ID: 1084385873

View in Genome Browser
Species Human (GRCh38)
Location 11:68842323-68842345
Sequence ACCGATCCACAGGGAGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084385866_1084385873 1 Left 1084385866 11:68842299-68842321 CCCACATCACCGAGCTGAGAAGC 0: 1
1: 0
2: 0
3: 18
4: 206
Right 1084385873 11:68842323-68842345 ACCGATCCACAGGGAGTGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1084385864_1084385873 17 Left 1084385864 11:68842283-68842305 CCAGGAAATAAGTTACCCCACAT 0: 1
1: 0
2: 0
3: 16
4: 139
Right 1084385873 11:68842323-68842345 ACCGATCCACAGGGAGTGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1084385867_1084385873 0 Left 1084385867 11:68842300-68842322 CCACATCACCGAGCTGAGAAGCA 0: 1
1: 0
2: 0
3: 12
4: 179
Right 1084385873 11:68842323-68842345 ACCGATCCACAGGGAGTGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1084385868_1084385873 -8 Left 1084385868 11:68842308-68842330 CCGAGCTGAGAAGCAACCGATCC 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1084385873 11:68842323-68842345 ACCGATCCACAGGGAGTGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1084385865_1084385873 2 Left 1084385865 11:68842298-68842320 CCCCACATCACCGAGCTGAGAAG 0: 1
1: 0
2: 1
3: 12
4: 143
Right 1084385873 11:68842323-68842345 ACCGATCCACAGGGAGTGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084385873 Original CRISPR ACCGATCCACAGGGAGTGGT GGG Intronic
902447888 1:16478629-16478651 ACCCATCCACTTGGAGTGGATGG + Intergenic
904750276 1:32737497-32737519 CCCTATCCACAGGGACTGCTGGG + Intergenic
916354429 1:163888887-163888909 TCTGATCCACAGGCAGTGGAGGG - Intergenic
918053851 1:181001008-181001030 CCCCATCCACAGTGAGTGTTTGG - Intronic
1062894200 10:1090485-1090507 ACCTAACTAAAGGGAGTGGTGGG + Intronic
1065976027 10:30842997-30843019 ACTGATCCATAGGGAGAGGGAGG - Intronic
1067300408 10:45002643-45002665 ACTTCTCTACAGGGAGTGGTAGG - Intronic
1072545123 10:96431473-96431495 ACAGAGCCACAGGGAGGGGAAGG + Intronic
1078857845 11:15221032-15221054 ACCGTTCAACAGGGTGTTGTGGG - Intronic
1079004262 11:16781190-16781212 ACAGATCCACGGGGCCTGGTGGG + Intronic
1083303096 11:61748970-61748992 ACCGAGCCACAGTGAGTGAGGGG - Intergenic
1084271714 11:68032709-68032731 ACCCAAGCACAGGGAGAGGTAGG + Intronic
1084385873 11:68842323-68842345 ACCGATCCACAGGGAGTGGTGGG + Intronic
1085649125 11:78251344-78251366 ACCAATAGACAGGGAGTGGTAGG - Intronic
1087672619 11:101126960-101126982 ACCGTTCCCCCGGGAGGGGTGGG - Intronic
1091221911 11:133934802-133934824 ACCCAGCGACAGGGAGTGGCAGG - Intronic
1092261239 12:6954267-6954289 GCCACACCACAGGGAGTGGTGGG - Intronic
1096585803 12:52618846-52618868 GCTGTTCCCCAGGGAGTGGTGGG + Intergenic
1106815690 13:33404724-33404746 ACCATGCCAAAGGGAGTGGTGGG + Intergenic
1117404945 14:55392870-55392892 ACAGATCCACAGGGACTGAGGGG + Intronic
1117724835 14:58662626-58662648 CCCGATACACAGAGAGTAGTGGG + Intergenic
1121298579 14:92850765-92850787 ACCTGTCCCCAGGGACTGGTAGG - Intergenic
1123063562 14:105605312-105605334 ACCGATGCACACCGAGTGCTGGG + Intergenic
1123087619 14:105724099-105724121 ACCGATGCACACCGAGTGCTGGG + Intergenic
1126274636 15:46862507-46862529 ACTGATCAACAGGGAGAGGTTGG + Intergenic
1141125118 16:81395573-81395595 ACCTCTCCACAGGGCCTGGTAGG - Intergenic
1146790305 17:35747131-35747153 TCCAGTCCACAGGGGGTGGTGGG + Exonic
1149468411 17:56897492-56897514 GCTGGTCCACAGGGAGTGGGTGG - Intronic
1149991202 17:61384572-61384594 GGCCATCCACAGGGAGTGGTAGG + Intronic
1150610051 17:66726597-66726619 ACCGAGGCGGAGGGAGTGGTGGG + Intronic
1151620693 17:75243128-75243150 TCCTATCCACAGGAATTGGTGGG + Exonic
1152612340 17:81322047-81322069 ACCGGGCCACAGGGAGTGCTGGG - Intronic
1162124115 19:8490191-8490213 ACCGTCCCAGGGGGAGTGGTTGG + Exonic
1162205592 19:9053880-9053902 ACCAATCAGCAGGAAGTGGTTGG + Intergenic
1164274255 19:23702821-23702843 TCAGTTCCTCAGGGAGTGGTGGG - Intergenic
1167488577 19:49778239-49778261 ACAGAGCCTCAGTGAGTGGTGGG - Intronic
1168213096 19:54906105-54906127 ATAGATACACAGGAAGTGGTGGG - Intergenic
925827248 2:7861583-7861605 TCAGATGCACAGGGAGTAGTGGG - Intergenic
925982947 2:9191815-9191837 ACCGCCACACAGAGAGTGGTTGG - Intergenic
932771190 2:74501784-74501806 TCGGATCCACAGAGAGGGGTAGG + Intronic
935574103 2:104691115-104691137 ACCCTTCCACAAGGATTGGTTGG - Intergenic
935739019 2:106130421-106130443 GCCATTCCACAGGGAGAGGTTGG - Intronic
940790466 2:158025635-158025657 ACCATTCCACAGGGATAGGTTGG + Intronic
946067835 2:217004722-217004744 ACATATCCACAGAGAGTGGCTGG - Intergenic
947690801 2:232134176-232134198 ACAGAGCCTCAGGGAGTTGTGGG + Intronic
1170642531 20:18167106-18167128 ACCCAGCAACAGGGAGTGGAAGG + Intronic
1174127856 20:48320332-48320354 ACAGATCCACAGGCAGTGTCAGG + Intergenic
1174282300 20:49448036-49448058 AGGGATCCCCACGGAGTGGTTGG - Intronic
1175481539 20:59314648-59314670 ACCAGTCCTCAGGCAGTGGTAGG + Intronic
1179250050 21:39664717-39664739 ACCCAGCCACAGGGGGTGGTGGG - Exonic
1181978857 22:26752170-26752192 ACCGATGCTCAGAGAGGGGTGGG + Intergenic
1183781166 22:39999843-39999865 ACCCATCGACAGGCAGAGGTGGG - Intronic
950502873 3:13375714-13375736 CCCGATCCCCAGGGAGGGGTGGG - Intronic
950669443 3:14517291-14517313 ACCCAACCACAGGGAGAGATGGG + Intronic
951089616 3:18556975-18556997 ACTGAAACACTGGGAGTGGTTGG - Intergenic
953849347 3:46454405-46454427 ACTGTTCCACAGGGAGGGGCTGG - Intronic
954413723 3:50382745-50382767 ACCGAGACACAGTGAGGGGTGGG - Intronic
956725418 3:72152707-72152729 ACCAATCCACAGGGGGTGAAGGG + Intergenic
961781470 3:129323254-129323276 CCTGATCCCCAGGGAGGGGTGGG - Intergenic
964207053 3:154185995-154186017 ACCGCTCCACTGTGAGTGTTGGG + Intronic
966988297 3:185202532-185202554 ACCGGTCCACAGCCAGAGGTTGG - Intronic
969370659 4:6729115-6729137 ACCCCTCCCCAGGGAGTAGTGGG - Intergenic
973048708 4:45567924-45567946 ACCGATCAGCAGGGTGTGGGTGG + Intergenic
973871391 4:55170123-55170145 ACCGACTCACTGGGACTGGTTGG - Intergenic
981295194 4:143123686-143123708 CCTGATCAACAGGGAGAGGTAGG + Intergenic
983964459 4:173792489-173792511 ACAGATCCCTAGGAAGTGGTAGG + Intergenic
992366877 5:76101178-76101200 ACAGAAACACAGGCAGTGGTGGG + Intronic
992378641 5:76215678-76215700 CTCAATGCACAGGGAGTGGTGGG - Intronic
1002400775 5:178990689-178990711 GCCGACCCACAGGAAGTGGCCGG + Exonic
1007254899 6:40521789-40521811 ACCGATGAAAAGGGAGGGGTGGG + Intronic
1010134264 6:72532091-72532113 AGGGAGCCACAGGGAGTGGCAGG - Intergenic
1011548052 6:88502125-88502147 ACACATACACACGGAGTGGTGGG + Intergenic
1014810075 6:125875265-125875287 AGGGATGCACATGGAGTGGTGGG - Intronic
1026201424 7:68217949-68217971 ATAGAGCCACAGGGAGAGGTTGG - Intergenic
1031561173 7:123240367-123240389 ACTGAAGCACAGGGAGTGATAGG - Intergenic
1032627803 7:133611529-133611551 CCAGATCAACAGGGTGTGGTAGG - Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035084707 7:156248114-156248136 ACCCATGGACTGGGAGTGGTGGG + Intergenic
1041083576 8:54236282-54236304 ACCGATGCCCAGTGAGTGGAAGG + Intergenic
1062219093 9:135404705-135404727 ACAAATCCCCAGGGAGTGGAGGG - Intergenic
1187601918 X:20840692-20840714 ACAGATCCTCAGGGACTTGTAGG - Intergenic
1189266673 X:39722058-39722080 AGCAAGCCCCAGGGAGTGGTAGG + Intergenic
1195070059 X:101270458-101270480 ACCTATCTATAGGGGGTGGTGGG - Intronic
1195915256 X:109929111-109929133 ACATATCCACAGGGTGTCGTGGG - Intergenic