ID: 1084396162

View in Genome Browser
Species Human (GRCh38)
Location 11:68911870-68911892
Sequence AACAAATAAACCCTGACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084396162_1084396167 26 Left 1084396162 11:68911870-68911892 CCCTGGGTCAGGGTTTATTTGTT 0: 1
1: 0
2: 0
3: 19
4: 190
Right 1084396167 11:68911919-68911941 TCCGTGTGCACGCCCGTGCAGGG 0: 1
1: 0
2: 2
3: 6
4: 56
1084396162_1084396166 25 Left 1084396162 11:68911870-68911892 CCCTGGGTCAGGGTTTATTTGTT 0: 1
1: 0
2: 0
3: 19
4: 190
Right 1084396166 11:68911918-68911940 CTCCGTGTGCACGCCCGTGCAGG 0: 1
1: 0
2: 1
3: 3
4: 65
1084396162_1084396169 27 Left 1084396162 11:68911870-68911892 CCCTGGGTCAGGGTTTATTTGTT 0: 1
1: 0
2: 0
3: 19
4: 190
Right 1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084396162 Original CRISPR AACAAATAAACCCTGACCCA GGG (reversed) Intronic
901830816 1:11891158-11891180 AACAAATAACACCTGACCCTTGG + Intergenic
904579804 1:31534394-31534416 AAAATAAAAAGCCTGACCCAAGG - Intergenic
907119823 1:51998581-51998603 AACATATGGTCCCTGACCCAAGG + Intergenic
907421206 1:54348555-54348577 AACAAATAAAGCCCAACCCCTGG - Intronic
909916857 1:81330559-81330581 AAAGAATAATTCCTGACCCAAGG - Intronic
910693305 1:89986288-89986310 AACAACTACACCCTGAATCAGGG - Intergenic
911488094 1:98527444-98527466 AACAAATAAGCCCAGAGCCTGGG - Intergenic
911628887 1:100159976-100159998 TAAAAACAAACACTGACCCAAGG + Intronic
912864074 1:113241232-113241254 AACAAATAAACCCAAATCCCTGG - Intergenic
915569506 1:156736710-156736732 AACAGAAAGAGCCTGACCCAGGG - Exonic
916061695 1:161103140-161103162 ACCACATGACCCCTGACCCAGGG + Intronic
916336421 1:163676039-163676061 AGAAAATAAAGCCTGAACCAAGG - Intergenic
919903909 1:202064369-202064391 AACAAACAAACCCAGAGTCAGGG - Intergenic
920127252 1:203703127-203703149 AACACATACCCCCAGACCCAGGG - Intronic
920531655 1:206706754-206706776 AACAAGTAAAGCCCCACCCACGG - Intronic
920552940 1:206880065-206880087 AACAAAACAACCCTGAGCAATGG - Intergenic
921322565 1:213956426-213956448 AACAAATAAAACCTGGGCAAAGG - Intergenic
923869481 1:237975284-237975306 CACAACTGGACCCTGACCCATGG + Intergenic
1063946767 10:11183972-11183994 ATCAAAGAAAACCTAACCCAAGG + Intronic
1064948794 10:20823005-20823027 AATAAATAAATGCTGACACAAGG + Intronic
1066436069 10:35397627-35397649 ACCAAATGAACCCTGTCCCTGGG + Intronic
1067940329 10:50649884-50649906 AGCAATGAAAACCTGACCCATGG - Intergenic
1068954301 10:62807490-62807512 AACAAATACTCCCTCACCCTGGG - Exonic
1069911893 10:71765105-71765127 AAGAAACAAAACCTGCCCCAAGG + Intronic
1070743315 10:78916765-78916787 ATCAAATAAACCCATACTCATGG + Intergenic
1071188426 10:83072094-83072116 AACATATACACACTGAACCATGG - Intergenic
1073588257 10:104731665-104731687 TACAAATCAACCCTGCTCCATGG + Intronic
1073696956 10:105880261-105880283 AAGAAATAAACCCTGGCCCCAGG + Intergenic
1074220020 10:111427370-111427392 TACAAATAAACCATGATCCCAGG - Intergenic
1074325409 10:112446570-112446592 TAGAAATAAATCCTCACCCAAGG + Intronic
1076330029 10:129657430-129657452 AACAGATAAACCCTGCCCTGAGG + Intronic
1077142881 11:1032140-1032162 AACTCAAAAACCCTGGCCCAGGG - Intronic
1084391617 11:68880977-68880999 AACAAATAAGCCCTAGCCCTTGG - Intergenic
1084396162 11:68911870-68911892 AACAAATAAACCCTGACCCAGGG - Intronic
1087989121 11:104725886-104725908 AACAAATACAGCATGGCCCAAGG - Intergenic
1088525082 11:110744129-110744151 TACAAATAAACTCTGACCATTGG - Intergenic
1089112869 11:116071085-116071107 AACAAATAAACTCTGGCCTGAGG + Intergenic
1090347058 11:126080078-126080100 ATTAAATAAACCCTGACTCATGG - Intergenic
1090554619 11:127860884-127860906 AACAAATAAATAGTTACCCAAGG - Intergenic
1090620949 11:128560766-128560788 AACAAATAAACCATGGCCTTAGG + Intronic
1091180996 11:133604544-133604566 CACCAACAAACCCTGACCCAAGG + Intergenic
1092077948 12:5688780-5688802 AAAGACAAAACCCTGACCCATGG + Intronic
1092153142 12:6264948-6264970 AACAAACATACCCAAACCCAGGG + Intergenic
1092816170 12:12314096-12314118 AACAAACAAACACTGACGCTGGG - Intergenic
1095194363 12:39295995-39296017 AACAAAAAAACCATATCCCAGGG - Intronic
1095902042 12:47338090-47338112 AACAAATAAACACAGTCTCAGGG - Intergenic
1095910894 12:47425072-47425094 AACAACTACACCCTAAGCCACGG + Intergenic
1096271946 12:50172433-50172455 AAGTAATAAACCCAGCCCCATGG + Intergenic
1098935763 12:76477549-76477571 AACAAAGAAAGTCTGACACACGG + Intronic
1100055013 12:90498306-90498328 AACAAATAACCCCTCAACCTGGG - Intergenic
1102770416 12:115471223-115471245 AGAAAATAAACCCAGATCCATGG - Intergenic
1104601591 12:130157559-130157581 AACAAATTAACCCTTAACCTGGG - Intergenic
1105991885 13:25630412-25630434 AACAAATAAATGCTGTCGCATGG - Intronic
1108421597 13:50255871-50255893 AAAAAATAAACCCAGCCCTATGG + Intronic
1111473805 13:88720779-88720801 AACCAGAAAACACTGACCCAAGG + Intergenic
1112792368 13:103016785-103016807 TAGAAATATACCCTAACCCAAGG - Intergenic
1114399418 14:22395802-22395824 AACAAGGAAACCCAGATCCAGGG + Intergenic
1117284085 14:54269327-54269349 AAGAAATAAACCCTCAACCCAGG + Intergenic
1120845458 14:89121265-89121287 AATAAATAAAAACTCACCCAAGG + Intergenic
1121217538 14:92260185-92260207 AACAAAGAAACCTAGGCCCAGGG + Intergenic
1121438865 14:93936349-93936371 CACAACTAAACCATGCCCCAGGG - Intronic
1202836514 14_GL000009v2_random:80970-80992 AACAAAAATACCCTGTCCGAAGG + Intergenic
1123813944 15:23957566-23957588 AACAAACAAACCCTGTGACACGG - Intergenic
1124224920 15:27885355-27885377 CACAAATAAATCCAGACCCATGG + Intronic
1127924104 15:63521615-63521637 TTAAAATGAACCCTGACCCAGGG - Intronic
1128747576 15:70125321-70125343 AGCAAATACACCCTGCCTCAGGG - Intergenic
1130875058 15:88006596-88006618 AACCAAAAAGCCCTGCCCCATGG + Intronic
1131803950 15:96102060-96102082 ATGAAATAAATCCTGACACATGG - Intergenic
1131898627 15:97062519-97062541 AACTAGTCAACCATGACCCAAGG + Intergenic
1135173027 16:20203316-20203338 AACAAATAAACACACACACACGG - Intergenic
1135836970 16:25835070-25835092 AAGAAATAAAACCTAACTCATGG - Intronic
1136574182 16:31113473-31113495 AATAAATAAAAACTCACCCATGG - Intergenic
1137532587 16:49289885-49289907 AACAAATAACACCTGTCACACGG - Intergenic
1138390328 16:56665944-56665966 AACAAATGAAGCCTGACCTTGGG + Intronic
1138391326 16:56671906-56671928 AACAAATGAAGCCTGACCTTGGG - Intronic
1139607966 16:68033437-68033459 AAGAAATAATCTCTGATCCAAGG - Intronic
1140358845 16:74328206-74328228 AAAAAGTAAATTCTGACCCATGG + Intergenic
1142551366 17:742112-742134 AAGAATTCAACTCTGACCCATGG - Exonic
1146479739 17:33195581-33195603 AAGAAATAAACCCTGTCCTCAGG + Intronic
1146712661 17:35056098-35056120 AACAAATAAACCCCGCCCCCAGG + Intronic
1149434603 17:56622452-56622474 AACAAACAAAGCCTGCCCCTTGG - Intergenic
1151157064 17:72132567-72132589 AAGAGATAAAGCCTGAGCCAAGG + Intergenic
1152796254 17:82309043-82309065 AAGACAGAATCCCTGACCCAGGG - Intergenic
1152845156 17:82595159-82595181 AGCAAATTACCCCTGCCCCACGG - Intronic
1154486659 18:14877242-14877264 CACAAATACTCCCTGCCCCATGG - Intergenic
1158953083 18:62514984-62515006 GAAAAATAAACTTTGACCCAAGG + Intergenic
1159209883 18:65304853-65304875 AATAAATAAACCTTGACTCAAGG + Intergenic
1160102511 18:75936318-75936340 ATCAAATAATCCCTGGCCCAAGG - Intergenic
1161506577 19:4647294-4647316 AACAAAAAAACCCAGTCCGACGG - Intronic
1163870707 19:19819248-19819270 AACAAATAATTTCTGACCCCTGG - Intronic
1164764235 19:30751407-30751429 AACAAATGGACCCTGACACTGGG - Intergenic
1165207913 19:34207073-34207095 AAAAAATAAAACTTGACCCCTGG + Intronic
1167871938 19:52377828-52377850 AAAAAATAATCCCTGAACTATGG - Intronic
925447921 2:3943391-3943413 AACAGGCAGACCCTGACCCAGGG - Intergenic
925731306 2:6921057-6921079 AACAAACAAACCCTTACGAATGG - Intronic
925917348 2:8616075-8616097 AAGAAAGAAACACTGACGCAGGG + Intergenic
926973410 2:18489278-18489300 GCCAAATAAACCCTGACCAGAGG + Intergenic
927262964 2:21112902-21112924 GGCAAATTAACCCTGTCCCAAGG + Intergenic
929654197 2:43714171-43714193 AAGTAATAAACCCTTAGCCATGG - Intronic
931993556 2:67816412-67816434 AGCAAATAATCCCTGCCCCCAGG - Intergenic
933903026 2:86862541-86862563 AACAAATAGAGCCAGCCCCAGGG - Intergenic
934534618 2:95122390-95122412 AATAAAAAAACCATGGCCCAGGG - Intronic
935598554 2:104899059-104899081 AACCAATAAACTTTGACCAAAGG + Intergenic
935777521 2:106486729-106486751 AACAAATAGAGCCGGCCCCAGGG + Intergenic
940352055 2:152701826-152701848 AACAAATAAACCCAGACTCTCGG + Intronic
945060356 2:205903574-205903596 AAAAAATAAACCCTGTGCAATGG - Intergenic
945262872 2:207860976-207860998 AACAAGGAAAACCTGATCCAGGG + Intronic
945429227 2:209745513-209745535 AACAAAAAAAACCAGACCAAAGG - Intergenic
946116900 2:217470821-217470843 AAAAAAAAAACACTGTCCCAAGG + Intronic
946820934 2:223628403-223628425 AAAAAAAAAATACTGACCCAGGG - Intergenic
946900584 2:224368056-224368078 AACAAATGGACCCAGAGCCACGG + Intergenic
948978643 2:241480709-241480731 AAGAAAGAAAGCCTAACCCAGGG + Intronic
1170508998 20:17057833-17057855 AACACATAATCCCTGCCCTATGG - Intergenic
1170558170 20:17532108-17532130 AACAAATAGAGCCCCACCCATGG + Intronic
1173027798 20:39325577-39325599 AACAAATAAACCCTAAACCCAGG - Intergenic
1176794643 21:13362137-13362159 CACAAATACTCCCTGCCCCATGG + Intergenic
1179194981 21:39156323-39156345 AACAAAAAAACCCTCAGCCTTGG - Intergenic
1181759221 22:25046343-25046365 AATCAAGAAACCCTCACCCAAGG - Intronic
1184374649 22:44103989-44104011 AACAAATTAACACAAACCCAGGG - Intronic
1184554264 22:45224862-45224884 AACACAGAACCCCTGACCCAGGG - Intronic
950639503 3:14339732-14339754 AACAAAAAAACCCAAACCAAGGG - Intergenic
950649724 3:14399726-14399748 GACAAAAAAACCCAGCCCCAAGG - Intergenic
951732466 3:25825356-25825378 AAAAAATAAACACTGACAAATGG + Intergenic
955474800 3:59325778-59325800 AACAAAAAAAACCTGAGCCTGGG + Intergenic
956775121 3:72558621-72558643 AACAAAAAAACCCTGAGACTGGG - Intergenic
958105905 3:89072715-89072737 CCCAAATAAACCCTCACACACGG + Intergenic
960153084 3:114271053-114271075 AACAGAACAACCCTGTCCCAAGG - Intergenic
960948441 3:122982840-122982862 AACAAATACACTCTGGCCCTAGG - Intronic
961677326 3:128575780-128575802 ATCAAATGAACCCGAACCCAAGG + Intronic
964170233 3:153761049-153761071 AACAAAAAAACTCTTACCCATGG + Intergenic
970053447 4:11943667-11943689 AACAAATAAACACATACCCAAGG + Intergenic
970401407 4:15720987-15721009 AGCACATAAGCCCAGACCCAGGG - Intronic
973365937 4:49209781-49209803 AACAAAAATACCCTGTCCGAAGG - Intergenic
973565414 4:52181443-52181465 AACAAGGAAAGCCTGAGCCAAGG + Intergenic
974592823 4:63976130-63976152 CAGAAATAAACCCTGAGACAAGG - Intergenic
981322408 4:143407814-143407836 AACAAATTAACCATGAAGCAGGG - Intronic
982771115 4:159398402-159398424 AACAAAGAAACCCTTTTCCATGG - Intergenic
983383124 4:167022757-167022779 TACAAATAGACCCTGAGTCATGG + Intronic
983535140 4:168849758-168849780 AAAAAAAAAACACTGACCCTTGG + Intronic
984071741 4:175122684-175122706 AACAAATCAACCCAAACCCAAGG + Intergenic
984300647 4:177912633-177912655 CCCATAAAAACCCTGACCCAGGG - Intronic
1202763441 4_GL000008v2_random:132262-132284 AACAAAAATACCCTGTCCGAAGG - Intergenic
992268465 5:75041242-75041264 CACAAACACACCCTCACCCAGGG + Intergenic
992493294 5:77267064-77267086 AACAAATAAGCCTTAACACAGGG - Intronic
997743373 5:136277532-136277554 AAAATATCATCCCTGACCCAAGG + Intronic
998413742 5:141930278-141930300 ACCAAATGGACCCTGCCCCAAGG + Intronic
1000156263 5:158554960-158554982 AAGAAAAAAACACTGATCCACGG - Intergenic
1000321903 5:160141031-160141053 AAAAAAGAAATCCTGACCCACGG - Intergenic
1000824902 5:166032958-166032980 AACAAACAAACTCTTTCCCATGG + Intergenic
1001236018 5:170030310-170030332 AACAAATCAAGCCCGACACAGGG + Intronic
1003526772 6:6904823-6904845 AAGAAATAAAGCCTGAAACAAGG + Intergenic
1004289098 6:14350420-14350442 TACAAAGAAACACAGACCCAAGG + Intergenic
1006966179 6:37987812-37987834 ACCAAACAAACCATGACCGAGGG - Intronic
1008872941 6:56292741-56292763 CACAAATAGACCCTGGCTCAGGG - Intronic
1011840212 6:91488224-91488246 AATAAATACACCCTGAATCAAGG - Intergenic
1012213503 6:96553845-96553867 AACAAATGAATCCTTCCCCAGGG - Exonic
1015826697 6:137320300-137320322 AGCAAACAAACTCCGACCCACGG + Intergenic
1016077659 6:139816478-139816500 AAAAAATAAACCCCCTCCCAAGG - Intergenic
1016326545 6:142909167-142909189 AATAAATATATCATGACCCAAGG + Intronic
1018185405 6:161262101-161262123 AAAAAAGAAACCCAGAGCCAGGG - Intronic
1019555320 7:1626470-1626492 AACAAACAAACCCAGAGACATGG + Intergenic
1020492834 7:8810678-8810700 GACAAATCAACCCAGACCAAAGG + Intergenic
1023686307 7:42739020-42739042 AAGAAATGGACCCTGACACAAGG + Intergenic
1025254969 7:57378538-57378560 AACAAACAAAAACTGACACACGG + Intergenic
1025264480 7:57443521-57443543 ATCCACTAAACCCTGGCCCACGG + Intergenic
1027436666 7:78171869-78171891 AACAAAAAAACCCTCCTCCAAGG - Intronic
1028525924 7:91786723-91786745 AACACATAGACCTTGACTCAAGG + Intronic
1028771151 7:94622845-94622867 AACAAATAAACCATAACTTAGGG - Intronic
1030902156 7:115137977-115137999 AACAAATAAAACCCAACCCATGG + Intergenic
1032113719 7:129099500-129099522 AACAAAAAAACCTTGTCCCGTGG - Intergenic
1032629722 7:133635750-133635772 AACAAGTACACCCTGGCCCAAGG + Intronic
1033449417 7:141449416-141449438 ACCAAAAATAGCCTGACCCAAGG + Intronic
1033671287 7:143495852-143495874 AACAAAGAAACTAAGACCCAGGG - Intergenic
1035604557 8:921262-921284 AACATTTAAACCCTGAGCCCAGG - Intergenic
1035610180 8:956761-956783 ATAAAATAAACCCTGAATCATGG - Intergenic
1035683073 8:1503021-1503043 AACAAACAAACTCTCAACCACGG - Intronic
1035944990 8:3952868-3952890 AACAAATCATCTCTAACCCAAGG + Intronic
1038171054 8:25132727-25132749 AAAAACAAAAACCTGACCCACGG + Intergenic
1038185455 8:25269847-25269869 AAAAAACAAAACCAGACCCACGG + Intronic
1038369607 8:26975273-26975295 GACAAATAGACAATGACCCAGGG + Intergenic
1039896553 8:41720590-41720612 CAGACATAACCCCTGACCCAAGG + Intronic
1042105529 8:65322332-65322354 AACGAATAAACCCTGGCTCCTGG + Intergenic
1044194967 8:89365007-89365029 AAGAAATAAACATTGATCCATGG - Intergenic
1046390100 8:113559968-113559990 AAAAAATAAACCATAATCCATGG - Intergenic
1047718747 8:127619519-127619541 CACACAGAAACCCTGGCCCATGG - Intergenic
1047868721 8:129058787-129058809 AACTAAGAAACGCTGACCCAAGG + Intergenic
1048518139 8:135129148-135129170 AACAAAAGAAGCCAGACCCAAGG - Intergenic
1048548886 8:135415289-135415311 AAAAAATAAGCCCTGAGCCCCGG + Intergenic
1048714961 8:137258146-137258168 AACAAAGAAACCCAGAGCAAAGG - Intergenic
1049213681 8:141398141-141398163 AGCAAATAAACCCTGAGCACTGG - Intronic
1050027686 9:1352617-1352639 AAAAACAAAATCCTGACCCATGG - Intergenic
1050362979 9:4848180-4848202 AAAAAGAAAAACCTGACCCATGG - Intronic
1050672419 9:8012620-8012642 AACAAATAATACCTGACATAAGG + Intergenic
1052440312 9:28488336-28488358 AGCAAAGAAACACTGACCCAAGG + Intronic
1052806409 9:33017765-33017787 AATAAAAAAACCCTAACCAAAGG - Intronic
1055786581 9:79875642-79875664 GAAAATTAAACACTGACCCAAGG + Intergenic
1056068582 9:82962504-82962526 AACAAATCATTCCTGACCCCAGG + Intergenic
1056616870 9:88175963-88175985 AAAAAACAAACCCTGAACAATGG - Intergenic
1060320316 9:122553151-122553173 AATAAATAAATACTGACACATGG + Exonic
1187728317 X:22226811-22226833 AACAAATGAACCTAGCCCCAAGG - Intronic
1189536645 X:41941944-41941966 AACAAATAAACATTTTCCCAAGG - Intergenic
1192093317 X:68183954-68183976 AACAAATATAACCTGACTCTAGG + Intronic
1192465980 X:71356354-71356376 AACAGCTAAACCCAGACACAAGG - Intergenic
1193277361 X:79604860-79604882 AACCCATAAACCCTGACCACTGG + Intergenic
1195116594 X:101705277-101705299 AACAAATAAACCCAAACATATGG + Intergenic
1196578382 X:117349390-117349412 AACAAATCAACCAAGCCCCATGG + Intergenic
1197139484 X:123100696-123100718 AAAAAAAAAACCAGGACCCAGGG + Intergenic
1197280206 X:124526660-124526682 AACAAATAAATCCTCTCCCTTGG - Intronic
1197703359 X:129616354-129616376 AACAGAAGAACACTGACCCAAGG - Intergenic
1201942648 Y:19476498-19476520 TACACATAATCCCTGAGCCAGGG + Intergenic