ID: 1084387916

View in Genome Browser
Species Human (GRCh38)
Location 11:68855562-68855584
Sequence TCGGGGCTCTGCGCAGCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084387916_1084387929 30 Left 1084387916 11:68855562-68855584 CCCGGAGCTGCGCAGAGCCCCGA No data
Right 1084387929 11:68855615-68855637 GAGCACCCCCGGTCGCCTGCCGG No data
1084387916_1084387921 -9 Left 1084387916 11:68855562-68855584 CCCGGAGCTGCGCAGAGCCCCGA No data
Right 1084387921 11:68855576-68855598 GAGCCCCGAGACCCGGAGGGAGG No data
1084387916_1084387928 19 Left 1084387916 11:68855562-68855584 CCCGGAGCTGCGCAGAGCCCCGA No data
Right 1084387928 11:68855604-68855626 GCGCGCTGCGCGAGCACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084387916 Original CRISPR TCGGGGCTCTGCGCAGCTCC GGG (reversed) Intergenic