ID: 1084390363

View in Genome Browser
Species Human (GRCh38)
Location 11:68871674-68871696
Sequence GCCTCCAGAGTGACTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 4, 2: 10, 3: 39, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084390363_1084390365 8 Left 1084390363 11:68871674-68871696 CCTGCTCTAGTCACTCTGGAGGC 0: 1
1: 4
2: 10
3: 39
4: 177
Right 1084390365 11:68871705-68871727 CTACGCACGGCTGAAACTTGAGG 0: 1
1: 0
2: 19
3: 44
4: 109
1084390363_1084390364 -5 Left 1084390363 11:68871674-68871696 CCTGCTCTAGTCACTCTGGAGGC 0: 1
1: 4
2: 10
3: 39
4: 177
Right 1084390364 11:68871692-68871714 GAGGCTGACTAGTCTACGCACGG 0: 1
1: 12
2: 40
3: 91
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084390363 Original CRISPR GCCTCCAGAGTGACTAGAGC AGG (reversed) Intergenic
901236752 1:7671361-7671383 GCCCAAAGGGTGACTAGAGCTGG + Intronic
901987766 1:13089755-13089777 GCTTCTGGAGTGACCAGAGCAGG - Intergenic
901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
904627136 1:31813386-31813408 GCCTCCAGAGTAGCTGGAACAGG + Intronic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
906060861 1:42947750-42947772 GCAGCCAGAGTGACGAGAGTAGG + Intronic
911226229 1:95308471-95308493 GGCTCCAGAGGGAGTAGAGTTGG + Intergenic
912233085 1:107818100-107818122 GTTTCCAGAGTGAGGAGAGCAGG + Intronic
913343072 1:117779760-117779782 GCCTCTAGACTGTCTAGAGTAGG - Intergenic
914214057 1:145608286-145608308 GGTGCCAGAGTGACTAGCGCAGG - Intronic
914808184 1:151007091-151007113 GGCTCCAGAGGGAAAAGAGCTGG - Intronic
917883910 1:179365241-179365263 GCCTCCCGAGGGACTACAGGCGG - Intergenic
920118083 1:203635387-203635409 GCCTCCCAAGTAACTGGAGCAGG + Intronic
922500951 1:226096541-226096563 GCCTCCAGGGGGACCACAGCTGG - Intergenic
1067133240 10:43585268-43585290 GCTTCCGGAGTGACCACAGCAGG + Intergenic
1069590327 10:69637408-69637430 CCCACCAGAGGGACTGGAGCTGG - Intergenic
1070638123 10:78145552-78145574 GCCTTCAGGGTGACTTGGGCAGG + Intergenic
1072105670 10:92271060-92271082 GCCTCCTGAGTGACTGGGGCTGG - Intronic
1072764388 10:98083825-98083847 GCAGCCTGAGTGACTAAAGCAGG - Intergenic
1073296888 10:102445667-102445689 GCCTCCTGAGTAGCTATAGCTGG - Intergenic
1073754883 10:106571031-106571053 GCGGCCAGAGTGACTAGGGGTGG - Intergenic
1074445609 10:113518983-113519005 GCTTTCAGTGGGACTAGAGCTGG + Intergenic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1084488002 11:69462348-69462370 GCCTCCAGTGGGTGTAGAGCTGG - Intergenic
1085010506 11:73137784-73137806 ACGTCCCGAGTGACCAGAGCAGG + Intronic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1085810058 11:79671816-79671838 GGCTTCAGAGTGATTAGAGTTGG + Intergenic
1086132239 11:83412868-83412890 GTATCCAGAGTGACTACGGCTGG + Intergenic
1092596801 12:10015193-10015215 GACTCTAGAGTGACTGGAGAAGG - Intronic
1096339859 12:50788601-50788623 GCCTCCTGAGTAGCTAGAGCTGG + Intronic
1098864352 12:75745082-75745104 TCCTTCAGAGTCACTAAAGCAGG + Intergenic
1101784962 12:107874757-107874779 CCCTCCCCAGGGACTAGAGCAGG + Intergenic
1102631386 12:114283859-114283881 ACCTCCAGACTGACAAGAGAAGG + Intergenic
1102706513 12:114885491-114885513 GCCTCCAGAGTAGCTAGACCAGG + Intergenic
1103046035 12:117735294-117735316 CCCTCTAGAGTGAATAGATCTGG + Intronic
1103102460 12:118190651-118190673 GTCACCAGAGTGAGTAAAGCTGG + Intronic
1106620058 13:31364348-31364370 GCGTCCAAATAGACTAGAGCTGG + Intergenic
1106707221 13:32294037-32294059 GGCTCAAGAGTGAGTAGATCTGG - Intronic
1107025324 13:35795803-35795825 GCCTCCTGAGTAGCTGGAGCTGG - Intronic
1107591263 13:41909171-41909193 GCCTCCAGAGTGGCTGTGGCTGG + Intronic
1107805180 13:44146967-44146989 GCTTCGAGAGTGACTGGAGGTGG + Intronic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1113662777 13:112118427-112118449 GCCTTCAGGGTGACTTGGGCTGG + Intergenic
1114043017 14:18696202-18696224 GCCTCCCGAATAACTACAGCAGG - Intergenic
1114047308 14:18886642-18886664 GCCTCCCGAATAACTACAGCAGG - Intergenic
1114116907 14:19632755-19632777 GCCTCCCGAATAACTACAGCAGG + Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1116072476 14:40066346-40066368 GCCTTCAGAGTGAATGAAGCAGG - Intergenic
1118951388 14:70439439-70439461 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
1120355771 14:83431765-83431787 GCCTCCCAAGTAGCTAGAGCAGG - Intergenic
1121365657 14:93307271-93307293 GCCTCCCAAGTAGCTAGAGCAGG + Intronic
1122747108 14:103904556-103904578 GCCTCCAGACTGATTAGCTCTGG + Intergenic
1125631376 15:41150257-41150279 GCCTCCAGAGTAAATTGAGCAGG - Intergenic
1128600645 15:68992812-68992834 GCTTCTGGGGTGACTAGAGCAGG + Intronic
1128600652 15:68992877-68992899 GCTTTCGGAGTGACCAGAGCAGG + Intronic
1128976239 15:72155876-72155898 GCCTTCCGAGTGGCCAGAGCTGG + Intergenic
1129714189 15:77837410-77837432 GAGTCCAGTGTGACCAGAGCTGG - Intergenic
1129851567 15:78796772-78796794 GCCTCCAGTGTACCCAGAGCTGG - Exonic
1130841963 15:87709164-87709186 GCCACCAAAGAGACTAGTGCGGG - Intergenic
1132249567 15:100325108-100325130 CCCTCCAGAGTGGCTGGAGGTGG + Intronic
1134685881 16:16157797-16157819 GCCTCCAGGGAGCCTGGAGCAGG + Exonic
1134809532 16:17155536-17155558 CCCTCCCAAGTGACCAGAGCTGG - Intronic
1135167471 16:20152660-20152682 GCCTCCAGAGTAGCTGGAGGTGG - Intergenic
1135228128 16:20679313-20679335 GCCTCCAGTGTGGTCAGAGCAGG - Intronic
1135345760 16:21687215-21687237 GGCTCCACAGTGAGTGGAGCAGG + Intronic
1136176472 16:28520476-28520498 GCCTCCTGAGTCACTGTAGCTGG - Intergenic
1136271951 16:29153699-29153721 GCCTCCGGAGGGACTATGGCTGG - Intergenic
1136716910 16:32288819-32288841 GCCTGCAGAGGGAACAGAGCTGG + Intergenic
1137254764 16:46765738-46765760 GCCTCCAGAGTAACTAGCTCCGG - Intronic
1137614788 16:49839672-49839694 GCCTCCAGAGAGAACAGAGCCGG + Intronic
1138351665 16:56349218-56349240 GCCACTAGAGTGACCTGAGCTGG - Intronic
1139012359 16:62648459-62648481 TCCTCCAGATTGAATAGAGGTGG - Intergenic
1141163879 16:81647659-81647681 GCCTCCAGGGAGCCTGGAGCAGG + Intronic
1203145458 16_KI270728v1_random:1795385-1795407 GCCTGCAGAGGGAACAGAGCTGG + Intergenic
1143169657 17:4920921-4920943 GCCTCCAGACTGACTACCTCTGG - Intergenic
1143985577 17:10910760-10910782 GCTTCCACAGCAACTAGAGCAGG - Intergenic
1148446253 17:47739368-47739390 GCCTCCCGAGTCACCCGAGCGGG - Intronic
1150217003 17:63476679-63476701 GCCTCCGGAGTGACAAGGCCGGG - Intergenic
1151834953 17:76576515-76576537 GCCACCAGACTCACTAGGGCAGG + Intronic
1151882956 17:76905864-76905886 GGCACCAGAGTGACCAGATCGGG - Intronic
1152017707 17:77762536-77762558 GCCTCCTGAGTAGCTGGAGCCGG + Intergenic
1152842271 17:82577697-82577719 GCCTCCAAAGGGACTAGAGCTGG + Intronic
1152982873 18:295455-295477 GCCTCCAGACAGCCTGGAGCAGG - Intergenic
1154108581 18:11546929-11546951 GCTTCCAGTGTGACTAGAGCAGG + Intergenic
1154108590 18:11546994-11547016 GCCTCCTGATTGGCCAGAGCAGG + Intergenic
1154294798 18:13138547-13138569 GCCTCCCGAGGTACAAGAGCAGG - Intergenic
1155526576 18:26721850-26721872 GCCTCCAGAGTGGTATGAGCAGG + Intergenic
1160067432 18:75588984-75589006 TCCTGGAGAGTGACTAGAACCGG + Intergenic
1160621728 18:80175915-80175937 ACCTCCAATGTGACTGGAGCTGG - Intronic
1160714061 19:567493-567515 GCTTCCGGGGTGACTAGAGCAGG + Intergenic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164017081 19:21262678-21262700 GCCTCCAGAGTGGTCAGAGCAGG - Intronic
1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG + Intronic
1164054456 19:21610008-21610030 GCCTCCAGTGTGGTCAGAGCAGG - Intergenic
1164142567 19:22486246-22486268 GCTTCCAGTGTGACTAGAGCGGG + Intronic
1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG + Intronic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1165129526 19:33623023-33623045 GCCTCCAGCGAGGCCAGAGCGGG - Intronic
1165704155 19:37963274-37963296 AGCTCCAGAGAGACTAGAGGGGG - Intronic
1166083541 19:40459982-40460004 GCCTACAGACTGACCAGTGCTGG + Intronic
1166090091 19:40503151-40503173 GTCTCCAGGGTAACTAGAGAGGG + Intronic
1166875595 19:45895364-45895386 GCCTCCTGAGTAGCTATAGCTGG + Intronic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168043034 19:53774163-53774185 GCCTCCACATTGATTAGAGGAGG + Intergenic
925344138 2:3158089-3158111 GCCTCCCGAGTGAGTGTAGCTGG - Intergenic
925522595 2:4764361-4764383 GCCTACAGAGTGAATAAAGTAGG + Intergenic
926272247 2:11375525-11375547 GCTTCGAGAGTGACTGGAACAGG - Intergenic
930173917 2:48281837-48281859 GCCTCCTGAGGGACTGGAGGTGG - Intergenic
931345479 2:61441437-61441459 GGCTGCAGAGAGACTAGAGCTGG + Intronic
932756681 2:74414583-74414605 GCCTCCACAGGGTCTGGAGCTGG - Exonic
935607099 2:104982257-104982279 CCCTCCACAGTGACATGAGCAGG + Intergenic
940109076 2:150130667-150130689 GCTTCCAGAGCGACAAGAACTGG + Intergenic
940806603 2:158194552-158194574 ACCTCCAGAGAGCCTAGGGCAGG - Intronic
941842854 2:170106505-170106527 GTCTCCACAGAGAATAGAGCAGG + Intergenic
943445326 2:187978200-187978222 GCATCTATAGTGACTAGATCTGG - Intergenic
944518016 2:200531784-200531806 GCCTCCAGAGAGAGTGCAGCTGG - Intronic
946884047 2:224205386-224205408 ACCCCCAGGGTGACTATAGCTGG + Intergenic
1173513224 20:43646614-43646636 GCCACCAGAGTGAGTACTGCTGG - Intronic
1173732152 20:45336501-45336523 GCCTCCAGAGTTATTAAAACAGG - Intronic
1174861770 20:54098017-54098039 GCCACCTGAGTGCCAAGAGCAGG + Intergenic
1175268432 20:57716757-57716779 GGCTGCACAGTGACTAGCGCAGG + Intergenic
1175927675 20:62479051-62479073 GCCTCCACAGTGACTGGTGGGGG + Intergenic
1175986174 20:62765140-62765162 ACCTCCAGAGTGACAGGAGCGGG - Intergenic
1175991700 20:62793130-62793152 GGGTCCACAGGGACTAGAGCAGG + Intergenic
1176346348 21:5751893-5751915 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176353162 21:5872477-5872499 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176498479 21:7572562-7572584 GCCTCCAGTGTGGTCAGAGCAGG - Intergenic
1176540669 21:8149963-8149985 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176559620 21:8333008-8333030 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1179086814 21:38225659-38225681 GCTTCCAGGGTGACTAGAGCAGG + Intronic
1179086823 21:38225723-38225745 GCTTCTGGAGTGACCAGAGCAGG + Intronic
1179382365 21:40911262-40911284 GCCCCCAGAGAGTCTTGAGCAGG - Intergenic
1180465841 22:15609297-15609319 GCCTCCCGAATAACTACAGCAGG - Intergenic
1180956113 22:19742113-19742135 GCTTCCAGAGAGCCTACAGCTGG + Intergenic
1182829769 22:33295574-33295596 GCCTCCAGAGTGAGCAGCACAGG - Intronic
1184010314 22:41743055-41743077 GCATCCAGAGAGACAAAAGCAGG - Intronic
1184900496 22:47443843-47443865 TCCTTAAGCGTGACTAGAGCTGG - Intergenic
1203245610 22_KI270733v1_random:66381-66403 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
949519117 3:4833691-4833713 GGCTCCAGTGTGGCTGGAGCTGG - Intronic
949862244 3:8516277-8516299 CCCTCCTGAGAGACAAGAGCCGG + Intronic
950167894 3:10815638-10815660 ACCTGCAGAGTGTCTAGGGCTGG + Intergenic
954932813 3:54298683-54298705 GCCTCCTGAGTAGCTATAGCTGG - Intronic
956444163 3:69309249-69309271 GCCTCCTGAGTGGCTAGGACTGG + Intronic
959071886 3:101709632-101709654 GCCTCCAGAAAGACTAGAGACGG - Intergenic
959702377 3:109310285-109310307 GCCTCCTGAGTAGCTGGAGCTGG - Intronic
959961921 3:112307054-112307076 GCCTCCGGAGTGGCCACAGCAGG - Intergenic
961091460 3:124116126-124116148 GCCACCAGAGGGAAGAGAGCTGG - Intronic
962376402 3:134862164-134862186 GCCTCCTGAGTATCTAGCGCTGG + Intronic
962648789 3:137467046-137467068 GGCTCCAGAGTGCGTAGAGCAGG - Intergenic
963575303 3:147053331-147053353 GCATCCAGTGTGACTAGATTTGG + Intergenic
963752862 3:149201242-149201264 GCCTCCAGAGTAACTAGGACAGG + Intronic
964887788 3:161503706-161503728 GCCACCAGACTGATTCGAGCAGG - Exonic
968480074 4:829353-829375 GCTTCCAGAGAGGCTAGAGCTGG - Intergenic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
972651591 4:41022540-41022562 GACTCCAGAGGGACAAGAGAAGG - Intronic
974976539 4:68901154-68901176 GCTCCCAGTGTGACTAGAGCAGG + Intergenic
978953588 4:114590829-114590851 GCTTCCAGTGTGATCAGAGCAGG + Intergenic
979058031 4:116018946-116018968 GCTTCCAGAGTTACCAGAGCAGG - Intergenic
979058036 4:116019010-116019032 GCTTCCGGGGTGACTAGAGCAGG - Intergenic
980650280 4:135704644-135704666 GGCTCCAGGGTGATTAGAGTAGG + Intergenic
989998202 5:50860860-50860882 GTCTCCATAGAGACTTGAGCAGG + Intergenic
991418093 5:66412102-66412124 GCCTCCAGGGTGACCATAGTGGG - Intergenic
994808792 5:104486257-104486279 GCCTCCCGAGTGGCTGTAGCTGG - Intergenic
996550470 5:124725036-124725058 GACACCAGAGTGACTGAAGCTGG - Intronic
998380455 5:141721273-141721295 GGCTCCAGAGTGAAGAAAGCAGG - Intergenic
999028978 5:148268842-148268864 ACATCCAAAGTGACAAGAGCAGG + Exonic
999753723 5:154648827-154648849 CCCTCCAGAGTGGCTGGGGCTGG + Intergenic
1001130125 5:169056987-169057009 GTCTCCATAATGACAAGAGCAGG + Intronic
1001254567 5:170173509-170173531 GCCTACAGAGTGGCCAGCGCTGG + Intergenic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1007584440 6:42980203-42980225 GCCTCCCGAGTAACTGTAGCCGG + Intergenic
1007836353 6:44676910-44676932 GGCTCCAGAGTGTCTAGGACTGG - Intergenic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1009494737 6:64332673-64332695 GCCTCCAGTGTGGATGGAGCAGG - Intronic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1016272156 6:142301854-142301876 GCTTCCGGCGTGACTGGAGCTGG - Intronic
1017966287 6:159269870-159269892 ATCACCAGACTGACTAGAGCAGG - Intronic
1019811685 7:3169588-3169610 GCCTCCTGAGTACCTAGAACAGG - Intronic
1020149030 7:5667447-5667469 ACCTCCAGGGTAACTAGAGATGG - Intronic
1020257091 7:6508439-6508461 GGGCCCAGAGAGACTAGAGCAGG + Intronic
1023029444 7:36079674-36079696 GCCTCCACAGTTAGTAGACCAGG - Intronic
1024497644 7:50066809-50066831 GCCTCCAGTGTGGTCAGAGCAGG + Intronic
1025823535 7:64993186-64993208 GCTTCTGGGGTGACTAGAGCAGG + Exonic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1031300241 7:120055522-120055544 GCTTCCAGGGTGACTAGAGCAGG + Intergenic
1032783168 7:135180336-135180358 GCCTCCAGAGTGATCACAGCAGG - Intergenic
1033109153 7:138559552-138559574 GCTTCTGGGGTGACTAGAGCCGG + Intronic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1035290454 7:157834717-157834739 GCCTCCAGTGAGCCTGGAGCCGG + Intronic
1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG + Intergenic
1042207104 8:66340350-66340372 GCCTACAGAGTGGATTGAGCAGG + Intergenic
1042561084 8:70072301-70072323 GCCGCCAGAGTCCCTAAAGCTGG + Intergenic
1042873615 8:73420199-73420221 GCCTCCTGGGTGACTCGGGCCGG - Intergenic
1046797499 8:118388841-118388863 GCCAACAGAGAGACCAGAGCTGG + Intronic
1048295914 8:133213087-133213109 GCCTCTACTGTGACTACAGCGGG + Exonic
1049010441 8:139883817-139883839 GGCTCCAGAGTGAGCAGAGCCGG - Intronic
1053002579 9:34585547-34585569 GCCCCCAGAGTGCCTAGCTCTGG + Intronic
1057305339 9:93909063-93909085 CCCCCCAGAGTGACCAGAGGTGG - Intergenic
1058296040 9:103308366-103308388 GCTGCCAGACTGGCTAGAGCTGG + Intergenic
1059409834 9:114124893-114124915 GCCTCCAGAGTGGGGAGGGCAGG - Intergenic
1060915267 9:127385137-127385159 GCCTCCAGGGTGAGTAGGACTGG + Exonic
1061068198 9:128292288-128292310 GCCACCAGAGTGACCACAGCAGG + Intergenic
1061264873 9:129499089-129499111 GGTTCCAGAGTGACCAGGGCTGG - Intergenic
1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG + Intronic
1062595968 9:137299415-137299437 ACCTCCAGCGTGCCCAGAGCTGG - Intergenic
1203435023 Un_GL000195v1:130218-130240 GCCTGCAGAGGGACTAGGGAGGG - Intergenic
1203461948 Un_GL000220v1:49453-49475 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1187120312 X:16399361-16399383 GCCTCCCGAGTAGCTGGAGCTGG + Intergenic
1194090806 X:89580687-89580709 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1194090813 X:89580751-89580773 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1197946626 X:131846168-131846190 TTCTCCAGAGTGACTAGAAGTGG - Intergenic
1198469410 X:136932308-136932330 GCTGCCAGTGTGACTAGAGCAGG + Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1200180431 X:154147169-154147191 GCCACCAGTGTAACTAGAGCTGG - Intronic
1200186259 X:154185564-154185586 GCCACCAGTGTAACTAGAGCTGG - Intergenic
1200191911 X:154222702-154222724 GCCACCAGTGTAACTAGAGCTGG - Intronic
1200197666 X:154260506-154260528 GCCACCAGTGTAACTAGAGCTGG - Intronic
1200443458 Y:3236747-3236769 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1200443465 Y:3236811-3236833 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1200779559 Y:7201958-7201980 GCCTCCAGAGTGGTCAGAGCAGG - Intergenic
1201858319 Y:18569408-18569430 ACTTCCAGGATGACTAGAGCAGG + Intronic
1201875002 Y:18750973-18750995 ACTTCCAGGATGACTAGAGCAGG - Intronic
1202168726 Y:22018664-22018686 GCTTCCAGGATGACTACAGCAGG - Intergenic
1202222635 Y:22567704-22567726 GCTTCCAGGATGACTACAGCAGG + Intergenic
1202320480 Y:23627956-23627978 GCTTCCAGGATGACTACAGCAGG - Intergenic
1202550287 Y:26042100-26042122 GCTTCCAGGATGACTACAGCAGG + Intergenic