ID: 1084396163

View in Genome Browser
Species Human (GRCh38)
Location 11:68911871-68911893
Sequence GAACAAATAAACCCTGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084396163_1084396169 26 Left 1084396163 11:68911871-68911893 CCTGGGTCAGGGTTTATTTGTTC 0: 1
1: 0
2: 0
3: 16
4: 134
Right 1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 66
1084396163_1084396166 24 Left 1084396163 11:68911871-68911893 CCTGGGTCAGGGTTTATTTGTTC 0: 1
1: 0
2: 0
3: 16
4: 134
Right 1084396166 11:68911918-68911940 CTCCGTGTGCACGCCCGTGCAGG 0: 1
1: 0
2: 1
3: 3
4: 65
1084396163_1084396167 25 Left 1084396163 11:68911871-68911893 CCTGGGTCAGGGTTTATTTGTTC 0: 1
1: 0
2: 0
3: 16
4: 134
Right 1084396167 11:68911919-68911941 TCCGTGTGCACGCCCGTGCAGGG 0: 1
1: 0
2: 2
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084396163 Original CRISPR GAACAAATAAACCCTGACCC AGG (reversed) Intronic
905521964 1:38607574-38607596 GAACAAACAAATCCCTACCCAGG + Intergenic
908100669 1:60787864-60787886 GAACAATTAAGCTCTGGCCCAGG - Intergenic
908763464 1:67533335-67533357 AAACAAATCAACCGTGACCCTGG - Intergenic
911488095 1:98527445-98527467 AAACAAATAAGCCCAGAGCCTGG - Intergenic
915092840 1:153438639-153438661 GAAGAACTAAACCCTGAGCAGGG + Intronic
915569507 1:156736711-156736733 GAACAGAAAGAGCCTGACCCAGG - Exonic
915906058 1:159878113-159878135 GAACACAGGTACCCTGACCCTGG + Intronic
919339225 1:196282274-196282296 GAACAAAGAAACCCAGATCCTGG + Exonic
921710178 1:218365745-218365767 GGAGAAATTCACCCTGACCCTGG - Intronic
1064930677 10:20622529-20622551 GAACAAATAATCCCAGAACAAGG + Intergenic
1065425054 10:25592912-25592934 AAAAAAAAAAAGCCTGACCCAGG + Intronic
1065643053 10:27804759-27804781 AAACAAAAAAAACCTGACCCTGG - Intergenic
1066436068 10:35397626-35397648 TACCAAATGAACCCTGTCCCTGG + Intronic
1068954302 10:62807491-62807513 GAACAAATACTCCCTCACCCTGG - Exonic
1073138569 10:101232942-101232964 GAAAGAATAAACCTGGACCCTGG - Intergenic
1078010738 11:7571220-7571242 AAACAAAGAAACCCAGACCCAGG + Intronic
1078702100 11:13696213-13696235 GAACAAATAACCCCTCACTGGGG - Intronic
1078941961 11:16016560-16016582 GAACAAATTAACCCAGATGCAGG + Intronic
1079287905 11:19156164-19156186 TAACAATTAAAACGTGACCCAGG - Intronic
1084396163 11:68911871-68911893 GAACAAATAAACCCTGACCCAGG - Intronic
1085336026 11:75696508-75696530 CAACAAAAAAGCCCTGACTCAGG - Intergenic
1090365522 11:126202185-126202207 GAACATATAAAGACTGTCCCGGG + Exonic
1090857648 11:130624209-130624231 GTACACAGAAACCCAGACCCAGG - Intergenic
1092816171 12:12314097-12314119 AAACAAACAAACACTGACGCTGG - Intergenic
1093063745 12:14634305-14634327 GAAGAAATAAAGGCTGTCCCAGG + Intronic
1093516873 12:19997992-19998014 GAATAAATAAATCCTGGGCCTGG - Intergenic
1094347430 12:29486074-29486096 CAACATTTAAAACCTGACCCTGG - Intronic
1094462179 12:30708326-30708348 GAAAAAATGTACCCTGACACAGG - Intergenic
1095702363 12:45203369-45203391 GAACAAATCAGCCCAGTCCCTGG + Intergenic
1096429013 12:51527983-51528005 AAACAAAGAAAACCTGCCCCTGG + Intergenic
1097367446 12:58733013-58733035 AAACAAATACAACTTGACCCAGG + Intronic
1100055014 12:90498307-90498329 AAACAAATAACCCCTCAACCTGG - Intergenic
1101489474 12:105197908-105197930 GAAGAAATAAAGCCTCTCCCAGG + Exonic
1101844219 12:108349566-108349588 GAGCAAATAAACTCAGTCCCTGG - Intergenic
1104601592 12:130157560-130157582 CAACAAATTAACCCTTAACCTGG - Intergenic
1109521775 13:63522729-63522751 AAACAAATAAAAACTAACCCTGG - Intergenic
1109953426 13:69533274-69533296 GAACAAATTAAATGTGACCCAGG + Intergenic
1112207145 13:97336047-97336069 GAATTAATAAAGACTGACCCTGG + Intronic
1112562622 13:100527444-100527466 AAAAAAAAAATCCCTGACCCTGG - Intronic
1112676128 13:101704196-101704218 GAACAAATGCACCCAGACACAGG - Intronic
1113119772 13:106913808-106913830 GAACAAAAAGAGCTTGACCCTGG + Intergenic
1113204596 13:107901682-107901704 GACAAAATAAAACCTGTCCCCGG + Intergenic
1113867153 13:113534186-113534208 GAACAAAGAAATCCTGATCTTGG + Exonic
1114399417 14:22395801-22395823 GAACAAGGAAACCCAGATCCAGG + Intergenic
1117630813 14:57689478-57689500 GAACAAAAAAACCCTGCTCCCGG + Intronic
1118640281 14:67785815-67785837 GAACAAATAAAAGCTGAACTGGG - Intronic
1122023319 14:98857333-98857355 GAAAAAAAAAACCTAGACCCAGG - Intergenic
1124460342 15:29884469-29884491 CAACAAAGAAACTCTTACCCAGG + Intronic
1127798739 15:62459711-62459733 AAACAACTAAAGCCTGCCCCAGG - Intronic
1128916907 15:71571348-71571370 AGATAAATAAACCCTGGCCCAGG + Intronic
1129157333 15:73726868-73726890 GAAAGACAAAACCCTGACCCTGG + Intergenic
1129170547 15:73804884-73804906 CAGAAAATAAACCCTGAGCCTGG - Intergenic
1130913681 15:88288838-88288860 GAACAAGAAAAACCTGCCCCGGG + Intergenic
1131865846 15:96708641-96708663 GAACAAATAAACAAAGACACTGG - Intergenic
1135293665 16:21261344-21261366 AAACAAACATACGCTGACCCAGG + Intronic
1137492906 16:48948008-48948030 TCACAAGTTAACCCTGACCCAGG - Intergenic
1138390327 16:56665943-56665965 GAACAAATGAAGCCTGACCTTGG + Intronic
1138391327 16:56671907-56671929 GAACAAATGAAGCCTGACCTTGG - Intronic
1139634678 16:68250873-68250895 AAACAACAAAAACCTGACCCTGG + Intronic
1140069660 16:71638179-71638201 TAACAAATAAAAGCTGACCTCGG + Intronic
1142468558 17:149122-149144 GAAGAAAAAAACCCTGAACCCGG - Exonic
1142641030 17:1286097-1286119 GAAGAAAGACACCCTGTCCCTGG + Intronic
1143241032 17:5443425-5443447 GTACAAATCAACCTTCACCCAGG + Exonic
1146629706 17:34460938-34460960 GAACAAACACACCCTCACCGGGG + Intergenic
1151649427 17:75457022-75457044 CAACAAAGAATCCCTGCCCCAGG + Intronic
1156022631 18:32617325-32617347 GAAGAAATCAAACCTGACCTTGG - Intergenic
1156987912 18:43371018-43371040 GCACAAATCAACCCTGGACCAGG - Intergenic
1157192970 18:45596806-45596828 GATCAATTAAACACTGATCCAGG - Intronic
1157407219 18:47432161-47432183 GAAAAAATAAACCTTGAAGCAGG + Intergenic
1159119331 18:64150953-64150975 AAACAAACAAACCCTGAAGCTGG - Intergenic
1159264905 18:66068416-66068438 TAACAAAAACACCCTGAGCCGGG - Intergenic
1162391746 19:10394109-10394131 CAACAAAAAAACCCTGAGGCTGG + Intronic
1163283134 19:16329470-16329492 GTACAAAGAAAACCTCACCCTGG + Intergenic
1163319876 19:16568355-16568377 CCACAAATAAGCCCTGCCCCTGG - Intronic
1164042801 19:21508273-21508295 GACAAAAGAAACCCTGACCCCGG + Intronic
1164527959 19:29025720-29025742 AATAAAATAAACCCTGAGCCAGG + Intergenic
1164764236 19:30751408-30751430 AAACAAATGGACCCTGACACTGG - Intergenic
1166035705 19:40166731-40166753 AAATAAATAAACCCTGACACGGG + Intergenic
925447922 2:3943392-3943414 GAACAGGCAGACCCTGACCCAGG - Intergenic
926881295 2:17547168-17547190 GAACTAATAAACTATGGCCCTGG - Intronic
927473329 2:23393095-23393117 GAACCACTAATCGCTGACCCGGG + Intronic
927999848 2:27513982-27514004 GAACACAAAACCACTGACCCAGG + Intronic
928387782 2:30884563-30884585 GACCACTTAACCCCTGACCCTGG - Intergenic
929816657 2:45237956-45237978 GAACTGATAATCCCTGCCCCAGG - Intergenic
934579744 2:95428459-95428481 GAACACACACACCCTGACCATGG - Intergenic
934599703 2:95648266-95648288 GAACACACACACCCTGACCATGG + Intergenic
936589103 2:113785906-113785928 GAACAATTAAATTATGACCCGGG - Intergenic
937430284 2:121832318-121832340 TAACAAATCAGCCCTGCCCCAGG + Intergenic
937436249 2:121884402-121884424 GAACAAAGCAACCCTAACCTAGG + Intergenic
937815129 2:126243006-126243028 GAAGAAATGAACCCTGACGGAGG + Intergenic
937949140 2:127370311-127370333 GAACAAATGAACTCAGACACAGG - Intronic
941924919 2:170885126-170885148 GAACACATAAACACTGGGCCAGG + Intergenic
942116900 2:172736343-172736365 GAGAAAATAAACCCCCACCCAGG - Intronic
945262871 2:207860975-207860997 GAACAAGGAAAACCTGATCCAGG + Intronic
948379200 2:237541228-237541250 GAACACACAATCCCTGACCCAGG + Intronic
1173984367 20:47249795-47249817 GAACAAAGCAACACTGAGCCTGG + Intronic
1174997199 20:55583457-55583479 GAAAAAATAAAGCCTGGGCCTGG - Intergenic
1178454973 21:32740547-32740569 GAACAAGTAAACCTTAATCCAGG + Intronic
1184269441 22:43370379-43370401 GAAGAAATAAACACTGTTCCCGG - Intergenic
1184554265 22:45224863-45224885 TAACACAGAACCCCTGACCCAGG - Intronic
950110131 3:10413444-10413466 GAACGAATGAACCCAGAGCCAGG + Intronic
952078006 3:29721956-29721978 AAACAAATAAACACTGTCCAAGG + Intronic
955474799 3:59325777-59325799 AAACAAAAAAAACCTGAGCCTGG + Intergenic
956775122 3:72558622-72558644 CAACAAAAAAACCCTGAGACTGG - Intergenic
957480744 3:80790132-80790154 GAAAAAAGAAACCCTGGCTCTGG + Intergenic
961910683 3:130313246-130313268 GAACACATACACCCATACCCAGG - Intergenic
961955430 3:130797414-130797436 GAACAAAAAAACCATGAGCCGGG - Intergenic
963273312 3:143306631-143306653 AAATACATAAAACCTGACCCAGG + Intronic
964732630 3:159883439-159883461 GAACAGATAACCCCTGTTCCAGG - Intronic
971306166 4:25483508-25483530 GAAGAAACACACCCTTACCCGGG + Intergenic
974912972 4:68146090-68146112 GAACAAAGAAACCATGTACCAGG - Intergenic
975938193 4:79607552-79607574 GAACAAATGATCCTTCACCCAGG + Intergenic
982813707 4:159858736-159858758 AAACAAAGAAAACCTGAGCCAGG + Intergenic
986617629 5:9635973-9635995 GAACAAACAAACCCCAAACCTGG - Intronic
987967375 5:24893733-24893755 GGAAAAATAATCCCTGAACCAGG - Intergenic
990267931 5:54098548-54098570 GAAGAAAAAAACCCTGAGCGTGG + Intronic
992619053 5:78574463-78574485 TACCAACTGAACCCTGACCCTGG + Intronic
993238472 5:85346867-85346889 GAACATACAAACCCTGACACTGG - Intergenic
993279214 5:85904234-85904256 CATCAAATAAAACATGACCCAGG - Intergenic
993962465 5:94316688-94316710 GAACAACTAAAGCCTGACGGAGG - Intronic
994668185 5:102732791-102732813 GAAAAAAGAAAACCAGACCCAGG + Intergenic
995097924 5:108261366-108261388 GGACAAATAAACCCATACCATGG + Intronic
996377356 5:122825845-122825867 AAACAAAAAAACCCTGTCACTGG - Intronic
996816580 5:127580731-127580753 CAACAAATAAATCCTGCCACTGG + Intergenic
1000701548 5:164457487-164457509 GAAAAAATAAAGAATGACCCTGG + Intergenic
1006966180 6:37987813-37987835 GACCAAACAAACCATGACCGAGG - Intronic
1013148699 6:107423063-107423085 AAACAAAAAAAGCCTGACCAGGG + Intronic
1013350852 6:109304358-109304380 GAACACACAACACCTGACCCTGG + Intergenic
1013953346 6:115811647-115811669 GAAGAAATAACCCATGACACTGG + Intergenic
1014143369 6:117969472-117969494 AAACAAATAAACCCAGGCCAAGG + Intronic
1018274996 6:162120988-162121010 GAACAAATAAACACAGCTCCTGG + Intronic
1018658294 6:166061654-166061676 GAACCAGTAAACCCTGGCCATGG - Intergenic
1027340254 7:77199860-77199882 GAACACAGAAAGCCTGACTCAGG - Intronic
1028088882 7:86672573-86672595 AAACAAAAAAACCCTGCCCCAGG - Intronic
1031044911 7:116876748-116876770 GAACATACAAAACCTGACACTGG + Intronic
1032527948 7:132593974-132593996 GAACCAAGAGACCCAGACCCAGG + Intronic
1039761918 8:40585782-40585804 GAAGAAATAAACCCTGAAGCTGG - Intronic
1042951386 8:74203889-74203911 GAACACACAACCCCTGCCCCAGG - Intergenic
1043184032 8:77122286-77122308 CAACAAAAAAACGCTGTCCCAGG - Intergenic
1044600848 8:94003211-94003233 CAACAACAAAACCCTGACACTGG - Intergenic
1050884967 9:10752637-10752659 GAACAAATAATTCCTGAGTCCGG + Intergenic
1055887030 9:81075571-81075593 GAAGATTTAAATCCTGACCCAGG - Intergenic
1056747910 9:89320382-89320404 GAACAAATGAACCTTGAAACGGG - Intronic
1058648203 9:107150374-107150396 GAACAGAGAAACCATGATCCAGG - Intergenic
1062659452 9:137621288-137621310 CAATTAATGAACCCTGACCCAGG - Intronic
1191611961 X:63125895-63125917 GAACAACTATACACTGACACTGG + Intergenic
1194038884 X:88915381-88915403 GAGCAAATTGTCCCTGACCCTGG + Intergenic
1196970962 X:121108220-121108242 AACCAAATACACCCTGAACCAGG + Intergenic
1197140400 X:123111511-123111533 AAACAAATACACCCTGTCCTAGG - Intergenic
1200768581 Y:7102816-7102838 GAACTAAGAAAGCCTGAGCCAGG + Intergenic
1201942647 Y:19476497-19476519 GTACACATAATCCCTGAGCCAGG + Intergenic