ID: 1084386707

View in Genome Browser
Species Human (GRCh38)
Location 11:68847621-68847643
Sequence ATGCTTATCAATAAGCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084386705_1084386707 8 Left 1084386705 11:68847590-68847612 CCAGCATAAAATTTGCTCATTCC No data
Right 1084386707 11:68847621-68847643 ATGCTTATCAATAAGCACAGTGG No data
1084386703_1084386707 22 Left 1084386703 11:68847576-68847598 CCTGGAGCCTACAACCAGCATAA No data
Right 1084386707 11:68847621-68847643 ATGCTTATCAATAAGCACAGTGG No data
1084386704_1084386707 15 Left 1084386704 11:68847583-68847605 CCTACAACCAGCATAAAATTTGC No data
Right 1084386707 11:68847621-68847643 ATGCTTATCAATAAGCACAGTGG No data
1084386702_1084386707 25 Left 1084386702 11:68847573-68847595 CCACCTGGAGCCTACAACCAGCA No data
Right 1084386707 11:68847621-68847643 ATGCTTATCAATAAGCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084386707 Original CRISPR ATGCTTATCAATAAGCACAG TGG Intergenic
No off target data available for this crispr