ID: 1084387915

View in Genome Browser
Species Human (GRCh38)
Location 11:68855551-68855573
Sequence CGCAGCTCCGGGAAGCGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084387915_1084387919 -2 Left 1084387915 11:68855551-68855573 CCGGTGCGCTTCCCGGAGCTGCG No data
Right 1084387919 11:68855572-68855594 CGCAGAGCCCCGAGACCCGGAGG No data
1084387915_1084387920 -1 Left 1084387915 11:68855551-68855573 CCGGTGCGCTTCCCGGAGCTGCG No data
Right 1084387920 11:68855573-68855595 GCAGAGCCCCGAGACCCGGAGGG No data
1084387915_1084387921 2 Left 1084387915 11:68855551-68855573 CCGGTGCGCTTCCCGGAGCTGCG No data
Right 1084387921 11:68855576-68855598 GAGCCCCGAGACCCGGAGGGAGG No data
1084387915_1084387918 -5 Left 1084387915 11:68855551-68855573 CCGGTGCGCTTCCCGGAGCTGCG No data
Right 1084387918 11:68855569-68855591 CTGCGCAGAGCCCCGAGACCCGG No data
1084387915_1084387928 30 Left 1084387915 11:68855551-68855573 CCGGTGCGCTTCCCGGAGCTGCG No data
Right 1084387928 11:68855604-68855626 GCGCGCTGCGCGAGCACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084387915 Original CRISPR CGCAGCTCCGGGAAGCGCAC CGG (reversed) Intergenic
No off target data available for this crispr