ID: 1084394221

View in Genome Browser
Species Human (GRCh38)
Location 11:68898307-68898329
Sequence GCTGGGCTTGTGGTGTCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084394215_1084394221 -10 Left 1084394215 11:68898294-68898316 CCCATCCAAGAAGGCTGGGCTTG 0: 1
1: 0
2: 0
3: 14
4: 137
Right 1084394221 11:68898307-68898329 GCTGGGCTTGTGGTGTCTTGGGG 0: 1
1: 0
2: 2
3: 27
4: 199
1084394207_1084394221 25 Left 1084394207 11:68898259-68898281 CCCTCACTTGGGTACTTCTCAGT 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1084394221 11:68898307-68898329 GCTGGGCTTGTGGTGTCTTGGGG 0: 1
1: 0
2: 2
3: 27
4: 199
1084394208_1084394221 24 Left 1084394208 11:68898260-68898282 CCTCACTTGGGTACTTCTCAGTG 0: 1
1: 0
2: 1
3: 27
4: 377
Right 1084394221 11:68898307-68898329 GCTGGGCTTGTGGTGTCTTGGGG 0: 1
1: 0
2: 2
3: 27
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084394221 Original CRISPR GCTGGGCTTGTGGTGTCTTG GGG Intronic
900614244 1:3557435-3557457 GCTGGCCTGGAGGGGTCTTGAGG + Intronic
901032103 1:6313132-6313154 GCTAAGCTGGTGGTGTCTGGGGG + Intronic
901242311 1:7702808-7702830 GCTGGGGTTGGGGTGGCTTCTGG - Intronic
901334941 1:8441148-8441170 GCTGGGCTAGTGGTGTGACGAGG - Intronic
903036712 1:20497840-20497862 GCTGGGCTTGTGAGGACGTGTGG + Intergenic
904236038 1:29117925-29117947 CCTTGTCATGTGGTGTCTTGTGG - Exonic
904259508 1:29280256-29280278 GCAGGGCTTGGAGTGTCTGGAGG + Intronic
904730853 1:32590032-32590054 CCTGGGCTGGTGGTGCCTTCAGG - Intronic
906259732 1:44377932-44377954 CCTTGGCTTGGGGTGTGTTGAGG + Intergenic
906718040 1:47984799-47984821 GCTTGTCTTGTGGTGTGTTGTGG - Intronic
907323652 1:53621260-53621282 GCTGGGCTGGGGGAGACTTGGGG - Intronic
909658299 1:78055111-78055133 GCCGGCCATGTGGTATCTTGTGG + Intronic
910324631 1:85991450-85991472 GCTGGGCTTGTGGTTTCATGGGG + Intronic
911835628 1:102615091-102615113 GCTGGGCTTGTGTTGTCATTTGG - Intergenic
915320701 1:155054527-155054549 GGTGGGCTTTGGTTGTCTTGAGG + Intronic
922438245 1:225627799-225627821 ACTGGGCTTGGTGTGTCTGGAGG - Intronic
922880475 1:228976640-228976662 GTTGTCCCTGTGGTGTCTTGTGG + Intergenic
1063482095 10:6385069-6385091 CCTGGCCTTGTGGTCTCATGTGG + Intergenic
1064106852 10:12507656-12507678 GATGGGCTTGTGGTGTCCTGAGG + Intronic
1064132317 10:12721015-12721037 GCAGGGCTTTTGTTGTCTTTGGG + Intronic
1065139682 10:22708231-22708253 GCTGTGCTTGTGGTTGATTGCGG - Intronic
1065916732 10:30359436-30359458 GCTGTCCTTGTGGAGTCTTGTGG + Intronic
1067078874 10:43202896-43202918 GCTGGGCTGGTGGGGCCTGGGGG - Intronic
1067078892 10:43202950-43202972 GCTGGGGCTGTGGGGTCTCGGGG - Intronic
1067557040 10:47279679-47279701 GCAGGCCTTGTGGAGTCCTGGGG + Intergenic
1067737981 10:48873559-48873581 GCTGGGCTTGTGGAGCCAGGGGG + Exonic
1068669520 10:59709538-59709560 GCCGGGCTGGTGGTGTGGTGGGG + Exonic
1069820712 10:71225933-71225955 GCTGAGCCTGTGGTGGGTTGAGG + Intronic
1069830590 10:71280072-71280094 TCTGGGCCTGGGGTGTCCTGGGG - Intronic
1070407087 10:76106639-76106661 GCTGGGCTTGTGATGCAGTGTGG + Intronic
1075465650 10:122648466-122648488 CCTGGGCTCCTGGTGCCTTGGGG - Intergenic
1076253726 10:129003298-129003320 GCTAGTCTTGTGAGGTCTTGAGG + Intergenic
1076523929 10:131098981-131099003 CCTGGGCGTCTGGTGCCTTGGGG + Intronic
1076756080 10:132572446-132572468 GCTGTGCTGGTGCTGTCCTGGGG + Intronic
1076881563 10:133242020-133242042 CCTGGCCTGGTGGTGTCTCGAGG + Intergenic
1077037230 11:501288-501310 GCTTGTCTGGTGGTTTCTTGTGG - Intronic
1077347611 11:2071243-2071265 GCTGAGCTTGGGGTGTGTTAAGG - Intergenic
1077354302 11:2108090-2108112 GCTTGGCTTGGGGTGTCAGGGGG - Intergenic
1077457121 11:2687864-2687886 GCTGGACTTGGGGTGTCCCGCGG + Intronic
1080172192 11:29318275-29318297 GTTGGCTTTGTGCTGTCTTGTGG + Intergenic
1080569745 11:33545116-33545138 GCATGGCTTGTGGTTTCCTGGGG - Exonic
1083264282 11:61539091-61539113 CCTTGGCTTGTGGTGCCTTCTGG - Intronic
1083625976 11:64072161-64072183 GCTGGGCCTGGGGGGACTTGGGG + Intronic
1084325176 11:68396096-68396118 GCTGGGGTTGTGGTGGCTTCTGG + Intronic
1084394221 11:68898307-68898329 GCTGGGCTTGTGGTGTCTTGGGG + Intronic
1085319362 11:75564633-75564655 GCTGGGAGGGAGGTGTCTTGGGG + Intronic
1089372444 11:117970996-117971018 GCAGGGCTTGGGGTGGCCTGGGG - Intergenic
1091645333 12:2268592-2268614 GTTGGACCTGTGGTGTCCTGGGG + Intronic
1091767391 12:3130496-3130518 GCTGGGCAGATGGTGTCTGGAGG + Intronic
1091969490 12:4773597-4773619 CCTGTGCGTGTGGTGTGTTGTGG + Intronic
1096533049 12:52253920-52253942 TCTGGGCTTGAGGAGTCCTGAGG - Intronic
1097684174 12:62676636-62676658 GCTGGGTGTGTGGGGGCTTGGGG + Intronic
1100532122 12:95470470-95470492 GCTGAGTCTGAGGTGTCTTGGGG - Intergenic
1102255498 12:111412412-111412434 GCTGGGCTCGGGGCGTCATGGGG - Intronic
1102944960 12:116978680-116978702 GCTGGTCTTGTGGTCTTTAGTGG - Intronic
1102986120 12:117280057-117280079 GATGTGCTTGTGCTGTCATGTGG + Intronic
1103443197 12:120978625-120978647 GCTTGGCTAGTGGGGTTTTGGGG + Exonic
1106240501 13:27908604-27908626 GCTCGGATTTTGGTGTTTTGGGG + Intergenic
1113455046 13:110442488-110442510 GAGGGGCTTTTGGTGTCTAGGGG - Intronic
1116211144 14:41946398-41946420 GCTGGGCTTGAGGTATCCTCTGG + Intergenic
1120917859 14:89725584-89725606 GCTGGGCTTTTAGTTTCTTTAGG + Intergenic
1121925872 14:97926905-97926927 GCTACGTTTGTGGTGACTTGAGG + Intronic
1122045668 14:99021407-99021429 GATGGGCATGCGGTGTCATGGGG - Intergenic
1122405528 14:101498602-101498624 GCTGGACTGGTGGTTTCTGGAGG + Intergenic
1122782843 14:104150871-104150893 GCTGGGCTGGTGCTGTCCTGGGG + Intronic
1124330222 15:28806234-28806256 GGTGGGCTAGTGCTGGCTTGTGG + Intergenic
1124483712 15:30098484-30098506 GCTGTCCTTTTGGAGTCTTGTGG - Intergenic
1124504610 15:30262028-30262050 GCTGGGTCGGGGGTGTCTTGAGG + Intergenic
1124519867 15:30398742-30398764 GCTGTCCTTTTGGAGTCTTGTGG + Intergenic
1124538787 15:30567481-30567503 GCTGTCCTTTTGGAGTCTTGTGG - Intergenic
1124738942 15:32276607-32276629 GCTGGGTCGGGGGTGTCTTGAGG - Intergenic
1124759864 15:32440100-32440122 GCTGTCCTTTTGGAGTCTTGTGG + Intergenic
1126548710 15:49903460-49903482 GCTGTGCTTGTAGTGACATGGGG - Intronic
1127279715 15:57478545-57478567 GATTGTCTTGTGGTGTGTTGTGG + Intronic
1128256509 15:66201200-66201222 GCTGGACTTGTGGTGGGATGAGG - Intronic
1128841258 15:70853526-70853548 GATGGGGAGGTGGTGTCTTGAGG + Intronic
1129210533 15:74065512-74065534 GCTGTCCTTGTGGAGTCTTGTGG + Intergenic
1129403479 15:75299817-75299839 GCTGTCCTTGTGGAGTCTTGTGG - Intergenic
1129840162 15:78738746-78738768 GCTGTCCTTGTGGAGTCTTGTGG - Intergenic
1130080931 15:80732875-80732897 TGTGGCCTTGTGGTGTCCTGGGG + Intronic
1130271847 15:82455829-82455851 GCTGTCCTTGTGGAGTCTTGTGG + Intergenic
1130282569 15:82531354-82531376 GCTGTCCTTTTGGAGTCTTGTGG - Intergenic
1130446327 15:84005161-84005183 TGTGGGCTGCTGGTGTCTTGGGG - Intronic
1130464198 15:84183216-84183238 GCTGTCCTTGTGGAGTCTTGTGG + Intergenic
1130488489 15:84411603-84411625 GCTGTCCTTGTGGAGTCTTGTGG - Intergenic
1130500068 15:84490319-84490341 GCTGTCCTTGTGGAGTCTTGTGG - Intergenic
1130586495 15:85187851-85187873 GCTGTCCTTGTGGAGTCTTGTGG + Intergenic
1132185240 15:99797774-99797796 GCTGTCCTTTTGGAGTCTTGTGG - Intergenic
1132431748 15:101766781-101766803 GCTGTCCTTTTGGAGTCTTGTGG + Intergenic
1132500916 16:284342-284364 CCTGGGGTTGTGGTGGCCTGGGG + Intronic
1134091594 16:11394315-11394337 TCCGGGCTTGTGTTCTCTTGGGG - Intronic
1137742755 16:50796347-50796369 TCTGGGCATGGGGTGACTTGAGG - Exonic
1139264334 16:65624906-65624928 GATGGGCTTGTGCTGATTTGAGG - Intergenic
1140521430 16:75585270-75585292 GCTGGGCTAGTGGAGTATGGGGG - Intergenic
1141199855 16:81889282-81889304 GCTGGGCTTGTTGTCGCTTGGGG + Intronic
1141908867 16:87045043-87045065 TCTGGGCTTGTGGGGCCTCGGGG - Intergenic
1142604949 17:1076449-1076471 GCTGAGCTTGTGCTTTCTTTTGG - Intronic
1143500387 17:7335400-7335422 GCTGTGCTTGTTCTGGCTTGAGG - Intergenic
1146509175 17:33430973-33430995 GCAGGGCTTGTGGTCTTTAGTGG - Intronic
1150550409 17:66204485-66204507 CCTGGGATTGTGGTGACTAGGGG + Intergenic
1151196992 17:72438750-72438772 GCTGGGCTTGAGGTGGGTTTAGG - Intergenic
1151523484 17:74647803-74647825 GCTGGGCTCTGGGTGCCTTGTGG - Intergenic
1152584383 17:81182466-81182488 GCTGGGCAAGCGGTGTCTGGAGG - Intergenic
1156447736 18:37249603-37249625 GCTGAGCCCGTGGAGTCTTGGGG - Intronic
1157396533 18:47346183-47346205 GCTGGGCTGGGGGTGGCATGGGG + Intergenic
1160354168 18:78212917-78212939 ACTGGGCTTGTGGTGTTTGGGGG + Intergenic
1160406478 18:78649775-78649797 CCTGGGCTTGGGGTGTCAGGAGG - Intergenic
1160442270 18:78901957-78901979 GTTTGGCGTGTGGTGTCTGGAGG - Intergenic
1161760569 19:6168115-6168137 GCTAGGCTTGCAGTGCCTTGTGG - Intronic
1162402217 19:10453202-10453224 GCTGGGCTTGGGGAGTCCCGGGG - Intronic
1164725382 19:30462369-30462391 GGTGTGCTTGTGCTGTCTTGGGG + Intronic
1166532832 19:43552827-43552849 GCTGGGCTGGTGGTTTGCTGGGG + Exonic
1166717194 19:44976185-44976207 GCTGGGCTTGAGGTCTCTGTGGG - Intronic
1166817690 19:45556818-45556840 CCTGGGCTTGTGGGTTCCTGGGG + Intronic
1167342137 19:48922245-48922267 GCTGGGCCTCTGGGGTCCTGGGG + Intronic
926099227 2:10103419-10103441 GCTGGGCTTCAGCTGTCCTGAGG - Intergenic
927202809 2:20589006-20589028 GCTGGGTTAGTGGTGACTTTGGG - Intronic
927488173 2:23503557-23503579 GGTGGGCTCGTGGTGTGTAGCGG - Intronic
927907999 2:26875685-26875707 CCTGGGCTGGTGGTGGCTGGGGG + Intronic
929194128 2:39167258-39167280 GCTGGCCTTGTGATCTCCTGAGG - Intergenic
929906586 2:46051276-46051298 CCTGGGCTGGTGGTTTCTGGTGG + Intronic
931215109 2:60234734-60234756 GCTGGGCTTTTGGAGCCTTGGGG - Intergenic
933854548 2:86400598-86400620 GCTGTGCTTTTGTTGTGTTGGGG - Intergenic
934106276 2:88697891-88697913 GGTGGGCCTGATGTGTCTTGTGG + Intronic
936114432 2:109690765-109690787 GCTGGGGGTGGGGTGTGTTGGGG + Intergenic
942311615 2:174661853-174661875 ACTGGGTGTGTGGTGTCTGGGGG + Intronic
943658125 2:190530443-190530465 GCTAGGCTTGTGGCTTCTTATGG - Intronic
946971010 2:225091470-225091492 GATTGTCTTGTGGTTTCTTGAGG + Intergenic
948493534 2:238330156-238330178 GTTGTGCATGTGGTGTCTTTAGG + Intronic
948716470 2:239867843-239867865 GCTGTGCTTGTGGTGTGTAGGGG - Intergenic
1172332269 20:34083403-34083425 ACTGGGCTTGTCTTCTCTTGCGG - Intronic
1173742397 20:45410182-45410204 GCTGGGCCTGTGGTCTCATGTGG - Exonic
1173967718 20:47126110-47126132 GCTGGGCTTGTGTCTCCTTGGGG - Intronic
1175222179 20:57423560-57423582 CCTTGGCTTGAGGTCTCTTGAGG + Intergenic
1175882716 20:62270144-62270166 GCAGTGCCTGTGGTGTCCTGAGG + Intronic
1176238290 20:64064279-64064301 CCTGGGCCTCTGTTGTCTTGCGG + Intronic
1176429805 21:6568579-6568601 GCTGGGCTTTTGGTGCCTCCAGG + Intergenic
1179483695 21:41694938-41694960 GGTGGGCTGGGGGAGTCTTGGGG - Intergenic
1179705199 21:43176041-43176063 GCTGGGCTTTTGGTGCCTCCAGG + Intergenic
1180741890 22:18059241-18059263 GCTGGGCGTGGGGTGGCTTCTGG - Intergenic
1181061931 22:20285783-20285805 CCAGGGCCTGGGGTGTCTTGGGG + Intergenic
1181939279 22:26463063-26463085 GCAGGGCAAATGGTGTCTTGGGG - Intronic
1184175705 22:42787636-42787658 GCTGTCCTTGTGGAGTCTTGTGG - Intergenic
1184864232 22:47193364-47193386 GCAGGGGGTGTGGTGTCCTGGGG + Intergenic
1185017402 22:48352752-48352774 TCGGTGCTTGTGGTTTCTTGGGG + Intergenic
950564654 3:13761276-13761298 GCTGGCATTCTGTTGTCTTGTGG + Intergenic
951532897 3:23714331-23714353 GCAGTGCATGTGGTGGCTTGGGG - Intergenic
953248788 3:41223845-41223867 GCTGTGGTTGAGGTGTCTGGAGG + Intronic
953706506 3:45235048-45235070 GCTGGGCCTTTGGTGGATTGTGG - Intergenic
954368331 3:50157474-50157496 CCTGGGCTTGGTGTGACTTGGGG + Intronic
954798191 3:53172142-53172164 GCTGGGCATGTGGAGGCTGGGGG + Intronic
955089182 3:55732480-55732502 GCTTGGTTTTTGGTGTCATGGGG - Intronic
956738708 3:72258673-72258695 GCTGGGTTTGCAGTGTGTTGAGG - Intergenic
960037960 3:113120679-113120701 CCTGGGCTGGTGGTATCTGGTGG - Intergenic
961830633 3:129621354-129621376 GCTGGGCGGGTGGGGTCTCGTGG - Intergenic
962707338 3:138057686-138057708 GCTGAGATTGTACTGTCTTGGGG - Intergenic
964036158 3:152199655-152199677 GCTGGAGTTGTGGAGTTTTGGGG + Intergenic
964840184 3:160984915-160984937 GGAGGGCTGGTGGTGTCTAGTGG + Intronic
965052715 3:163671337-163671359 GCTGGGCTTGTTGTGGCTGGGGG + Intergenic
965091221 3:164164750-164164772 CCTGGGCTTTGGGTGTGTTGAGG - Intergenic
969547203 4:7838184-7838206 GCTGGGCTTCTGAAATCTTGTGG - Intronic
970593780 4:17581239-17581261 GCAGTGTTTTTGGTGTCTTGTGG + Intronic
977901201 4:102424403-102424425 GGTGGGCTTGTGGGGTGTAGAGG + Intronic
981820092 4:148876583-148876605 GGTGGGATTGTTGTGTCTTATGG + Intergenic
989454028 5:41621429-41621451 GCTTTGGTTGTGGTGACTTGAGG - Intergenic
989514857 5:42329863-42329885 CCTGGGTATATGGTGTCTTGTGG - Intergenic
990784741 5:59407029-59407051 ACTGGACTTGTAGAGTCTTGGGG + Intronic
990946167 5:61252075-61252097 GCTGGGCCTGTGATGTCTCAGGG + Intergenic
994183601 5:96794922-96794944 GCTGGGGTTTTTGTGGCTTGAGG + Intronic
998145476 5:139725302-139725324 GCTGGGCGTCTGGGGCCTTGAGG + Intergenic
999608835 5:153347409-153347431 GCAGGGCTCATGGTGTATTGAGG - Intergenic
1001400956 5:171446230-171446252 GCTAGGCTTGTGGTGGGTGGAGG + Intronic
1001769973 5:174287546-174287568 GCTGGTTGTGTGGTCTCTTGGGG - Intergenic
1002301027 5:178257350-178257372 GCTGGGCCTGTTGTGTGGTGGGG + Intronic
1005341299 6:24845965-24845987 GATGGGCTTGTGGTGGGCTGTGG + Intronic
1005713320 6:28523351-28523373 GAAGGGCTTGGGGTGTTTTGTGG + Intronic
1006135828 6:31896321-31896343 TCTGGGCTCGTGGTGGCTGGAGG + Exonic
1006188091 6:32191773-32191795 GCTAGGCTTGAGGGGTTTTGGGG + Exonic
1007042529 6:38736645-38736667 TCTGGGCTTTTGGTTTCTTACGG + Intronic
1007356467 6:41321424-41321446 GCTGGCCTGGTGGGGTCTGGAGG - Intergenic
1007664281 6:43505332-43505354 GCTGGGCTGGTGGTGGGGTGAGG - Exonic
1007819289 6:44548855-44548877 GGTGGGTTTGTGGCGTCTGGGGG + Intergenic
1007850986 6:44802594-44802616 GCAGGGCTTGTGGTATATTTTGG + Intergenic
1008046265 6:46854418-46854440 TCTTGGGTTGTGGTGACTTGGGG + Intronic
1015617501 6:135092737-135092759 GCTGGGTTTATGGTGTGTTTTGG - Intronic
1019737809 7:2659239-2659261 GCTGGCCTTGGAGTGTCCTGGGG + Intronic
1023998627 7:45177088-45177110 GGTGGACTTGTCCTGTCTTGGGG + Intronic
1024114995 7:46184338-46184360 GCTGGTCTTGTAATGTCTTTTGG - Intergenic
1025976852 7:66377012-66377034 GCTGGGCTTGTGGCGCCTGCCGG + Intronic
1031070686 7:117157973-117157995 GCTGGTCTCATGCTGTCTTGGGG - Intronic
1031205388 7:118750855-118750877 GCTGGGTTAGTGCTGCCTTGTGG - Intergenic
1032016103 7:128381274-128381296 GCTCGGCTTGTGGTGGGGTGGGG - Intergenic
1032173817 7:129607935-129607957 GTTGGGCTTCTGGTCTCTAGAGG - Intergenic
1033495431 7:141889176-141889198 GCTGGGCTTTCTGTGTCTTTGGG + Intergenic
1035779536 8:2216842-2216864 CCGGGGCTTGTGCTGTCTTCTGG + Intergenic
1035940374 8:3893675-3893697 GCTGCGGTTGTTGTGTTTTGAGG - Intronic
1036755781 8:11470294-11470316 GGGGGTCTTGTGGTGTCTTGGGG + Intronic
1039367059 8:36939876-36939898 GCTGGGATTATGATGTCATGGGG + Intergenic
1039956061 8:42207930-42207952 GCTGGGAGTGGGGTGTCTTCTGG + Intergenic
1040531788 8:48271932-48271954 CCTGGGCCTGGGGTGCCTTGTGG + Intergenic
1043679829 8:83009548-83009570 GCTGGGCATGCAGTATCTTGAGG - Intergenic
1044406623 8:91834180-91834202 GCTGGACTTGTTCTCTCTTGGGG - Intergenic
1048198851 8:132354811-132354833 GCTGGGCTTGTGGAGTCAGTGGG + Intronic
1051078305 9:13266334-13266356 ACTGTGCTTGTGGTGACTAGTGG + Intronic
1052797429 9:32936230-32936252 GCTGGGCAGAAGGTGTCTTGTGG - Intergenic
1052991481 9:34521495-34521517 GCTGGGCTTCTGGGGTGGTGGGG + Exonic
1054753268 9:68930305-68930327 GCTGAGCTTGTGGAATCTAGTGG - Intronic
1055755751 9:79555574-79555596 GCTGGGTTAGTGGGGTCTCGTGG - Intergenic
1056953597 9:91065365-91065387 GCTGGGCCTGGGGCCTCTTGTGG - Intergenic
1056968260 9:91181769-91181791 GCAGGGCTTGCTGTGTGTTGGGG - Intergenic
1058153318 9:101486099-101486121 ACTGCGCTCGCGGTGTCTTGGGG - Intronic
1061061963 9:128254999-128255021 GCTATCCTTGTGGAGTCTTGTGG + Exonic
1061201629 9:129141540-129141562 GCTGGACTTGCGGTGTCAGGGGG + Intronic
1061733172 9:132632595-132632617 GCTGGCCTTGAGGTGTGTTCTGG + Intronic
1062289961 9:135790009-135790031 GCTGGGCTTTGTGTTTCTTGGGG - Intronic
1186437881 X:9558761-9558783 GCTGGGCTGCTGGTCTCCTGGGG - Intronic
1189252416 X:39611603-39611625 GCTGGGCTTGGGGAGTCCAGGGG - Intergenic
1189295475 X:39914719-39914741 CCTGGGATGGTGGTGTGTTGAGG - Intergenic
1198814432 X:140572999-140573021 TATGGGCTAGTGGTGCCTTGTGG + Intergenic
1199712039 X:150476548-150476570 GCTGGGAGTGTGGTTTCATGGGG + Intronic
1199925227 X:152455769-152455791 CCTGTGCTTGTGGAGTCTTTAGG - Intergenic
1200701458 Y:6406096-6406118 GCTGCCCTTGAGGTTTCTTGAGG + Intergenic
1200754228 Y:6974913-6974935 GCTGGGCTGCTGGTCTCTTGTGG - Intronic
1200937208 Y:8748794-8748816 GCTGTGCTTGAGGTTTCTTCAGG + Intergenic
1201032653 Y:9758602-9758624 GCTGCCCTTGAGGTTTCTTGAGG - Intergenic
1202367822 Y:24178977-24178999 GCTGTGCTTGCGGAGTCTTGTGG - Intergenic
1202371020 Y:24195422-24195444 GCTGTCCTTGTGGAGTCTTGTGG - Intergenic
1202499764 Y:25474695-25474717 GCTGTCCTTGTGGAGTCTTGTGG + Intergenic
1202502961 Y:25491146-25491168 GCTGTGCTTGCGGAGTCTTGTGG + Intergenic