ID: 1084387912

View in Genome Browser
Species Human (GRCh38)
Location 11:68855544-68855566
Sequence CCGGGAAGCGCACCGGGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084387912_1084387921 9 Left 1084387912 11:68855544-68855566 CCGCTGCCCGGTGCGCTTCCCGG No data
Right 1084387921 11:68855576-68855598 GAGCCCCGAGACCCGGAGGGAGG No data
1084387912_1084387920 6 Left 1084387912 11:68855544-68855566 CCGCTGCCCGGTGCGCTTCCCGG No data
Right 1084387920 11:68855573-68855595 GCAGAGCCCCGAGACCCGGAGGG No data
1084387912_1084387918 2 Left 1084387912 11:68855544-68855566 CCGCTGCCCGGTGCGCTTCCCGG No data
Right 1084387918 11:68855569-68855591 CTGCGCAGAGCCCCGAGACCCGG No data
1084387912_1084387919 5 Left 1084387912 11:68855544-68855566 CCGCTGCCCGGTGCGCTTCCCGG No data
Right 1084387919 11:68855572-68855594 CGCAGAGCCCCGAGACCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084387912 Original CRISPR CCGGGAAGCGCACCGGGCAG CGG (reversed) Intergenic