ID: 1084392150

View in Genome Browser
Species Human (GRCh38)
Location 11:68884460-68884482
Sequence GCAAATCTTCAGAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084392150_1084392154 10 Left 1084392150 11:68884460-68884482 CCTTCCACCCTCTGAAGATTTGC No data
Right 1084392154 11:68884493-68884515 ATGTCAAAAGACAGATTAATAGG No data
1084392150_1084392155 18 Left 1084392150 11:68884460-68884482 CCTTCCACCCTCTGAAGATTTGC No data
Right 1084392155 11:68884501-68884523 AGACAGATTAATAGGAGAAAAGG 0: 15
1: 144
2: 360
3: 527
4: 870

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084392150 Original CRISPR GCAAATCTTCAGAGGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr