ID: 1084387917

View in Genome Browser
Species Human (GRCh38)
Location 11:68855563-68855585
Sequence CTCGGGGCTCTGCGCAGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084387917_1084387921 -10 Left 1084387917 11:68855563-68855585 CCGGAGCTGCGCAGAGCCCCGAG No data
Right 1084387921 11:68855576-68855598 GAGCCCCGAGACCCGGAGGGAGG No data
1084387917_1084387929 29 Left 1084387917 11:68855563-68855585 CCGGAGCTGCGCAGAGCCCCGAG No data
Right 1084387929 11:68855615-68855637 GAGCACCCCCGGTCGCCTGCCGG No data
1084387917_1084387928 18 Left 1084387917 11:68855563-68855585 CCGGAGCTGCGCAGAGCCCCGAG No data
Right 1084387928 11:68855604-68855626 GCGCGCTGCGCGAGCACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084387917 Original CRISPR CTCGGGGCTCTGCGCAGCTC CGG (reversed) Intergenic