ID: 1084386760

View in Genome Browser
Species Human (GRCh38)
Location 11:68847971-68847993
Sequence CTTGCTCCTGACCGCTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084386756_1084386760 0 Left 1084386756 11:68847948-68847970 CCCAACACCAGGGCCAGGGCAGT No data
Right 1084386760 11:68847971-68847993 CTTGCTCCTGACCGCTGTGCTGG No data
1084386758_1084386760 -7 Left 1084386758 11:68847955-68847977 CCAGGGCCAGGGCAGTCTTGCTC No data
Right 1084386760 11:68847971-68847993 CTTGCTCCTGACCGCTGTGCTGG No data
1084386757_1084386760 -1 Left 1084386757 11:68847949-68847971 CCAACACCAGGGCCAGGGCAGTC No data
Right 1084386760 11:68847971-68847993 CTTGCTCCTGACCGCTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084386760 Original CRISPR CTTGCTCCTGACCGCTGTGC TGG Intergenic
No off target data available for this crispr