ID: 1084387914

View in Genome Browser
Species Human (GRCh38)
Location 11:68855550-68855572
Sequence GCAGCTCCGGGAAGCGCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084387914_1084387920 0 Left 1084387914 11:68855550-68855572 CCCGGTGCGCTTCCCGGAGCTGC No data
Right 1084387920 11:68855573-68855595 GCAGAGCCCCGAGACCCGGAGGG No data
1084387914_1084387921 3 Left 1084387914 11:68855550-68855572 CCCGGTGCGCTTCCCGGAGCTGC No data
Right 1084387921 11:68855576-68855598 GAGCCCCGAGACCCGGAGGGAGG No data
1084387914_1084387919 -1 Left 1084387914 11:68855550-68855572 CCCGGTGCGCTTCCCGGAGCTGC No data
Right 1084387919 11:68855572-68855594 CGCAGAGCCCCGAGACCCGGAGG No data
1084387914_1084387918 -4 Left 1084387914 11:68855550-68855572 CCCGGTGCGCTTCCCGGAGCTGC No data
Right 1084387918 11:68855569-68855591 CTGCGCAGAGCCCCGAGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084387914 Original CRISPR GCAGCTCCGGGAAGCGCACC GGG (reversed) Intergenic