ID: 1084387919

View in Genome Browser
Species Human (GRCh38)
Location 11:68855572-68855594
Sequence CGCAGAGCCCCGAGACCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084387915_1084387919 -2 Left 1084387915 11:68855551-68855573 CCGGTGCGCTTCCCGGAGCTGCG No data
Right 1084387919 11:68855572-68855594 CGCAGAGCCCCGAGACCCGGAGG No data
1084387912_1084387919 5 Left 1084387912 11:68855544-68855566 CCGCTGCCCGGTGCGCTTCCCGG No data
Right 1084387919 11:68855572-68855594 CGCAGAGCCCCGAGACCCGGAGG No data
1084387911_1084387919 6 Left 1084387911 11:68855543-68855565 CCCGCTGCCCGGTGCGCTTCCCG No data
Right 1084387919 11:68855572-68855594 CGCAGAGCCCCGAGACCCGGAGG No data
1084387914_1084387919 -1 Left 1084387914 11:68855550-68855572 CCCGGTGCGCTTCCCGGAGCTGC No data
Right 1084387919 11:68855572-68855594 CGCAGAGCCCCGAGACCCGGAGG No data
1084387910_1084387919 9 Left 1084387910 11:68855540-68855562 CCGCCCGCTGCCCGGTGCGCTTC No data
Right 1084387919 11:68855572-68855594 CGCAGAGCCCCGAGACCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084387919 Original CRISPR CGCAGAGCCCCGAGACCCGG AGG Intergenic
No off target data available for this crispr