ID: 1084391150

View in Genome Browser
Species Human (GRCh38)
Location 11:68877967-68877989
Sequence CAAGGTGGTCCACAGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084391150_1084391156 0 Left 1084391150 11:68877967-68877989 CCTCCCTGCTGTGGACCACCTTG No data
Right 1084391156 11:68877990-68878012 TTGGTGACCAGAGTTCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084391150 Original CRISPR CAAGGTGGTCCACAGCAGGG AGG (reversed) Intergenic
No off target data available for this crispr