ID: 1084386084

View in Genome Browser
Species Human (GRCh38)
Location 11:68843441-68843463
Sequence TGTAGGATAGATCCCTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084386076_1084386084 0 Left 1084386076 11:68843418-68843440 CCTCCTGGAGCTCCTGATTATCC 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1084386084 11:68843441-68843463 TGTAGGATAGATCCCTGGAGGGG 0: 1
1: 0
2: 1
3: 15
4: 150
1084386075_1084386084 11 Left 1084386075 11:68843407-68843429 CCGTCGATGTACCTCCTGGAGCT 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1084386084 11:68843441-68843463 TGTAGGATAGATCCCTGGAGGGG 0: 1
1: 0
2: 1
3: 15
4: 150
1084386077_1084386084 -3 Left 1084386077 11:68843421-68843443 CCTGGAGCTCCTGATTATCCTGT 0: 1
1: 0
2: 3
3: 20
4: 232
Right 1084386084 11:68843441-68843463 TGTAGGATAGATCCCTGGAGGGG 0: 1
1: 0
2: 1
3: 15
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084386084 Original CRISPR TGTAGGATAGATCCCTGGAG GGG Intronic
900591914 1:3463937-3463959 TGGAGGGCAGATCCCTGGAAGGG + Intronic
901204840 1:7488301-7488323 TGTGGGATGGAGGCCTGGAGTGG + Intronic
902804915 1:18855040-18855062 TGGTGGATAGAGCCCTGGGGTGG - Intronic
903396890 1:23008354-23008376 TGAAAGCTAGATCTCTGGAGAGG - Intergenic
904482104 1:30800590-30800612 TGAAGCATAGATGCGTGGAGAGG - Intergenic
904498831 1:30902520-30902542 TGGAGGACAGAGGCCTGGAGGGG + Intronic
906618963 1:47258333-47258355 TGTAGGATAAATTCCTAGATAGG - Intronic
906788179 1:48634538-48634560 GGTAGGATGGACCCATGGAGAGG + Exonic
910772883 1:90847447-90847469 TGTATGTTAGATGCCAGGAGTGG - Intergenic
911210629 1:95134652-95134674 TAGAGGATAGATCTCTGCAGTGG + Intronic
911229717 1:95347947-95347969 TGCAGCCTTGATCCCTGGAGAGG + Intergenic
913549302 1:119901809-119901831 TGTAGGATATATACCTAGAGTGG - Intergenic
915736854 1:158090554-158090576 AGGAGGATTGATCCCTGGAAAGG + Intronic
916773819 1:167938513-167938535 TGTAGGATAAGTACCTAGAGTGG + Intronic
919980900 1:202642588-202642610 TGTGGGAAAGTTCCCGGGAGAGG + Intronic
920865530 1:209749004-209749026 TTTAGGATAAAACCTTGGAGTGG - Intergenic
921219937 1:212966247-212966269 TGTAGGATAGAGCACAGCAGAGG - Intronic
922353290 1:224753003-224753025 TGTAGGATATAGACCTGGCGTGG - Intergenic
1063838868 10:10047749-10047771 TGTTGGATTGATTCCTGGTGTGG - Intergenic
1071517956 10:86311542-86311564 TGTATGATAAATGCCTAGAGAGG + Intronic
1072283358 10:93890749-93890771 TGTAGGATAGAACACTGGAGAGG - Intergenic
1073106436 10:101035086-101035108 AATGGGATAGATCCCTGTAGAGG - Intronic
1075598219 10:123747714-123747736 TCTAGGCTAGATCCCTGTGGTGG + Intronic
1076331631 10:129674735-129674757 TGCAGGATAGAGCCCAGGGGAGG - Intronic
1077407645 11:2389748-2389770 TGTGGGATACATCCCTGCTGTGG - Intronic
1077411935 11:2407718-2407740 TGGAGGAGAGAGCCCTGGAGCGG - Intronic
1080525330 11:33110914-33110936 TATAGGATAGATCCTAGGAGTGG - Intronic
1081620070 11:44614240-44614262 AGCAGGGTAGATGCCTGGAGGGG - Intronic
1081640585 11:44750707-44750729 AATAGGCGAGATCCCTGGAGTGG + Intronic
1084386084 11:68843441-68843463 TGTAGGATAGATCCCTGGAGGGG + Intronic
1085591653 11:77767812-77767834 TGTAGCATAGAACACTGGTGGGG - Intronic
1087094718 11:94307629-94307651 TGTAGGACAGTTCCCAGGATGGG - Intronic
1088271711 11:108041168-108041190 TGTAGGTGTGATCCCTGTAGAGG - Intronic
1090791414 11:130093151-130093173 TGAAGGATTCCTCCCTGGAGAGG + Intronic
1091991054 12:4956079-4956101 TCTAGGATGGATCCCTGGAAGGG + Intergenic
1093165969 12:15804637-15804659 TGTAGGATAGATTGATGGAATGG + Intronic
1094174356 12:27526095-27526117 AGTAGGATAGAGCTGTGGAGTGG + Intronic
1094726686 12:33126023-33126045 GGTAGGAGAGATTCCTGGATTGG + Intergenic
1096487879 12:51995892-51995914 TGTTGAATAAATGCCTGGAGAGG - Intronic
1098247872 12:68538983-68539005 AGTAGAAGAGATCCCAGGAGGGG - Intergenic
1100098166 12:91069164-91069186 GGTAGGAAAGAGTCCTGGAGGGG - Intergenic
1101599612 12:106197703-106197725 TGTAGGATAGAATGCTGGAAGGG - Intergenic
1103882629 12:124177831-124177853 TGTAGGATAAATTCCTAGAAGGG - Intronic
1105455215 13:20534194-20534216 TGTGGGATGGACCCCTGCAGTGG - Intergenic
1107373717 13:39779711-39779733 TTTAGGACAGAACCCTGGAGAGG - Intronic
1110738265 13:78963775-78963797 TGTATGACAGTTTCCTGGAGGGG - Intergenic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1117369496 14:55063237-55063259 AGTAGGATAGAGTCCTGGTGTGG - Exonic
1118300669 14:64612891-64612913 TCTAGAACAGACCCCTGGAGAGG + Intergenic
1120117777 14:80640639-80640661 TTTTAGATAGAACCCTGGAGAGG - Intronic
1122538416 14:102482452-102482474 TGCAGGAGAGATCTCTGCAGGGG - Intronic
1122943622 14:104994865-104994887 TGTTGGAGAGATCCCAGGAATGG - Exonic
1123171526 14:106377466-106377488 GGTATGATAGACCCCTGGACAGG - Intergenic
1127861328 15:62996726-62996748 GGAAGGACAGATGCCTGGAGAGG - Intergenic
1128558608 15:68648899-68648921 TGTAGGATGAATTCCTAGAGTGG - Intronic
1129768029 15:78182444-78182466 TGTAGGACAGATGCCCGGTGGGG - Exonic
1129961215 15:79686854-79686876 TGTAGGAATGATCACTGGAGGGG - Intergenic
1130227135 15:82067764-82067786 GGTAGGACATATCCCAGGAGAGG + Intergenic
1139587896 16:67916083-67916105 TATAGGACAGATGGCTGGAGTGG - Intronic
1139911089 16:70398154-70398176 TGGGGGACAGATCCCTGGAAGGG + Intronic
1139963395 16:70730792-70730814 TGCAGGTTAGATCACTGGAGAGG - Intronic
1140034575 16:71362420-71362442 TGTAGGCTAGATTCTTGGAAGGG - Intronic
1140444261 16:75012092-75012114 TGGATGATAAATCCCTTGAGGGG + Intronic
1144051071 17:11497569-11497591 GGTATGATTGATCCCTGAAGTGG - Intronic
1144580402 17:16455963-16455985 TGCAGGAGGGAGCCCTGGAGGGG - Intronic
1145827855 17:27890861-27890883 TGCAAGATGGAGCCCTGGAGTGG - Intronic
1147333841 17:39715277-39715299 TGGAGGCTGGGTCCCTGGAGGGG - Exonic
1148248603 17:46053818-46053840 TGCAGGATAGATTCTTGGTGTGG - Intronic
1148987727 17:51638287-51638309 TGGTGGATGGAACCCTGGAGGGG - Intronic
1150825260 17:68468912-68468934 TGTGGAACAGATCCCTGGAGAGG - Intergenic
1152012915 17:77729805-77729827 TGTAGGGCAGAGCCCTGGAGAGG + Intergenic
1152109071 17:78347446-78347468 GGAAGGAGAGATGCCTGGAGAGG - Intergenic
1152529654 17:80910112-80910134 TGCAGGACAGAGCACTGGAGAGG - Intronic
1152859168 17:82685569-82685591 TGTTGGCTAGGGCCCTGGAGGGG - Intronic
1153307364 18:3644337-3644359 TTCAGGATAAATCCCTGAAGTGG - Intronic
1157502905 18:48203387-48203409 TTAAGGAAAGATCCCTGTAGCGG - Intronic
1157633251 18:49122194-49122216 TCTGGGATAGATTCCAGGAGAGG + Intronic
1159065643 18:63565299-63565321 TGTAGGCTGGATCCCTGGTGTGG + Intronic
1159409453 18:68052738-68052760 TGTGGGATGGGTCCCTGGGGAGG - Intergenic
1165559329 19:36665928-36665950 TGAATGACAGATCTCTGGAGTGG + Intronic
1168605221 19:57753419-57753441 TGTAAGATATCTCCCAGGAGAGG - Exonic
928309274 2:30196100-30196122 TCTAGGATAGATTCCTGAAAGGG + Intergenic
940788006 2:158002586-158002608 TGAAGGGAAGATCCCTGGGGTGG + Intronic
941960153 2:171245494-171245516 TGTAGGAAACATCCCTGTTGTGG + Intergenic
942919551 2:181354902-181354924 TTTAGTATAGAACACTGGAGTGG + Intergenic
943001108 2:182329742-182329764 AGTAGGAGTGGTCCCTGGAGTGG - Intronic
949041664 2:241852486-241852508 TGCAGGACAGAGCCCTGGACTGG + Intronic
1168754464 20:306528-306550 TGATGGATATATCCCGGGAGGGG - Intergenic
1170600015 20:17834902-17834924 TGCAGGATAAATCCCAGAAGTGG - Intergenic
1173055474 20:39608095-39608117 TGTAGGTTAGATAGATGGAGGGG - Intergenic
1173592204 20:44233560-44233582 TGGAGGAAAGATCCCTGGATTGG + Intergenic
1173593696 20:44245289-44245311 TAGAGGAAAGATCCCTGGATTGG - Intergenic
1173848490 20:46202851-46202873 TGGAGGATAGAGGCCAGGAGAGG + Intronic
1175355016 20:58358433-58358455 TGTAGGATTAATGCCCGGAGTGG - Intronic
1175544169 20:59767439-59767461 TGTAGGATAGATGGATGGATGGG - Intronic
1177431159 21:20994311-20994333 CGTCTGATAGAGCCCTGGAGAGG + Intergenic
1185373239 22:50470424-50470446 TGGAGGGTAGAGCCCTGCAGAGG - Intronic
949344303 3:3062382-3062404 GATAGGATAGGTGCCTGGAGAGG + Intergenic
952322798 3:32293948-32293970 TGTAGGTTAGATCCCAGAACTGG + Intronic
954577282 3:51683579-51683601 AGTGGGATAGGTCCCTGGATGGG + Intronic
954882311 3:53844501-53844523 AGGAGGATAGAGCCCTGGGGAGG - Intronic
956713976 3:72062220-72062242 CTTTGGATAGATCCCTGGAAAGG + Intergenic
961175320 3:124830595-124830617 TGGAGGAAAGATCCCTGCACTGG - Intronic
961506771 3:127375314-127375336 TGCAGGAAAAATCCCTGGGGAGG - Intergenic
963109691 3:141677306-141677328 TGTTGGATATATACCTAGAGTGG - Intergenic
965088368 3:164129425-164129447 TATGTGATAGATCCGTGGAGTGG - Intergenic
972644022 4:40951101-40951123 TGGAGGATGAATACCTGGAGTGG + Intronic
974645221 4:64681100-64681122 TATAGGAAAAAGCCCTGGAGTGG + Intergenic
974796035 4:66751126-66751148 TGTAGCATAGTACACTGGAGTGG + Intergenic
976164431 4:82239091-82239113 GGTAAGATAGATCACTGAAGAGG + Intergenic
976622768 4:87145802-87145824 TATAGGATAAATTCCTGGAAGGG + Intergenic
980670463 4:135997908-135997930 TGAAGGATAGATACCTGGACTGG + Intergenic
981736116 4:147952261-147952283 TCTTGGATAAATCCCAGGAGTGG + Intronic
982209415 4:153022509-153022531 AGTGGGAGAGCTCCCTGGAGTGG - Intergenic
984479869 4:180286332-180286354 TGTAGGATAGATCCAGGTGGAGG + Intergenic
990986060 5:61642023-61642045 AGGAGAAAAGATCCCTGGAGAGG + Intronic
997867703 5:137479418-137479440 TGCAGGATAGATCCCCAGAAGGG + Intronic
999143847 5:149379887-149379909 TGGTGGATAGAGCCCTGGATGGG - Intronic
1008255662 6:49296730-49296752 TGTAGGAGAGAGCCTTGCAGAGG - Intergenic
1010102649 6:72127581-72127603 TGTAGAATTGATGACTGGAGGGG - Intronic
1012582934 6:100890240-100890262 AGTAGGATAGAGTCCTGGTGTGG - Intergenic
1013635632 6:112026813-112026835 AGTGTGATAGATCCCTGGAGTGG + Intergenic
1015263371 6:131263807-131263829 TGTGGCCTAGAGCCCTGGAGTGG + Intronic
1015601129 6:134911726-134911748 TGGAGAGTAGAGCCCTGGAGAGG - Intergenic
1016749953 6:147621469-147621491 TGTTGGATGGATTCCTGAAGTGG - Intronic
1018106119 6:160488120-160488142 TCTAGGATGCATCCCTGGACAGG + Intergenic
1018106632 6:160493647-160493669 TCTAGGATGCATCCCTGGACAGG + Intergenic
1019838235 7:3412620-3412642 TGTAGGATAAATTCCTAGAATGG + Intronic
1022394464 7:29973538-29973560 AGTAGGGTAGAGGCCTGGAGAGG + Intronic
1022642498 7:32201607-32201629 TGCATGAGAGATCCCAGGAGTGG + Intronic
1022658588 7:32344763-32344785 TGGAGCTTAGATTCCTGGAGAGG - Intergenic
1023808736 7:43894301-43894323 TCCAGGATAGATCCATGTAGTGG + Intronic
1024600430 7:50975707-50975729 TGTAGGATAACTCCTTGTAGTGG + Intergenic
1024921748 7:54564602-54564624 TCTAGGAAAGATCCCAGAAGAGG - Intronic
1026901626 7:74040505-74040527 TTTGGGATCCATCCCTGGAGAGG + Intronic
1028448572 7:90953940-90953962 TGTAGGATAAAACCTTGCAGAGG + Intronic
1029969991 7:104779500-104779522 TCTTGGTTAGATCTCTGGAGTGG + Intronic
1032534575 7:132651813-132651835 TGTAGGATGTGTACCTGGAGTGG - Intronic
1038034440 8:23675331-23675353 TTTAGGATAGATCCATTGTGTGG - Intergenic
1040727350 8:50398322-50398344 TGCAGGAGAGATGTCTGGAGAGG - Intronic
1042324658 8:67516073-67516095 TGTTGGATAGAACCATGGAAAGG - Intronic
1042466550 8:69134882-69134904 TGTGGGAGAGATCCAGGGAGAGG - Intergenic
1042814813 8:72866881-72866903 TCTGGGATACCTCCCTGGAGAGG - Intronic
1042910285 8:73819029-73819051 TGTAGGACGGGTCCCTGGAGTGG - Intronic
1046804912 8:118469431-118469453 TGTGGGCTAGATCCCTAGATAGG - Intronic
1047495674 8:125407009-125407031 TGTTGAATAAATCCCTGGATGGG + Intergenic
1048271381 8:133030860-133030882 TGGAGGACAGAGCCCTGGTGGGG + Intronic
1048801108 8:138194323-138194345 TGCAGAGGAGATCCCTGGAGAGG - Intronic
1052984710 9:34478322-34478344 TCAAGCATATATCCCTGGAGAGG + Intronic
1053592756 9:39531005-39531027 TGTAGGATAGAAATCTGGTGTGG - Intergenic
1053850492 9:42285718-42285740 TGTAGGATAGAAATCTGGTGTGG - Intergenic
1054573547 9:66834274-66834296 TGTAGGATAGAAATCTGGTGTGG + Intergenic
1056910674 9:90697363-90697385 TGGAGGTGACATCCCTGGAGAGG - Intergenic
1058176324 9:101739434-101739456 GGTAGGAGAGATCCATGGGGTGG + Intergenic
1058844580 9:108944220-108944242 TGCAGAATCCATCCCTGGAGAGG + Intronic
1059176243 9:112172464-112172486 TGAAAGACAGATCCTTGGAGAGG - Intronic
1059358669 9:113721291-113721313 TGTATGATAGATCTCTTGAAAGG + Intergenic
1187205378 X:17176606-17176628 TGTAGGATGGGTTTCTGGAGAGG - Intergenic
1188105238 X:26141152-26141174 TGAAGGACAAAACCCTGGAGTGG + Intergenic
1192624343 X:72712501-72712523 TTTAGGAAAGATCCCAGGATAGG + Intronic
1193752094 X:85358293-85358315 TGTAGGATAGATGCCGTGAAAGG - Intronic
1194635017 X:96335301-96335323 TGAAGGATAAATCCCTGAAGGGG - Intergenic
1195557688 X:106245868-106245890 TGTGGGATACATCCCTGGCTGGG + Intergenic
1196656563 X:118224384-118224406 TGTAGGTTAAATCCCTTGAATGG - Intergenic
1198438771 X:136641485-136641507 TCTAGGATACAACTCTGGAGTGG + Intergenic
1199815000 X:151389258-151389280 TGTGGGAGAGCACCCTGGAGAGG + Intergenic
1200427847 Y:3041061-3041083 TGTAGTCTTGATACCTGGAGGGG + Intergenic