471 CGGAAGGCTGGACCTTTCCATGG + Intergenic
1056955057 9:91074869-91074891 CGCAACTCTCCACCTTCCCAAGG + Intergenic
1058420427 9:104828221-104828243 CCTGGGGCACGACCTTCCCAGGG + Intronic
1060919615 9:127410607-127410629 TGCAGGGCTACACCTTCACAGGG + Intergenic
1062534499 9:137015501-137015523 CGCAGCACTTGAGCTTCCCATGG + Exonic
1062544698 9:137056160-137056182 CGCAGGGCTCAGACCTCCCAGGG + Intergenic
1185504336 X:620183-620205 CCCAGGGCTGGCCCTACCCAAGG + Intergenic
1187127389 X:16466891-16466913 CTCATGGCTCCACCTTCCCAGGG + Intergenic
1188156689 X:26749500-26749522 GGCAGGGCCCCACCTTCCCTGGG - Intergenic
1193183228 X:78483160-78483182 CACAGGGGTGGAGCTTCCCAAGG - Intergenic
1194500182 X:94672758-94672780 CACAGGGGTAGAGCTTCCCAAGG - Intergenic
1199112875 X:143955634-143955656 CACAGGGTTGGAGCTTCCCAAGG + Intergenic
1199220264 X:145309243-145309265 CACAGGGGTGGAGCTTCCCAAGG - Intergenic
1201400526 Y:13599593-13599615 CACAGGGATAGAGCTTCCCAAGG + Intergenic