ID: 1084390649

View in Genome Browser
Species Human (GRCh38)
Location 11:68874647-68874669
Sequence ATGGCACCCAAGATATTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084390649_1084390654 2 Left 1084390649 11:68874647-68874669 CCTACAAATATCTTGGGTGCCAT No data
Right 1084390654 11:68874672-68874694 GAGAAACCCCCTAGTGGGGATGG No data
1084390649_1084390653 -2 Left 1084390649 11:68874647-68874669 CCTACAAATATCTTGGGTGCCAT No data
Right 1084390653 11:68874668-68874690 ATCAGAGAAACCCCCTAGTGGGG No data
1084390649_1084390652 -3 Left 1084390649 11:68874647-68874669 CCTACAAATATCTTGGGTGCCAT No data
Right 1084390652 11:68874667-68874689 CATCAGAGAAACCCCCTAGTGGG No data
1084390649_1084390651 -4 Left 1084390649 11:68874647-68874669 CCTACAAATATCTTGGGTGCCAT No data
Right 1084390651 11:68874666-68874688 CCATCAGAGAAACCCCCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084390649 Original CRISPR ATGGCACCCAAGATATTTGT AGG (reversed) Intergenic
No off target data available for this crispr