ID: 1084387928

View in Genome Browser
Species Human (GRCh38)
Location 11:68855604-68855626
Sequence GCGCGCTGCGCGAGCACCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084387926_1084387928 -7 Left 1084387926 11:68855588-68855610 CCGGAGGGAGGACCGAGCGCGCT No data
Right 1084387928 11:68855604-68855626 GCGCGCTGCGCGAGCACCCCCGG No data
1084387917_1084387928 18 Left 1084387917 11:68855563-68855585 CCGGAGCTGCGCAGAGCCCCGAG No data
Right 1084387928 11:68855604-68855626 GCGCGCTGCGCGAGCACCCCCGG No data
1084387924_1084387928 0 Left 1084387924 11:68855581-68855603 CCGAGACCCGGAGGGAGGACCGA No data
Right 1084387928 11:68855604-68855626 GCGCGCTGCGCGAGCACCCCCGG No data
1084387923_1084387928 1 Left 1084387923 11:68855580-68855602 CCCGAGACCCGGAGGGAGGACCG No data
Right 1084387928 11:68855604-68855626 GCGCGCTGCGCGAGCACCCCCGG No data
1084387915_1084387928 30 Left 1084387915 11:68855551-68855573 CCGGTGCGCTTCCCGGAGCTGCG No data
Right 1084387928 11:68855604-68855626 GCGCGCTGCGCGAGCACCCCCGG No data
1084387916_1084387928 19 Left 1084387916 11:68855562-68855584 CCCGGAGCTGCGCAGAGCCCCGA No data
Right 1084387928 11:68855604-68855626 GCGCGCTGCGCGAGCACCCCCGG No data
1084387922_1084387928 2 Left 1084387922 11:68855579-68855601 CCCCGAGACCCGGAGGGAGGACC No data
Right 1084387928 11:68855604-68855626 GCGCGCTGCGCGAGCACCCCCGG No data
1084387925_1084387928 -6 Left 1084387925 11:68855587-68855609 CCCGGAGGGAGGACCGAGCGCGC No data
Right 1084387928 11:68855604-68855626 GCGCGCTGCGCGAGCACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084387928 Original CRISPR GCGCGCTGCGCGAGCACCCC CGG Intergenic